This work was supported by the National Natural Science Foundation of China (82160550).

TMEM200A: A Novel Oncogene Regulating EMT and PI3K/AKT in Gastric Cancer

<ol>
	<li>Torre, L. A., Siegel, R. L., Ward, E. M., Jemal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+cancer+incidence+and+mortality+rates+and+trends--an+update.">Global cancer incidence and mortality rates and trends--an update.</a> Cancer Epidemiol Biomarkers Prev. 25 (1), 16-27 (2016).</li><li>Long, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+of+malignant+tumors+-+Yichang+City,+Hubei+Province,+China,+2019.">Economic burden of malignant tumors - Yichang City, Hubei Province, China, 2019.</a> China CDC Wkly. 4 (15), 312-316 (2022).</li><li>Harbeck, N., Gnant, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breast+cancer.">Breast cancer.</a> Lancet. 389 (10074), 1134-1150 (2017).</li><li>Bagchi, S., Yuan, R., Engleman, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+the+treatment+of+cancer:+clinical+impact+and+mechanisms+of+response+and+resistance.">Immune checkpoint inhibitors for the treatment of cancer: clinical impact and mechanisms of response and resistance.</a> Annu Rev Pathol. 16, 223-249 (2021).</li><li>Lam, G. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pitfalls+in+cutaneous+melanoma+diagnosis+and+the+need+for+new+reliable+markers.">Pitfalls in cutaneous melanoma diagnosis and the need for new reliable markers.</a> Mol Diagn Ther. 27 (1), 49-60 (2023).</li><li>Gromiha, M. M., Ou, Y. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatics+approaches+for+functional+annotation+of+membrane+proteins.">Bioinformatics approaches for functional annotation of membrane proteins.</a> Brief Bioinform. 15 (2), 155-168 (2014).</li><li>Schmit, K., Michiels, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM+proteins+in+cancer:+a+review.">TMEM proteins in cancer: a review.</a> Front Pharmacol. 9, 1345 (2018).</li><li>Marx, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmembrane+(TMEM)+protein+family+members:+Poorly+characterized+even+if+essential+for+the+metastatic+process.">Transmembrane (TMEM) protein family members: Poorly characterized even if essential for the metastatic process.</a> Semin Cancer Biol. 60, 96-106 (2020).</li><li>Fu, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+transmembrane+protein+168+in+the+mouse+nucleus+accumbens+induces+anxiety+and+sensorimotor+gating+deficit.">Overexpression of transmembrane protein 168 in the mouse nucleus accumbens induces anxiety and sensorimotor gating deficit.</a> PLoS One. 12 (12), e0189006 (2017).</li><li>Cuajungco, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Abnormal+accumulation+of+human+transmembrane+(TMEM)-176A+and+176B+proteins+is+associated+with+cancer+pathology.">Abnormal accumulation of human transmembrane (TMEM)-176A and 176B proteins is associated with cancer pathology.</a> Acta Histochem. 114 (7), 705-712 (2012).</li><li>Zhang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TMEM116+is+required+for+lung+cancer+cell+motility+and+metastasis+through+PDK1+signaling+pathway.">TMEM116 is required for lung cancer cell motility and metastasis through PDK1 signaling pathway.</a> Cell Death Dis. 12 (12), 1086 (2021).</li><li>Zhang, N., Pan, H., Liang, X., Xie, J., Han, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+roles+of+transmembrane+family+proteins+in+the+regulation+of+store-operated+Ca(2+)+entry.">The roles of transmembrane family proteins in the regulation of store-operated Ca(2+) entry.</a> Cell Mol Life Sci. 79 (2), 118 (2022).</li><li>Zhang, X., Zheng, P., Li, Z., Gao, S., Liu, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+somatic+mutation+landscape+and+RNA+prognostic+markers+in+stomach+adenocarcinoma.">The somatic mutation landscape and RNA prognostic markers in stomach adenocarcinoma.</a> Onco Targets Ther. 13, 7735-7746 (2020).</li><li>Jia, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mining+TCGA+database+for+genes+of+prognostic+value+in+glioblastoma+microenvironment.">Mining TCGA database for genes of prognostic value in glioblastoma microenvironment.</a> Aging (Albany NY). 10 (4), 592-605 (2018).</li><li>Wang, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UCSCXenaShiny:+an+R/CRAN+package+for+interactive+analysis+of+UCSC+Xena+data.">UCSCXenaShiny: an R/CRAN package for interactive analysis of UCSC Xena data.</a> Bioinformatics. 38 (2), 527-529 (2022).</li><li>Li, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TIMER2.0+for+analysis+of+tumor-infiltrating+immune+cells.">TIMER2.0 for analysis of tumor-infiltrating immune cells.</a> Nucleic Acids Res. 48 (W1), W509-W514 (2020).</li><li>Thul, P. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+subcellular+map+of+the+human+proteome.">A subcellular map of the human proteome.</a> Science. 356 (6340), eaal3321 (2017).</li><li>Li, Y., Ge, D., Lu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SMART+App:+an+interactive+web+application+for+comprehensive+DNA+methylation+analysis+and+visualization.">The SMART App: an interactive web application for comprehensive DNA methylation analysis and visualization.</a> Epigenetics Chromatin. 12 (1), 71 (2019).</li><li>Chandrashekar, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UALCAN:+An+update+to+the+integrated+cancer+data+analysis+platform.">UALCAN: An update to the integrated cancer data analysis platform.</a> Neoplasia. 25, 18-27 (2022).</li><li>Tate, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=COSMIC:+the+Catalogue+Of+Somatic+Mutations+In+Cancer.">COSMIC: the Catalogue Of Somatic Mutations In Cancer.</a> Nucleic Acids Res. 47 (D1), D941-D947 (2019).</li><li>Gao, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+analysis+of+complex+cancer+genomics+and+clinical+profiles+using+the+cBioPortal.">Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal.</a> Sci Signal. 6 (269), pl1 (2013).</li><li>Shen, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sangerbox:+A+comprehensive,+interaction-friendly+clinical+bioinformatics+analysis+platform.">Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform.</a> iMeta. 1 (3), e36 (2022).</li><li>Ru, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISIDB:+an+integrated+repository+portal+for+tumor-immune+system+interactions.">TISIDB: an integrated repository portal for tumor-immune system interactions.</a> Bioinformatics. 35 (20), 4200-4202 (2019).</li><li>Yuan, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CancerSEA:+a+cancer+single-cell+state+atlas.">CancerSEA: a cancer single-cell state atlas.</a> Nucleic Acids Res. 47 (D1), D900-D908 (2019).</li><li>Sun, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TISCH:+a+comprehensive+web+resource+enabling+interactive+single-cell+transcriptome+visualization+of+tumor+microenvironment.">TISCH: a comprehensive web resource enabling interactive single-cell transcriptome visualization of tumor microenvironment.</a> Nucleic Acids Res. 49 (D1), D1420-D1430 (2021).</li><li>Warde-Farley, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+GeneMANIA+prediction+server:+biological+network+integration+for+gene+prioritization+and+predicting+gene+function.">The GeneMANIA prediction server: biological network integration for gene prioritization and predicting gene function.</a> Nucleic Acids Res. 38, W214-W220 (2010).</li><li>Zhu, Y., Feng, S., Song, Z., Wang, Z., Chen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+immunological+characteristics+and+immune+subtypes+based+on+single-sample+gene+set+enrichment+analysis+algorithm+in+lower-grade+glioma.">Identification of immunological characteristics and immune subtypes based on single-sample gene set enrichment analysis algorithm in lower-grade glioma.</a> Front Genet. 13, 894865 (2022).</li><li>Mueller Bustin, S. A., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+reverse+transcription+PCR+(qRT-PCR)+and+its+potential+use+in+clinical+diagnosis.">Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis.</a> Clin Sci (Lond). 109 (4), 365-379 (2005).</li><li>Sun, L., Zhang, H., Gao, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+reprogramming+and+epigenetic+modifications+on+the+path+to+cancer.">Metabolic reprogramming and epigenetic modifications on the path to cancer.</a> Protein Cell. 13 (12), 877-919 (2022).</li><li>Ntontsi, P., Photiades, A., Zervas, E., Xanthou, G., Samitas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetics+and+epigenetics+in+asthma.">Genetics and epigenetics in asthma.</a> Int J Mol Sci. 22 (5), 2412 (2021).</li><li>Mart&#237;nez-Reyes, I., Chandel, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+metabolism:+looking+forward.">Cancer metabolism: looking forward.</a> Nat Rev Cancer. 21 (10), 669-680 (2021).</li><li>Chen, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PremPS:+Predicting+the+impact+of+missense+mutations+on+protein+stability.">PremPS: Predicting the impact of missense mutations on protein stability.</a> PLoS Comput Biol. 16 (12), e1008543 (2020).</li><li>Li, M., Petukh, M., Alexov, E., Panchenko, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predicting+the+impact+of+missense+mutations+on+protein-protein+binding+affinity.">Predicting the impact of missense mutations on protein-protein binding affinity.</a> J Chem Theory Comput. 10 (4), 1770-1780 (2014).</li><li>Hirsch, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+responses+to+PD-1+inhibition+and+their+molecular+characterization+in+six+patients+with+mismatch+repair-deficient+metastatic+cancer+of+the+digestive+system.">Clinical responses to PD-1 inhibition and their molecular characterization in six patients with mismatch repair-deficient metastatic cancer of the digestive system.</a> J Cancer Res Clin Oncol. 147 (1), 263-273 (2021).</li><li>Poulogiannis, G., Frayling, I. M., Arends, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+mismatch+repair+deficiency+in+sporadic+colorectal+cancer+and+Lynch+syndrome.">DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch syndrome.</a> Histopathology. 56 (2), 167-179 (2010).</li><li>Chintamani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+expression+of+mismatched+repair+genes+and+their+correlation+with+clinicopathological+parameters+and+response+to+neo-adjuvant+chemotherapy+in+breast+cancer.">The expression of mismatched repair genes and their correlation with clinicopathological parameters and response to neo-adjuvant chemotherapy in breast cancer.</a> Int Semin Surg Oncol. 4, 5 (2007).</li><li>Deng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+expression+of+TMEM200A+is+associated+with+a+poor+prognosis+and+immune+infiltration+in+gastric+cancer.">High expression of TMEM200A is associated with a poor prognosis and immune infiltration in gastric cancer.</a> Pathol Oncol Res. 29, 1610893 (2023).</li><li>Stemmler, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cadherins+in+development+and+cancer.">Cadherins in development and cancer.</a> Mol Biosyst. 4 (8), 835-850 (2008).</li><li>Bill, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ANO1/TMEM16A+interacts+with+EGFR+and+correlates+with+sensitivity+to+EGFR-targeting+therapy+in+head+and+neck+cancer.">ANO1/TMEM16A interacts with EGFR and correlates with sensitivity to EGFR-targeting therapy in head and neck cancer.</a> Oncotarget. 6 (11), 9173-9188 (2015).</li><li>De Las Rivas, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+drug+resistance+induced+by+EMT:+novel+therapeutic+strategies.">Cancer drug resistance induced by EMT: novel therapeutic strategies.</a> Arch Toxicol. 95 (7), 2279-2297 (2021).</li><li>Tian, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SERPINH1+regulates+EMT+and+gastric+cancer+metastasis+via+the+Wnt/&#946;-catenin+signaling+pathway.">SERPINH1 regulates EMT and gastric cancer metastasis via the Wnt/&#946;-catenin signaling pathway.</a> Aging (Albany NY). 12 (4), 3574-3593 (2020).</li></ol>

The authors declare there are no conflicts of interest.

TMEM200A belongs to a family of TMEMs that is essential for cancer cells to proliferate38. The variable expression of TMEM200A in different malignancies has received less attention, and a thorough pan-cancer investigation is lacking. However, evidence continues to accumulate, showing that the TMEM transmembrane protein family may be important in keeping cancer cells malignant through interactions with several proteins, for example, activation of TMEM16A Ca2+-activated ...

Cancer has emerged as a persistent public health issue endangering human health globally1due to its high morbidity and mortality rates worldwide, posing a heavy financial and medical burden to society2. Significant advancements in cancer therapy have been achieved in recent years thanks to the discovery of cancer markers3, and researchers have developed novel diagnostic methods and new drugs to treat cancer. However, some patients with cancer still have poor prognoses because of factors such as medication resistance, side effects of drugs, and chemical sensitivity4. Therefore, there is an urgent need for identifying new biomarkers for screening and treating early-stage cancers5.
Membrane proteins are proteins that can bind and integrate into cells and organelle membranes6. These can be grouped into three categories depending on the strength of binding to the membrane and their location: lipid-anchored proteins, integral proteins, and peripheral membrane proteins7,8. A transmembrane (TMEM) protein is an integral membrane protein that consists of at least one transmembrane segment9, which passes either completely or partially through the biological membrane. 
Although the mechanisms of action of proteins belonging to the TMEM family are not well understood, these proteins are known to be involved in several types of cancers10. Several TMEM proteins are associated with migratory, proliferative, and invasive phenotypes, and their expression is often associated with a patient's prognosis11. Therefore, TMEM family members have become the target of research. A comprehensive review of existing reports on TMEM revealed that they are mostly associated with inter- and intracellular signaling12, immune-related diseases, and tumorigenesis10. Many TMEMs also possess important physiological functions, for example, ion channels in the plasma membrane, activation of signal transduction pathways, as well as the mediation of cell chemotaxis, adhesion, apoptosis, and autophagy10. Therefore, we hypothesized that TMEM proteins may be important prognostic markers in the detection and treatment of tumors.
TMEM200A expression is significantly elevated in gastric cancer (GC). Higher expression of TMEM200A13, which has eight exons and a full length of 77.536 kb on chromosome 6q23.1, has been linked to a poor prognosis for overall survival (OS) in cases of GC. Yet the changes in its expression have rarely been reported in oncology studies. This article compares and analyzes the usefulness of TMEM200A as a therapeutic target and tumor diagnostic marker in various cancer studies using different publicly available datasets. We assessed the effectiveness of TMEM200A as a pan-cancer diagnostic and prognostic biomarker as well as its expression levels in various human cancer types using RNA-seq data from the UCSC Xena and TCGA databases, as well as by real-time quantitative polymerase chain reaction (qRT-PCR) and western blotting. 
The effect of TMEM200A expression levels on mutation rates, regulatory processes, tumor diagnosis and prognosis, immune infiltration, and immunotherapy was further investigated using a mix of computational tools and dataset websites. CBioPortal and the Catalog of Somatic Mutations in Cancer Cells (COSMIC) databases were used to examine mutations in TMEM200A. Sangerbox and TISIDB websites were utilized to understand how TMEM200A influences immune infiltration. The Tumor Immune Single Cell Center (TISCH) online tool and CancerSEA database were used to investigate the function of TMEM200A. Finally, to assess the impact of TMEM200A on the malignant behavior and tumor development function of GC cells, a loss-of-function experiment was conducted in an in vitro assay. Additionally, western blotting was performed to assess how TMEM200A knockdown affected the PI3K/AKT signaling pathway and the epithelial-mesenchymal transition (EMT) in GC.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Anti-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>60203-2-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-E-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>20874-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10494-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-N-cadherin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>22018-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-P-AKT antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>66444-1-Ig</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-snail antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>13099-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Vimentin antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>10366-1-AP</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyPrepMultisourceTotalRNAMini- 
			prep Kit</td>
			<td>Suzhou Youyi Landi Biotechnology Co., Ltd</td>
			<td>UEL-UE-MN-MS-RNA-50G</td>
			<td></td>
		</tr>
		<tr>
			<td>BCA Protein Assay Kit</td>
			<td>Epizyme Biotech</td>
			<td>ZJ101L</td>
			<td></td>
		</tr>
		<tr>
			<td>CCK-8 reagent</td>
			<td>MedChemExpress</td>
			<td>HY-K0301-500T</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)</td>
			<td>CYAGEN BIOSCIENCES (GUANGZHOU) INC</td>
			<td>FBSSR-01021</td>
			<td></td>
		</tr>
		<tr>
			<td>GAPDH primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): TGACATCAAGAAGGTG 
			GTGAAGCAG; Reverse primer (5&#8217;-3&#8217;): GTGTCGCTGTTGAAG 
			TCAGAGGAG</td>
		</tr>
		<tr>
			<td>HighGene plus Transfection reagent</td>
			<td>ABclonal</td>
			<td>RM09014P</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Mouse lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-1</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP-conjugated Affinipure Goat Anti-Rabbit lgG (H+L)</td>
			<td>Proteintech Group, Inc</td>
			<td>SA00001-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Human gastric mucosal epithelial GES-1 cells</td>
			<td>Guangzhou Cellcook Biotech Co.,Ltd.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD HGC-27 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Human STAD SGC-7901 cells</td>
			<td>Procell Life Science&#38;Technology Co.,Ltd</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MonAmp SYBR Green qPCR Mix (None ROX)</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MQ10101S</td>
			<td></td>
		</tr>
		<tr>
			<td>MonScript RTIII All-in-One Mix with dsDNase&#160;&#160;</td>
			<td>Mona (Suzhou) Biotechnology Co., Ltd</td>
			<td>MR05101M</td>
			<td></td>
		</tr>
		<tr>
			<td>Omni-ECL Femto Light Chemiluminescence Kit</td>
			<td>Epizyme Biotech</td>
			<td>SQ201</td>
			<td></td>
		</tr>
		<tr>
			<td>PAGE Gel Fast Preparationb Kit&#160;</td>
			<td>Epizyme Biotech</td>
			<td>PG111</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-streptomycin (Pen-Strep)</td>
			<td>Beijing Solarbio Science &#38; Technology Co.,Ltd</td>
			<td>P1400-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyvinylidene difluoride (PVDF) membrane</td>
			<td>Merck KGaA</td>
			<td>IPVH00010-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein Free Rapid Blocking Buffer</td>
			<td>Epizyme Biotech</td>
			<td>PS108P</td>
			<td></td>
		</tr>
		<tr>
			<td>RIPA lysis solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>R0010</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 complete medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>C11875500BT</td>
			<td></td>
		</tr>
		<tr>
			<td>Skimmed milk</td>
			<td>Campina: Elk</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TBST buffer solution</td>
			<td>Beijing Solarbio Science &#38; Technology Co., Ltd</td>
			<td>T1082</td>
			<td></td>
		</tr>
		<tr>
			<td>The protein loading buffer</td>
			<td>Epizyme Biotech</td>
			<td>LT101S</td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A knockdown plasmid</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>TMEM200A primer</td>
			<td>Sangon Biotech (Shanghai) Co., Ltd.</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): AAGGCGGTGTGGTGGTTCG; Reverse primer (5&#8217;-3&#8217;): GATTTTGGTCTCTTTGTCACGGTT</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA1</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACTGATGATAAGACCAG; Reverse primer (5&#8217;-3&#8217;): TGTTGACTACTATTCTGGTC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA2</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): CGTGTGAATGTCAATGACTG; Reverse primer (5&#8217;-3&#8217;): GCACACTTACAGTTACTGAC</td>
		</tr>
		<tr>
			<td>TMEM200A SiRNA3</td>
			<td>MiaoLing Plasmid</td>
			<td></td>
			<td>Forward primer (5&#8217;-3&#8217;): ACAACCACAACATCTGCCCG; Reverse primer (5&#8217;-3&#8217;): TGTTGGTGTTGTAGACGGGC</td>
		</tr>
		<tr>
			<td>Transmembrane protein 200A Antibody</td>
			<td>Proteintech Group, Inc</td>
			<td>48081-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 cell culture incubator</td>
			<td>Haier Group</td>
			<td>PYXE-80IR</td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence quantitative PCR instrument</td>
			<td>Bio-RAD</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gel Imaging System (Tanon 5200)</td>
			<td>Tanon Science &#38; Technology Co., Ltd</td>
			<td>LAB-0002-0007-SHTN</td>
			<td></td>
		</tr>
		<tr>
			<td>Multifunctional Enzyme Labeler</td>
			<td>Berthold</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

multiomics analysis of tmem200a as a pan-cancer biomarker

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in common cancers by multiomics analysis and used in vitro cell cultures of gastric cells to verify the results. The expression of TMEM200A in several human cancer types was assessed using the RNA-seq data from the UCSC Xena database. Bioinformatic analysis revealed a potential role of TMEM200A as a diagnostic and prognostic biomarker. 
Cultures of normal gastric and cancer cell lines were grown and TMEM200A was knocked down. The expression levels of TMEM200A were measured by using quantitative real-time polymerase chain reaction and western blotting. In vitro loss-of-function studies were then used to determine the roles of TMEM200A in the malignant behavior and tumor formation of gastric cancer (GC) cells. Western blots were used to assess the effect of the knockdown on epithelial-mesenchymal transition (EMT) and PI3K/AKT signaling pathway in GC. Bioinformatic analysis showed that TMEM200A was expressed at high levels in GC. 
The proliferation of GC cells was inhibited by TMEM200A knockdown, which also decreased vimentin, N-cadherin, and Snai proteins, and inhibited AKT phosphorylation. The PI3K/AKT signaling pathway also appeared to be involved in TMEM200A-mediated regulation of GC development. The results presented here suggest that TMEM200A regulates the tumor microenvironment by affecting the EMT. TMEM200A may also affect EMT through PI3K/AKT signaling, thus influencing the tumor microenvironment. Therefore, in pan-cancers, especially GC, TMEM200A may be a potential biomarker and oncogene.

Expression of TMEM200A in various cancers 
As illustrated in Figure 1, we first analyzed the differential expression levels of TMEM200A in various cancers through different databases. TMEM200A expression was elevated in cholangiocarcinoma (CHOL), head and neck squamous cell carcinoma (HNSC), renal clear cell carcinoma (KIRC), renal papillary cell carcinoma (KIRP), hepatocellular carcinoma (LIHC), STAD, and thyroid carcinoma (T...

Watch this Scientific Journal Video about Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies at JoVE.com

Author Spotlight: Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies 

Here, a protocol is presented in which multiple bioinformatic tools are combined to study the biological functions of TMEM200A in cancer. In addition, we also experimentally validate the bioinformatics predictions.

Multiomics Analysis of TMEM200A as a Pan-Cancer Biomarker

The transmembrane protein, TMEM200A, is known to be associated with human cancers and immune infiltration. Here, we assessed the function of TMEM200A in ...

Significant advancements have been made in the investigation of cancer biomarkers. Nevertheless, the extract function of tumor-related matters associated with transmembrane protein family remains unidentified. As a result, our research on the TMEM200A in gastric cancer has generated novel research directions for related cells.In this study, we used the combination of online database prediction and experimental technique validation, which simplifies the research steps and the stem cell cost of experiment in related field. In future, our laboratory will focus on exploring the specific mechanism of tumor in gastric cancer, searching for the association between glycosylation modification and the metabolic recording, and identifying find new targets for gastric cancer treatment.

multiomics-analysis-of-tmem200a-as-a-pan-cancer-biomarker

Research

JoVE Journal

Cancer Research

924 Views.  Youjiang Medical University for Nationalities. Significant advancements have been made in the investigation of cancer biomarkers. Nevertheless, the extract function of tumor-related matters associated with transmembrane protein family remains unidentified. As a result, our research on the TMEM200A in gastric cancer has generated novel research directions for related cells.In this study, we used the combination of online database prediction and experimental technique validation, which simplifies the research steps and the stem cell ...

Video: Author Spotlight: Unveiling Transmembrane Protein Family-Related Markers in Gastric Cancer and Implications for Targeted Therapies 

The Colon-26 Carcinoma Tumor-bearing Mouse as a Model for the Study of Cancer Cachexia

Cancer cachexia is the progressive loss of skeletal muscle mass and adipose tissue, negative nitrogen balance, anorexia, fatigue, inflammation, and activation of lipolysis and proteolysis systems. Cancer patients with cachexia benefit less from anti-neoplastic therapies and show increased mortality1. Several animal models have been established in order to investigate the molecular causes responsible for body and muscle wasting as a result of tumor growth. Here, we describe methodologies pertaining to a well-characterized model of cancer cachexia: mice bearing the C26 carcinoma2-4. Although this model is heavily used in cachexia research, different approaches make reproducibility a potential issue. The growth of the C26 tumor causes a marked and progressive loss of body and skeletal muscle mass, accompanied by reduced muscle cross-sectional area and muscle strength3-5. Adipose tissue is also lost. Wasting is coincident with elevated circulating levels of pro-inflammatory cytokines, particularly Interleukin-6 (IL-6)3, which is directly, although not entirely, responsible for C26 cachexia. It is well-accepted that a primary mechanism by which the C26 tumor induces muscle tissue depletion is the activation of skeletal muscle proteolytic systems. Thus, expression of muscle-specific ubiquitin ligases, such as atrogin-1/MAFbx and MuRF-1, represent an accepted method for the evaluation of the ongoing muscle catabolism2. Here, we present how to execute this model in a reproducible manner and how to excise several tissues and organs (the liver, spleen, and heart), as well as fat and skeletal muscles (the gastrocnemius, tibialis anterior, and quadriceps). We also provide useful protocols that describe how to perform muscle freezing, sectioning, and fiber size quantification.

Mice bearing the Colon-26 (C26) carcinoma represent a classical model of cancer cachexia. Progressive muscle wasting occurs in association with tumor growth, over-expression of muscle-specific ubiquitin ligases, and reductions in muscle cross-sectional area. Fat loss is also observed. Cachexia is studied in a time-dependent manner with increasing severity of wasting.

Cancer cachexia is the progressive loss of skeletal muscle mass and adipose tissue, negative nitrogen balance, anorexia, fatigue, inflammation, and ...

Simple and Rapid Method to Obtain High-quality Tumor DNA from Clinical-pathological Specimens Using Touch Imprint Cytology

It is critical to determine the mutational status in cancer before administration and treatment of specific molecular targeted drugs for cancer patients. In the clinical setting, formalin-fixed paraffin-embedded (FFPE) tissues are widely used for genetic testing. However, FFPE DNA is generally damaged and fragmented during the fixation process with formalin. Therefore, FFPE DNA is sometimes not adequate for genetic testing because of low quality and quantity of DNA. Here we present a method of touch imprint cytology (TIC) to obtain genomic DNA from cancer cells, which can be observed under a microscope. Cell morphology and cancer cell numbers can be evaluated using TIC specimens. Furthermore, the extraction of genomic DNA from TIC samples can be completed within two days. The total amount and quality of TIC DNA obtained using this method was higher than that of FFPE DNA. This rapid and simple method allows researchers to obtain high-quality DNA for genetic testing (e.g., next generation sequencing analysis, digital PCR, and quantitative real time PCR) and to shorten the turnaround time for reporting results.

Obtaining high-quality genomic DNA from tumor tissues is an essential first step for analyzing genetic alterations using next generation sequencing. In this article, we present a simple and rapid method to enrich tumor cells and obtain intact DNA from touch imprint cytology specimens.

It is critical to determine the mutational status in cancer before administration and treatment of specific molecular targeted drugs for cancer patients. ...

Selecting Multiple Biomarker Subsets with Similarly Effective Binary Classification Performances

Biomarker detection is one of the more important biomedical questions for high-throughput &#39;omics&#39; researchers, and almost all existing biomarker detection algorithms generate one biomarker subset with the optimized performance measurement for a given dataset. However, a recent study demonstrated the existence of multiple biomarker subsets with similarly effective or even identical classification performances. This protocol presents a simple and straightforward methodology for detecting biomarker subsets with binary classification performances, better than a user-defined cutoff. The protocol consists of data preparation and loading, baseline information summarization, parameter tuning, biomarker screening, result visualization and interpretation, biomarker gene annotations, and result and visualization exportation at publication quality. The proposed biomarker screening strategy is intuitive and demonstrates a general rule for developing biomarker detection algorithms. A user-friendly graphical user interface (GUI) was developed using the programming language Python, allowing biomedical researchers to have direct access to their results. The source code and manual of kSolutionVis can be downloaded from http://www.healthinformaticslab.org/supp/resources.php.

Existing algorithms generate one solution for a biomarker detection dataset. This protocol demonstrates the existence of multiple similarly effective solutions and presents a user-friendly software to help biomedical researchers investigate their datasets for the proposed challenge. Computer scientists may also provide this feature in their biomarker detection algorithms.

Biomarker detection is one of the more important biomedical questions for high-throughput &#39;omics&#39; researchers, and almost all existing biomarker ...

Phospho Flow Cytometry with Fluorescent Cell Barcoding for Single Cell Signaling Analysis and Biomarker Discovery

Aberrant cell signaling plays a central role in cancer development and progression. Most novel targeted therapies are indeed directed at proteins and protein functions, and cell signaling aberrations may therefore serve as biomarkers to indicate personalized treatment options. As opposed to DNA and RNA analyses, changes in protein activity can more efficiently evaluate the mechanisms underlying drug sensitivity and resistance. Phospho flow cytometry is a powerful technique that measures protein phosphorylation events at the cellular level, an important feature that distinguishes this method from other antibody-based approaches. The method allows for simultaneous analysis of multiple signaling proteins. In combination with fluorescent cell barcoding, larger medium- to high-throughput data-sets can be acquired by standard cytometer hardware in short time. Phospho flow cytometry has applications both in studies of basic biology and in clinical research, including signaling analysis, biomarker discovery and assessment of pharmacodynamics. Here, a detailed experimental protocol is provided for phospho flow analysis of purified peripheral blood mononuclear cells, using chronic lymphocytic leukemia cells as an example.

Here, a protocol for medium- to high-throughput analysis of protein phosphorylation events at the cellular level is presented. Phospho flow cytometry is a powerful approach to characterize signaling aberrations, identify and validate biomarkers, and assess pharmacodynamics.

Aberrant cell signaling plays a central role in cancer development and progression. Most novel targeted therapies are indeed directed at proteins and ...

Yeast As a Chassis for Developing Functional Assays to Study Human P53

The finding that the well-known mammalian P53 protein can act as a transcription factor (TF) in the yeast S. cerevisiae has allowed for the development of different functional assays to study the impacts of 1) binding site [i.e., response element (RE)] sequence variants on P53 transactivation specificity or 2) TP53 mutations, co-expressed cofactors, or small molecules on P53 transactivation activity. Different basic and translational research applications have been developed. Experimentally, these approaches exploit two major advantages of the yeast model. On one hand, the ease of genome editing enables quick construction of qualitative or quantitative reporter systems by exploiting isogenic strains that differ only at the level of a specific P53-RE to investigate sequence-specificity of P53-dependent transactivation. On the other hand, the availability of regulated systems for ectopic P53 expression allows the evaluation of transactivation in a wide range of protein expression. Reviewed in this report are extensively used systems that are based on color reporter genes, luciferase, and the growth of yeast to illustrate their main methodological steps and to critically assess their predictive power. Moreover, the extreme versatility of these approaches can be easily exploited to study different TFs including P63 and P73, which are other members of TP53 gene family.

Presented here are four protocols to construct and exploit yeast Saccharomyces cerevisiae reporter strains to study human P53 transactivation potential, impacts of its various cancer-associated mutations, co-expressed interacting proteins, and the effects of specific small molecules.

The finding that the well-known mammalian P53 protein can act as a transcription factor (TF) in the yeast S. cerevisiae has allowed for the development of ...

Performing Data Mining And Integrative Analysis Of Biomarker in Breast Cancer Using Multiple Publicly Accessible Databases

In recent years, emerging databases were designed to lower the barriers for approaching the intricate cancer genomic datasets, thereby, facilitating investigators to analyze and interpret genes, samples and clinical data across different types of cancer. Herein, we describe a practical operation procedure, taking ID1 (Inhibitor of DNA binding proteins 1) as an example, to characterize the expression patterns of biomarker and survival predictors of breast cancer based on pooled clinical datasets derived from online accessible databases, including ONCOMINE, bcGenExMiner v4.0 (Breast cancer gene-expression miner v4.0), GOBO (Gene expression-based Outcome for Breast cancer Online), HPA (The human protein atlas), and Kaplan-Meier plotter. The analysis began with querying the expression pattern of the gene of interest (e.g., ID1) in cancerous samples vs. normal samples. Then, the correlation analysis between ID1 and clinicopathological characteristics in breast cancer was performed. Next, the expression profiles of ID1 was stratified according to different subgroups. Finally, the association between ID1 expression and survival outcome was analyzed. The operation procedure simplifies the concept to integrate multidimensional data types at the gene level from different databases and test hypotheses regarding recurrence and genomic context of gene alteration events in breast cancer. This method can improve the credibility and representativeness of the conclusions, thereby, present informative perspective on a gene of interest.

Here, we present a protocol to explore the biomarker and survival predictor of breast cancer based on the comprehensive analysis of pooled clinical datasets derived from a variety of publicly accessible databases, using the strategy of expression, correlation and survival analysis step by step.

In recent years, emerging databases were designed to lower the barriers for approaching the intricate cancer genomic datasets, thereby, facilitating ...

Evaluating Cell Death Using Cell-Free Supernatant of Probiotics in Three-Dimensional Spheroid Cultures of Colorectal Cancer Cells

This manuscript describes a protocol to evaluate cancer cell deaths in three dimensional (3D) spheroids of multicellular types of cancer cells using supernatants from Lactobacillus fermentum cell culture, considered as probiotics cultures. The use of 3D cultures to test Lactobacillus cell-free supernatant (LCFS) are a better option than testing in 2D monolayers, especially as L. fermentum can produce anti-cancer effects within the gut. L. fermentum supernatant was identified to possess increased anti-proliferative effects against several colorectal cancer (CRC) cells in 3D culture conditions. Interestingly, these effects were strongly related to the culture model, demonstrating the notable ability of L. fermentum to induce cancer cell death. Stable spheroids were generated from diverse CRCs (colorectal cancer cells) using the protocol presented below. This protocol of generating 3D spheroid is time saving and cost effective. This system was developed to easily investigate the anti-cancer effects of LCFS in multiple types of CRC spheroids. As expected, CRC spheroids treated with LCFS strongly induced cell death during the experiment and expressed specific apoptosis molecular markers as analyzed by qRT-PCR, western blotting, and FACS analysis. Therefore, this method is valuable for exploring cell viability and evaluating the efficacy of anti-cancer drugs.

Here methods are presented to understand anti-cancer effects of Lactobacillus cell-free supernatant (LCFS). Colorectal cancer cell lines show cell deaths when treated with LCFS in 3D cultures. The process of generating spheroids can be optimized depending on the scaffold and the analysis methods presented are useful for evaluating the involved signaling pathways.

This manuscript describes a protocol to evaluate cancer cell deaths in three dimensional (3D) spheroids of multicellular types of cancer cells using ...

Culture of Bladder Cancer Organoids as Precision Medicine Tools

Current in vitro therapeutic testing platforms lack relevance to tumor pathophysiology, typically employing cancer cell lines established as two-dimensional (2D) cultures on tissue culture plastic. There is a critical need for more representative models of tumor complexity that can accurately predict therapeutic response and sensitivity. The development of three-dimensional (3D) ex vivo culture of patient-derived organoids (PDOs), derived from fresh tumor tissues, aims to address these shortcomings. Organoid cultures can be used as tumor surrogates in parallel to routine clinical management to inform therapeutic decisions by identifying potential effective interventions and indicating therapies that may be futile. Here, this procedure aims to describe strategies and a detailed step-by-step protocol to establish bladder cancer PDOs from fresh, viable clinical tissue. Our well-established, optimized protocols are practical to set up 3D cultures for experiments using limited and diverse starting material directly from patients or patient-derived xenograft (PDX) tumor material. This procedure can also be employed by most laboratories equipped with standard tissue culture equipment. The organoids generated using this protocol can be used as ex vivo surrogates to understand both the molecular mechanisms underpinning urological cancer pathology and to evaluate treatments to inform clinical management.

Patient-derived organoids (PDOs) are a powerful tool in translational cancer research, reflecting both the genetic and phenotypic heterogeneity of the disease and response to personalized anti-cancer therapies. Here, a consolidated protocol to generate human primary bladder cancer PDOs in preparation for the evaluation of phenotypic analyses and drug responses is detailed.

Current in vitro therapeutic testing platforms lack relevance to tumor pathophysiology, typically employing cancer cell lines established as ...

A Standardized Liquid Biopsy Preanalytical Protocol for Downstream Circulating-Free DNA Applications

The term liquid biopsy (LB) refers to molecules such as proteins, DNA, RNA, cells, or extracellular vesicles in blood and other bodily fluids that originate from the primary and/or metastatic tumor. LB has emerged as a mainstay in translational research and has started to become part of clinical oncology practice, providing a minimally invasive alternative to solid biopsy. The LB allows real-time monitoring of a tumor via a minimally invasive sample extraction, such as blood. The applications include early cancer detection, patient follow-up for the detection of disease progression, assessment of minimal residual disease, and potential identification of molecular progression and mechanism of resistance. In order to achieve a reliable analysis of these samples that can be reported in the clinic, the preanalytical procedures should be carefully considered and strictly followed. Sample collection, quality, and storage are crucial steps that determine their usefulness in downstream applications. Here, we present standardized protocols from our liquid biopsy working module for collecting, processing, and storing plasma and serum samples for downstream liquid biopsy analysis based on circulating-free DNA. The protocols presented here require standard equipment and are sufficiently flexible to be applied in most laboratories focused on biological procedures.

The liquid biopsy has revolutionized our approach to oncology translational studies, with sample collection, quality, and storage being crucial steps for its successful clinical application. Here we describe a standardized and validated protocol for downstream circulating-free DNA applications that can be applied in most translational research laboratories.

The term liquid biopsy (LB) refers to molecules such as proteins, DNA, RNA, cells, or extracellular vesicles in blood and other bodily fluids that ...

Zebrafish Larvae as a Model to Evaluate Potential Radiosensitizers or Protectors

Zebrafish are extensively used in several kinds of research because they are one of the easily maintained vertebrate models and exhibit several features of a unique and convenient model system. As highly proliferative cells are more susceptible to radiation-induced DNA damage, zebrafish embryos are a front-line in vivo model in radiation research. In addition, this model projects the effect of radiation and different drugs within a short time, along with major biological events and associated responses. Several cancer studies have used zebrafish, and this protocol is based on the use of radiation modifiers in the context of radiotherapy and cancer. This method can be readily used to validate the effects of different drugs on irradiated and control (non-irradiated) embryos, thus identifying drugs as radio sensitizing or protective drugs. Although this methodology is used in most drug screening experiments, the details of the experiment and the toxicity assessment with the background of X-ray radiation exposure are limited or only briefly addressed, making it difficult to perform. This protocol addresses this issue and discusses the procedure and toxicity evaluation with a detailed illustration. The procedure describes a simple approach for using zebrafish embryos for radiation studies and radiation-based drug screening with much reliability and reproducibility.

The zebrafish has recently been exploited as a model to validate potential radiation modifiers. The present protocol describes the detailed steps to use zebrafish embryos for radiation-based screening experiments and some observational approaches to evaluate the effect of different treatments and radiation.

Zebrafish are extensively used in several kinds of research because they are one of the easily maintained vertebrate models and exhibit several features ...