eoe sub articles

EoE Sub Articles

1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)
<ol>
	<li>Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 &#956;M &#946;-estradiol.</li>
	<li>Passage the cells at a ratio of 1:10 every 3 days. 
	NOTE: Make complete RPMI 1640 medium by supplementing with 10% fetal bovine serum (FBS), 5 x10-5 M &#946;-mercaptoethanol, and 10 &#956;g/mL gentamicin. Recombinant murine FL is also commercially available.</li>
</ol>
2. Lentiviral transduction
<ol>
	<li>Plate iHSPCs at a density of 1 x 105 cells/well in 12-well plates in 1 mL of complete medium containing 100 ng/mL FL, 1 &#956;M &#946;-estradiol, and 8 &#956;g/mL polybrene. 
	NOTE: The concentration of polybrene depends on the cell types and is usually in the range of 4-8 &#956;g/mL.</li>
	<li>Add shRNA-carrying lentivirus in each well at a multiplicity of infection (MOI) of 100. 
	NOTE: The lentiviral vector is pLKO.1-Puro with a puromycin selection marker (Figure 1). The target sequences of shRNAs against LacZ, Tcf4, and Id2, respectively, are listed in the Table of Materials. The MOI is defined by the number of virions that are added per cell during infection. 
	<img alt="Equation 1" src="/files/ftp_upload/20969/20969_Equation1.jpg" /></li>
	<li>Spin the plates at 1,100 x g for 90 min at 37 &#176;C.</li>
	<li>Incubate the plate containing infected cells for overnight at 37 &#176;C in an incubator. 
	NOTE: If the cells are sensitive to polybrene, then refresh the cells with the complete medium without polybrene after the spin infection.</li>
	<li>Refresh cells with complete medium containing 100 ng/mL FL and 1 &#956;M &#946;-estradiol 24 h after the infection.</li>
	<li>Add 6 &#956;g/mL of puromycin to the medium to select the infected cells after an additional 24 h. 
	NOTE: Transduced lentiviral vector usually takes 48 h for expressing genes, including puromycin resistant gene. Ensure that the concentration of puromycin is optimized for each cell line.</li>
	<li>Refresh the selection medium containing 100 ng/mL FL, 1 &#956;M &#946;-estradiol, and 6 &#956;g/mL puromycin every 3 days and maintain the cells for at least one week to expand the stably transduced iHSPC cells. 
	NOTE: Puromycin selection usually takes effect 48 h later, and the period of selection depends on cell types.</li>
</ol>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1.5 mL Micro tube&#160;</td>
			<td>ExtraGene&#160;</td>
			<td>TUBE-170-C</td>
			<td></td>
		</tr>
		<tr>
			<td>12-well tissue culture-treated plate&#160;</td>
			<td>Falcon&#160;</td>
			<td>353043</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS)&#160;</td>
			<td>Corning&#160;</td>
			<td>35-010-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI 1640 medium&#160;</td>
			<td>Gibco&#160;</td>
			<td>11875-085</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-estradiol&#160;&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>E2758-250MG</td>
			<td></td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol (&#946;-ME)&#160;</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Flt3 ligand (FL)&#160;</td>
			<td>Home-made</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Polybrene&#160;</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>TR-1003-G</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin&#160;</td>
			<td>Invivogen&#160;</td>
			<td>ant-pr-1</td>
			<td></td>
		</tr>
		<tr>
			<td>shId2 (GCTTATGTCGAATGATAGCAA/TRCN0000054390)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094)</td>
			<td>The RNAi Consortium (TRC)</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

short hairpin rna-mediated gene knockdown in ihspcs in vitro: a lentivirus-based shrna expression system delivery into ihspcs for knockdown of specific gene expression

Source: Hsiao, Y. L., et al. <a href="https://www.jove.com/v/62730">Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro.</a> J. Vis. Exp. (2022).
In this video, we demonstrate a method to perform transduction of shRNA lentiviral vectors to obtain stable knockdown cell lines in immortalized hematopoietic stem and progenitor cells (iHSPCs).

<img alt="Figure 1" src="/files/ftp_upload/20969/20969_Figure1.jpg" /> 
Figure 1: The construct of lentiviral vector pLKO.1-Puro.

Short Hairpin RNA Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based ShRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression and Generation of Stable Knockdo

Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression

Source: Hsiao, Y. L., et al.  Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell ...

Begin with an immortalized hematopoietic stem and progenitor cell, iHSPC, culture in media containing specific steroid hormone and hematopoietic cytokine, regulating cell proliferation in an undifferentiated state. Add a suitable cationic polymer and lentiviral vectors.
Recombinant viruses carry coding sequences for short hairpin RNAs, shRNAs, directed toward a specific host gene and antibiotic resistance marker gene.
Centrifuge to sediment cells and viruses. During incubation, cationic polymers neutralize the cellular membrane charges, enhancing viral binding. Following membrane fusion, viral genetic material and enzymes release into the cellular cytoplasm. The viral genome is reverse transcribed, moves into the nucleus, and integrates into the host genome.
Under a specific promoter&#39;s influence in the construct, the shRNA gene construct comprising a target mRNA matching sequence, loop segment, and another sequence complementary to the first, is transcribed forming shRNA with loop segment of unpaired nucleotides. Following transcription, shRNA is exported to the cytoplasm.
A specific ribonuclease cleaves the loop segment, forming double-stranded RNA, siRNA. siRNA is incorporated into the RNA-induced silencing complex, RISC, and siRNA strands separate. The activated complex with the retained strand complementary to the target mRNA recognizes and binds to the target mRNA in a sequence-specific manner, negatively regulating expression and mediating target gene suppression.
Incubate the cells with specific antibiotics. The stably transduced cells express the antibiotic resistance gene allowing their selection. Refresh media and incubate, allowing proliferation of stably transduced cells.

short-hairpin-rna-mediated-gene-knockdown-ihspcs-vitro-lentivirus

Research

JoVE Encyclopedia of Experiments

Biological Techniques

Genome Editing Techniques

Gene regulation

1.2K Views. Source: Hsiao, Y. L., et al. Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro. J. Vis. Exp. (2022). In this video, we demonstrate a method to perform transduction of shRNA lentiviral vectors to obtain stable knockdown cell lines in immortalized hematopoietic stem and progenitor cells (iHSPCs). 

Video: Short Hairpin RNA Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based ShRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression and Generation of Stable Knockdo - Concept

Lentiviral Mediated Gene Silencing in Human Pseudoislet Prepared in Low Attachment Plates

Various genetic tools are available to modulate genes in pancreatic islets of rodents to dissect function of islet genes for diabetes research. However, the data obtained from rodent islets are often not fully reproduced in or applicable to human islets due to well-known differences in islet structure and function between the species. Currently, techniques that are available to manipulate gene expression of human islets are very limited. Introduction of transgene into intact islets by adenovirus, plasmid, and oligonucleotides often suffers from low efficiency and high toxicity. Low efficiency is especially problematic in gene downregulation studies in intact islets, which require high efficiency. It has been known that enzymatically-dispersed islet cells reaggregate in culture forming spheroids termed pseudoislets. Size-controlled reaggregation of human islet cells creates pseudoislets that maintain dynamic first phase insulin secretion after prolonged culture and provide a window to efficiently introduce lentiviral short hairpin RNA (shRNA) with low toxicity. Here, a detailed protocol for the creation of human pseudoislets after lentiviral transduction using two commercially available multiwell plates is described. The protocol can be easily performed and allows for efficient downregulation of genes and assessment of dynamism of insulin secretion using human islet cells. Thus, human pseudoislets with lentiviral mediated gene modulation provide a powerful and versatile model to assess gene function within human islet cells.

A protocol to create gene modified human pseudoislets from dispersed human islet cells that are transduced by lentivirus carrying short hairpin RNA (shRNA) is presented. This protocol utilizes readily available enzyme and culture vessels, can be performed easily, and produces genetically modified human pseudoislets suitable for functional and morphological studies.

Various genetic tools are available to modulate genes in pancreatic islets of rodents to dissect function of islet genes for diabetes research. However, ...

JoVE Journal

Genetics

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining the role of the gene of interest in the development, differentiation, and function of NK cells. Recent advances related to chimeric antigen receptors (CARs) in cancer immunotherapy accentuate the need for an efficient method to deliver exogenous genes to effector lymphocytes. The efficiencies of lentiviral-mediated gene transductions into primary human or mouse NK cells remain significantly low, which is a major limiting factor. Recent advances using cationic polymers, such as polybrene, show an improved gene transduction efficiency in T cells. However, these products failed to improve the transduction efficiencies of NK cells. This work shows that dextran, a branched glucan polysaccharide, significantly improves the transduction efficiency of human and mouse primary NK cells. This highly reproducible transduction methodology provides a competent tool for transducing human primary NK cells, which can vastly improve clinical gene delivery applications and thus NK cell-based cancer immunotherapy.

The goal of this study was to formulate technologies that allow for successful gene transduction in primary natural killer (NK) cells. The dextran-mediated lentiviral transduction of human or mouse primary NK cells results in higher gene expression efficiencies. This method of gene transduction will vastly improve NK cell genetic manipulation.

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Immunology and Infection

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression

Transcript