eoe sub articles

EoE Sub Articles

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. Preparation of the MRSA HI antigen protein
<ol>
	<li>Obtain&#160;Fe ion surface determining factor B (IsdB)&#160;and&#160;&#945;-hemolysin mutant (Hla)&#160;clones from commercial sources (see&#160;Table of Materials), perform polymerase chain reaction (PCR) amplification to amplify&#160;IsdB&#160;and&#160;Hla&#160;genes, and ligate their products to the PGEX-6P-2 plasmid (obtained commercially; see&#160;Table of Materials). Screen with the vector Xl/blue strain of&#160;Escherichia coli.</li>
	<li>Transform the positive clone into&#160;E. coli&#160;BL21 competent cells (see&#160;Table of Materials) and amplify with shark culture.</li>
	<li>Express the antigen and isolate after induction with isopropyl-&#946;-D-1-mercaptogalactopyranoside and multimodal chromatography (MMC) isolate kits (see&#160;Table of Materials).</li>
	<li>Characterize the antigen protein and purify it with a full-automation purifier.
	<ol>
		<li>Affinity-purify gutathione S-transferase (GST)-tagged proteins from cleared lysates using a commercially available affinity chromatography resin (see&#160;Table of Materials).</li>
		<li>Purify the recombinant proteins by&#160; isopropyl-&#946;-D-1-mercaptogalactopyranoside and multimodal chromatography (MMC).</li>
		<li>Remove the endotoxin by the Triton X-114 phase separation method. Briefly, mix 1% Triton X-114 with recombinant protein eluate at 0 &#176;C for 5 min to ensure a homogenous solution, and incubate at 37 &#176;C for 5 min to allow two phases to form.</li>
	</ol>
	</li>
	<li>Use the bacterial endotoxin test method&#160;with Turtle kits (see&#160;Table of Materials) to detect the endotoxin concentration. The endotoxin for protein antigen is 0.06 EU/&#181;g, lower than the international standard (1.5 EU/&#181;g).
	<ol>
		<li>Perform an interference test to eliminate the possible influence of the test product on endotoxin detection.&#160;&#160;&#160;&#160; 
		NOTE: According to the Appendix 2020 of Chinese pharmacopeia, the endotoxin content should be less than 5 EU/dose. The sensitivity of Limulus lysate (&#955;0.25 EU/mL) and the maximum effective dilution ratio of 33.3 were calculated&#160;based on maximum valid dilution, MVD = cL/&#955;, where L is the limit value of bacterial endotoxin for the test article, c is the concentration of the test article solution, and when L is expressed in EU/m, c is equal to 1.0 mg/mL. &#955; is the labeled sensitivity (EU/mL) of the horseshoe crab reagent in the gel method.</li>
	</ol>
	</li>
	<li>Recombine the antigen (48 kDa, determined by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis [SDS-PAGE]) at 1.5 mg/mL in sterile water without endotoxin or phosphate-buffered saline (PBS) (sodium dichlorate method). 
	&#8203;NOTE: The protein peak time was 13.843 min, the purity was 99.4% (High-performance liquid chromatography method), and the protein was stored at -70 &#176;C. Genomic DNA extracted from&#160;S. aureus&#160;strain MRSA252 (see&#160;Table of Materials) was used as the PCR template. The&#160;IsdB&#160;gene was amplified using the forward primer 59-CGCGGATCCATGAATGGCGAAGCAAAAGCAG 
	C-39 and the reverse primer 59-TTTTCCTTTTGCGG 
	CCGCCTATGTCATATCTTTATTAGATTCTTC-39. 
	The&#160;Hla gene was amplified using the forward primer PHLAF (GCGGATCCGATTCTGATATTAATATTAAAACC) and the reverse primer PHLAR (TAAGCGGCCGCTTATCAATTTGTCATTTCTTC).</li>
</ol>
2. Preparation of the nanoemulsion vaccine
<ol>
	<li>According to the mass ratio of 1:6:3(w/w), add three kinds of excipients in sequence (isopropyl myristate, polyoxyethylene castor oil, and propylene glycol; see&#160;Table of Materials) to the HI antigen protein solution (10 mg/mL) and stir well. Then, add gradually sterilized pure water to reach a final volume of 10 mL and stir at 500 rpm and 25 &#176;C for approximately 20 min.&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
	NOTE: The nanoemulsion prepared in this protocol has a volume of 10 mL, and the masses of the three excipients are 0.34 g, 2 g, and 1 g, respectively. The protein solution here is the working solution, 10 times the concentration of the final solution.</li>
	<li>Prepare the nanoemulsion adjuvant vaccine (1 mg/mL protein) by low-energy emulsification methods&#160;to obtain a clear and transparent liquid solution. 
	NOTE: The blank nanoemulsion (BNE) was prepared by similar methods, except that water was replaced with HI. The usual emulsification method involves heating the outer and inner phases to approximately 80 &#176;C for emulsification and then stirring and cooling them gradually. In this process, a large amount of energy is consumed, and finally, the emulsion is obtained.</li>
</ol>
3. Physical characterization and stability of the nanoemulsion adjuvant vaccine
<ol>
	<li>Particle size, zeta potential, and polymer dispersion index characterization (PDI).
	<ol>
		<li>Prepare 100 &#181;L of the nanoemulsion adjuvant vaccine and dilute 50-fold with water for injection. Add 2 mL of sample for detection.</li>
		<li>Observe the particle sizes, zeta potential, and PDI at 25 &#176;C using a Nano Zetasizer (ZS; see&#160;Table of Materials).</li>
	</ol>
	</li>
	<li>Transmission electron microscopy (TEM)
	<ol>
		<li>Dilute 10 &#181;L of nanoemulsion vaccine 50-fold with water, place on a carbon-coated 100-mesh copper grid, and stain with 1% phosphotungstic acid (see&#160;Table of Materials) for 5 min at room temperature.</li>
		<li>Remove excess phosphotungstic acid solution with filter paper.</li>
		<li>Observe the morphology under a transmission electron microscope (see&#160;Table of Materials). Examine whether the finished products are nearly stable and circular within the field of view of the electron microscope and whether they exhibit good dispersion.</li>
	</ol>
	</li>
	<li>Scanning electron microscopy (SEM)
	<ol>
		<li>Dilute 10 &#181;L of the nanoemulsion adjuvant vaccine 50-fold with water, drop 10 &#181;L of prediluted samples on a silicon wafer, and place in a 37 &#176;C thermostat-controlled incubator for 24 h.</li>
		<li>Spray the prepared platinum on the silicon for 40 s and cool to room temperature.</li>
		<li>Observe the morphological properties of the prepared samples under a high-resolution scanning electron microscope (see&#160;Table of Materials). Determine whether the samples are nearly stable, spherical, and well dispersed within the field of view under the electron microscope.</li>
	</ol>
	</li>
	<li>Morphological stability
	<ol>
		<li>Place 1 mL of nanoemulsion vaccine samples in microcentrifuge tubes, and evaluate the stability of fresh samples by centrifuging for 30 min at 13,000 x&#160;g&#160;at room temperature (25 &#176; C).</li>
		<li>Observe the appearance of these fresh samples and then perform a thermodynamic stability test of six temperature cycles (one cycle: store at 4 &#176;C for 48 h, 25 &#176;C for 48 h, and 37 &#176;C for 48 h).</li>
		<li>After centrifugation, allow the samples to stand for 15 min to determine whether there is a Tyndall effect (whether the sample is clear and transparent under light) and whether demulsification has occurred (shown by clear stratification after demulsification).</li>
	</ol>
	</li>
	<li>SDS-PAGE and western blot
	<ol>
		<li>Shake the samples, mix a solution of 0.6 mL of absolute ethanol and 0.3 mL of vaccine, and centrifuge (13,000 x&#160;g, 30 min at room temperature, 25 &#176;C).</li>
		<li>Transfer the supernatant of the solution to a clean tube and dissolve the precipitate with 0.3 mL of water. Obtain the supernatant and precipitate solutions (both blank nanoemulsion and vaccine) after treatment with absolute ethanol and distilled water solution, and perform the same 50-fold dilution.</li>
		<li>Mix 2.5 mL of separation gel A and 2.5 mL of separation gel B (see&#160;Table of Materials), add 50 &#181;L of 10% ammonium persulfate, and quickly place the solution in the glass plate with a pipette. Mix 1 mL of concentrated gel A and 1 mL of concentrated gel B, add 20 &#181;L of 10% ammonium persulfate into the glass plate, insert an appropriately sized comb, and wait for solidification.</li>
		<li>Add a total of 5 &#181;L of 5x protein loading buffer solution to the diluted sample obtained in step 3.5.2, and boil the sample for 5 min.</li>
		<li>Add 10 &#181;L of heated protein to the corresponding well, and add 5 &#181;L of protein marker to the marker well.</li>
		<li>Connect the electrode, turn on the electrophoresis meter (see&#160;Table of Materials), and adjust the voltage to 300 V. Turn off the power when the electrophoresis reaches 1 cm away from the bottom of the PAGE rubber.</li>
		<li>Remove the gel and rinse with double-distilled water (ddH2O). Add Coomassie bright blue G-250 staining solution (see&#160;Table of Materials) for 10 min. Pour out the staining solution, and rinse the gel twice with solution and the commercially available decolorization solution and microwave the gel for 1 min. Shake the gel for 10 min, and repeatedly change the decolorization solution until the gel background is clear. Then, perform gel imaging (see&#160;Table of Materials).&#160;&#160;&#160;&#160;&#160;&#160; 
		NOTE: The western blot was pre-processed, as described in steps 3.5.1-3.5.6.</li>
		<li>Soak three filter paper blocks with an electrophoresis transfer buffer. Soak the polyvinylidene fluoride (PVDF) membrane in methanol for 30 s and transfer with a semidry gel transfer instrument (two layers of filter paper, PVDF membrane, electrophoresis gel, and one layer of filter paper). Use a voltage of 23 V to transfer the membrane for 23 min.</li>
		<li>Remove the PVDF membrane and wash once with tris-buffered saline-Tween 20 (TBST) after transfer.</li>
		<li>Place the PVDF membrane in sealing solution (5% skimmed milk powder solution) and seal overnight at 4 &#176;C.</li>
		<li>Remove the PVDF membrane and wash three times with TBST or 10 min each.</li>
		<li>Incubate with the primary antibody (from immunized mice with positive serum). Dilute the primary antibody&#160;(see&#160;Table of Materials) to be tested 500-fold (100-fold) with TBST. Place the blocked PVDF membrane in the primary antibody and incubate at 37 &#176;C for 1 h.</li>
		<li>Remove the PVDF membrane and wash three times with TBST for 10 min each.</li>
		<li>Incubate with the secondary antibody (see&#160;Table of Materials). Dilute alkaline phosphatase (AP)-labeled goat anti-mouse secondary antibody 5,000-fold with TBST. Place the PVDF membrane in the secondary antibody and incubate at 37 &#176;C for 40 min.</li>
		<li>Remove the PVDF membrane and wash four times with TBST for 10 min each.</li>
		<li>Submerge the PVDF membranes in a mixture (just enough to soak the membrane) of the AP substrate nitro blue tetrazole (NBT) and BCIP (5-bromo-4-chloro-3&#39;-indolyphosphate p-toluidine salt) (see&#160;Table of Materials) for staining. A positive result is purple. 
		&#8203;NOTE: The results must be a clear purple band, and the sample strip and the molecular weight of the antigen should be at the same labeled position.</li>
	</ol>
	</li>
</ol>
4. Assessment of antibody immune response to this vaccine after intramuscular administration
NOTE: The mice were immunized by intramuscular injection of the nanoemulsion vaccine following a published report. The mice were administered PBS as a negative control. At 1 week after three immunizations were completed, serum was collected from the mice. The serum levels of IgG and subclasses of IgG1, IgG2a, and IgG2b were quantitatively determined by enzyme-linked immunosorbent assay (ELISA).
<ol>
	<li>Antigen coating: Dilute HI protein antigen to 10 &#181;g/mL with coating solution and add to the ELISA plate at 100 &#181;L/well. Incubate at 4 &#176;C overnight.&#160;&#160; 
	NOTE: The coating solution is prepared by dissolving 1.6 g of anhydrous sodium carbonate and 2.9 g of sodium bicarbonate in 1 L of deionized water.</li>
	<li>Sealing: Wash the plate (three cycles, each cycle 300 &#181;L). Add 300 &#181;L of the sealing solution to each well, and seal the wells for 2 h at 37 &#176;C.&#160;&#160;&#160;&#160;&#160;&#160;&#160; 
	NOTE: The sealing solution is prepared by adding Tween-20 and bovine serum albumin (BSA) to PBS. The content of BSA in the PBST solution is 1%.</li>
	<li>Serum dilution: Dilute the sample serum of mice 100 times with PBST (take 3 &#181;L of serum and add it to 297 &#181;L of PBST and vortex), and use 100 &#181;L for each serum sample. Dilute the positive serum and negative control serum 100 times with PBST by adding 4 &#181;L&#160;to 396 &#181;L of PBST, then mixing by vortexing.</li>
	<li>Double ratio dilution: Add 200 &#181;L of the above diluted experimental serum to the first row of the coated ELISA plate, and add 100 &#181;L of PBST to all wells except the first and 12th&#160;rows. Perform a 1:2 dilution successively from the first row: adjust the pipette to 100 &#181;L, transfer 100 &#181;L from the first row to the second row, and mix with the pipette 10 times.</li>
	<li>Dilute the serum to Row 11 at multiple ratios and discard 100 &#181;L of liquid.</li>
	<li>Add diluted negative and positive serum to the corresponding wells in Row 12 according to the sample template (see&#160;Table 1)-100 &#181;L/well.</li>
	<li>Seal the ELISA plates with plastic wrap and incubate at 37 &#176;C for 1 h.</li>
	<li>Dilute secondary antibody anti-mouse IgG-HRP (see&#160;Table of Materials) with PBST at 1:10,000.</li>
	<li>Wash the plate (three cycles, each cycle 300 &#181;L). Then, add 100 &#181;L of the diluted secondary antibody to each well, and incubate the plate at 37 &#176;C for 40 min.</li>
	<li>Staining&#160;and termination: Wash the plate (five cycles, each cycle 300 &#181;L). Add 3,3&#8242;,5,5&#8242;-tetramethylbenzidine (TMB) staining solution (100 &#181;L; see&#160;Table of Materials) to each well. Place the plates at 37 &#176;C for 10 min away from light, and then terminate the reaction immediately with 50 &#181;L of 2 M H2SO4.</li>
	<li>Detect the optical density (OD450) value by an enzyme marker (read the OD450&#160;value within 15 min after termination).</li>
</ol>
Table 1: ELISA spiking sequence and dilution template.
<img alt="Figure 1" src="/files/ftp_upload/22215/22215table1.jpg" />

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5424-Small high speed centrifugeFA-45-24-11</td>
			<td>Eppendorf, Germany&#160;</td>
			<td>5424000495</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well plates</td>
			<td>Corning Incorporated, USA</td>
			<td>CLS3922</td>
			<td></td>
		</tr>
		<tr>
			<td>AFM Dimension FastScan</td>
			<td>BRUKER, Germany&#160;</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Balb/c mice&#160;</td>
			<td>Beijing HFK Bioscience Co. Ltd.&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BCIP/NBT</td>
			<td>Fuzhou Maixin Biotechnology Development Company,China</td>
			<td>BCIP/NBT</td>
			<td></td>
		</tr>
		<tr>
			<td>Bio-Rad 6.0 microplate reader</td>
			<td>Bio-Rad Laboratories Incorporated Limited Co., CA, USA</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>BL21 Competent Cell</td>
			<td>Merck millipore,Germany</td>
			<td>70232-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>BSA-100G</td>
			<td>Sigma-Aldrich, USA</td>
			<td>B2064-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge 5810 R</td>
			<td>Eppendorf, Germany&#160;</td>
			<td>5811000398</td>
			<td></td>
		</tr>
		<tr>
			<td>Coomassie bright blue G-250 staining solution</td>
			<td>MIKX,China</td>
			<td>DB236</td>
			<td></td>
		</tr>
		<tr>
			<td>Decolorization solution</td>
			<td>BOSTER,China</td>
			<td>AR0163-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Electro-heating standing-temperature cultivator HH-B11-420</td>
			<td>Shanghai Yuejin Medical Device Factory, China</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Electrophoresis apparatus</td>
			<td>Beijing Liuyi Instrument Factory, China</td>
			<td>DYCZ-25D</td>
			<td></td>
		</tr>
		<tr>
			<td>Gel image</td>
			<td>Tanon, USA</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Glutathione-Sepharose Resin GST</td>
			<td>Mei5bio,China</td>
			<td>affinity chromatography resin</td>
			<td></td>
		</tr>
		<tr>
			<td>H2SO4</td>
			<td>Chengdu KESHI Chemical Co., LTD,China</td>
			<td>7664-93-9</td>
			<td></td>
		</tr>
		<tr>
			<td>HI recombinant protein</td>
			<td>Third Military Medical University,China</td>
			<td>110-27-0</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP -Goat Anti-Mouse IgG</td>
			<td>Biodragon, China</td>
			<td>BF03001</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP- Goat anti-mouse IgG1</td>
			<td>Biodragon, China</td>
			<td>BF03002R</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP- Goat anti-mouse IgG2a</td>
			<td>Biodragon, China</td>
			<td>BF03003R</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP- Goat anti-mouse IgG2b</td>
			<td>Biodragon, China</td>
			<td>BF03004R</td>
			<td></td>
		</tr>
		<tr>
			<td>Inoculation loop</td>
			<td>Haimen Feiyue Co.,LTD,China</td>
			<td>YR-JZH-1UL</td>
			<td></td>
		</tr>
		<tr>
			<td>IsdB and Hla clones</td>
			<td>Shanghai Jereh Biotechnology Co,China</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl nutmeg (pharmaceutic adjuvant)</td>
			<td>SEPPIC, France</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>isopropyl- &#946;-D-1-mercaptogalactopyranoside</td>
			<td>fdbio,China</td>
			<td>FD3278-1</td>
			<td></td>
		</tr>
		<tr>
			<td>LB bouillon culture-medium</td>
			<td>Beijing AOBOX Biotechnology Co., LTD,China</td>
			<td>02-136</td>
			<td></td>
		</tr>
		<tr>
			<td>Low temperature refrigerated centrifuge</td>
			<td>Eppendorf, Germany&#160;</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Malvern NANO ZS</td>
			<td>Malvern Instruments Ltd., UK</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Micro plate washing machine 405 LSRS</td>
			<td>Bio Tek Instruments,Inc Highland&#160; Park,USA</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-TBC Compact Film Transfer Instrument</td>
			<td>BeiJingDongFangRuiLi Co.,LTD,China</td>
			<td>1658030</td>
			<td></td>
		</tr>
		<tr>
			<td>MMC packing</td>
			<td>TOSOH(SHANGHAI)CO.,LTD</td>
			<td>22818</td>
			<td></td>
		</tr>
		<tr>
			<td>MRSA252</td>
			<td>USA, ATCC</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop ultraviolet spectrophotometer</td>
			<td>Thermo Scientific, USA</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>New FlashTM Protein any KD PAGE Protein electrophoresis gel kit</td>
			<td>DAKEWE, China</td>
			<td>8012011</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>biosharp, China</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR, Amplifier</td>
			<td>Thermal Cycler, USA</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEX-target gene recombinant plasmid</td>
			<td>Shanghai Jereh Biotechnology Co,China</td>
			<td>B3528G</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphotungstic acid</td>
			<td>G-CLONE, China</td>
			<td>CS1231-25g</td>
			<td></td>
		</tr>
		<tr>
			<td>Pipette</td>
			<td>Eppendorf, Germany&#160;</td>
			<td>3120000844</td>
			<td></td>
		</tr>
		<tr>
			<td>Polyoxyethylated castor oil (pharmaceutic adjuvant)</td>
			<td>Aladdin, China</td>
			<td>K400327-1kg</td>
			<td></td>
		</tr>
		<tr>
			<td>Primary antibody</td>
			<td>Laboratory homemade:from immunized mice with positive sera</td>
			<td>null</td>
			<td>See Reference 11 for details</td>
		</tr>
		<tr>
			<td>Propylene glycol (pharmaceutic adjuvant)</td>
			<td>Sigma-Aldrich, USA</td>
			<td>P4347-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Protein Marker</td>
			<td>Thermo Scientufuc, USA</td>
			<td>26616</td>
			<td></td>
		</tr>
		<tr>
			<td>PVDF Transfer Membrane</td>
			<td>Invitrogen,USA</td>
			<td>88518</td>
			<td></td>
		</tr>
		<tr>
			<td>Scanning Electron Microscope</td>
			<td>JEOL,Japan</td>
			<td>JSM-IT800</td>
			<td></td>
		</tr>
		<tr>
			<td>Talos L120C TEM</td>
			<td>Thermo Fisher, USA</td>
			<td>null</td>
			<td></td>
		</tr>
		<tr>
			<td>TMB color solution</td>
			<td>TIAN GEN, China</td>
			<td>PA107-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Turtle kits</td>
			<td>Xiamen Bioendo Technology Co.,LTD</td>
			<td>ES80545</td>
			<td></td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Macklin, China</td>
			<td>9005-64-5</td>
			<td></td>
		</tr>
	</tbody>
</table>

measuring immunoglobulin g levels against a test vaccine in a mouse serum

Source: Zeng, X. et al., <a href="https://app.jove.com/v/65152">Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus (MRSA) Infection.</a>&#160;J. Vis. Exp.&#160;(2023)
This video demonstrates a method for assessing the antibody immune response to a novel nanoemulsion adjuvant vaccine in pre-immunized mice. Immunization enhances antibody response as confirmed by determining the IgG antibody titers.

Measuring Immunoglobulin G Levels Against a Test Vaccine in a Mouse Serum

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. ...

Begin with a multi-well plate coated with a test vaccine and block non-specific interaction sites.
Acquire a serum sample from a mouse injected with the test vaccine.&#160;
This serum contains immunoglobulin G, or IgG, antibodies that recognize the test vaccine.
To the vaccine-coated wells, add serially diluted serum samples.
The IgGs bind to the vaccine. Wash to remove unbound antibodies.
Add peroxidase-conjugated secondary antibodies that bind to IgGs. Remove unbound secondary antibodies.
Add a chromogenic substrate. The peroxidase interacts with the substrate, generating a blue-colored product.
Introduce an acid to stop the reaction. The change in the pH turns the solution yellow.
Using a spectrophotometer, measure the color intensity of each well to determine the concentration of IgG in the serum sample.

measuring-immunoglobulin-g-levels-against-test-vaccine-mouse

Research

JoVE Encyclopedia of Experiments

Immunology

Antibody-Based Technologies

Characterization and Functional Analysis

64 Views. Source: Zeng, X. et al., Evaluating the Immune Response of a Nanoemulsion Adjuvant Vaccine Against Methicillin-Resistant Staphylococcus aureus (MRSA) Infection. J. Vis. Exp. (2023) This video demonstrates a method for assessing the antibody immune response to a novel nanoemulsion adjuvant vaccine in pre-immunized mice. Immunization enhances antibody response as confirmed by determining the IgG antibody titers. 

Video: Measuring Immunoglobulin G Levels Against a Test Vaccine in a Mouse Serum - Concept

Rapid In Vivo Assessment of Adjuvant's Cytotoxic T Lymphocytes Generation Capabilities for Vaccine Development

The assessment of modern sub-unit vaccines reveals that the generation of neutralizing antibodies is important but not sufficient for adjuvant selection. Therefore, adjuvants with both humoral and cellular immuno-stimulatory capabilities that are able to promote cytotoxic T lymphocytes (CTL) responses are urgently needed. Thus, faithful monitoring of adjuvant candidates that induce cross-priming and subsequently enhance CTL generation represents a crucial step in vaccine development. In here we present an application for a method that uses SIINFEKL-specific (OT-I) T cells to monitor the cross-presentation of the model antigen ovalbumin (OVA) in vivo in the presence of different adjuvant candidates. This method represents a rapid test to select adjuvants with the best cross-priming capabilities. The proliferation of CD8+ T cells is the most valuable indication of cross-priming and it is also regarded as a correlate of adjuvant-induced cross-presentation. This feature can be evaluated in different immune organs like lymph nodes and spleen. The extent of the CTL generation can also be monitored, thereby giving insights on the nature of a local (draining lymph node mainly) or a systemic response (distant lymph nodes and/or spleen). This technique further allows multiple modifications for testing drugs that can inhibit specific cross-presentation pathways and also offers the possibility to be used in different strains of conventional and genetically modified mice. In summary, the application that we present here will be useful for vaccine laboratories in industry or academia that develop or modify chemical adjuvants for vaccine research and development.

Rapid In Vivo Assessment of Adjuvant's Cytotoxic T Lymphocytes Generation Capabilities for Vaccine Development

We present here an application for a standard immunological technique (CFSE stained OT-I proliferation) intended to rapidly monitor adjuvant-mediated cytotoxic T lymphocyte (CTL) generation in vivo. This fast estimation of CTL capacities is useful for the development of prophylactic vaccines against intracellular pathogens as well as therapeutic cancer vaccines.

The assessment of modern sub-unit vaccines reveals that the generation of neutralizing antibodies is important but not sufficient for adjuvant selection. ...

JoVE Journal

Medicine

Cell-Free Scaled Production and Adjuvant Addition to a Recombinant Major Outer Membrane Protein from Chlamydia muridarum for Vaccine Development

Subunit vaccines offer advantages over more traditional inactivated or attenuated whole-cell-derived vaccines in safety, stability, and standard manufacturing. To achieve an effective protein-based subunit vaccine, the protein antigen often needs to adopt a native-like conformation. This is particularly important for pathogen-surface antigens that are membrane-bound proteins. Cell-free methods have been successfully used to produce correctly folded functional membrane protein through the co-translation of nanolipoprotein particles (NLPs), commonly known as nanodiscs. 
This strategy can be used to produce subunit vaccines consisting of membrane proteins in a lipid-bound environment. However, cell-free protein production is often limited to small scale (&lt;1 mL). The amount of protein produced in small-scale production runs is usually sufficient for biochemical and biophysical studies. However, the cell-free process needs to be scaled up, optimized, and carefully tested to obtain enough protein for vaccine studies in animal models. Other processes involved in vaccine production, such as purification, adjuvant addition, and lyophilization, need to be optimized in parallel. This paper reports the development of a scaled-up protocol to express, purify, and formulate a membrane-bound protein subunit vaccine. 
Scaled-up cell-free reactions require optimization of plasmid concentrations and ratios when using multiple plasmid expression vectors, lipid selection, and adjuvant addition for high-level production of formulated nanolipoprotein particles. The method is demonstrated here with the expression of a chlamydial major outer membrane protein (MOMP) but may be widely applied to other membrane protein antigens. Antigen effectiveness can be evaluated in vivo through immunization studies to measure antibody production, as demonstrated here.

Cell-Free Scaled Production and Adjuvant Addition to a Recombinant Major Outer Membrane Protein from Chlamydia muridarum for Vaccine Development

This protocol describes using commercial, cell-free protein expression kits to produce membrane proteins supported in nanodisc that can be used as antigens in subunit vaccines.

Subunit vaccines offer advantages over more traditional inactivated or attenuated whole-cell-derived vaccines in safety, stability, and standard ...

Immunology and Infection

In Vitro Cellular Activity Evaluation of the Nanoemulsion Vaccine Adjuvant Ophiopogonin D

As a principal ingredient of vaccines, adjuvants can directly induce or enhance the powerful, widespread, innate, and adaptive immune responses associated with antigens. Ophiopogonin D (OP-D), a purified component extracted from the plant Ophiopogon japonicus, has been found to be useful as a vaccine adjuvant. The problems of the low solubility and toxicity of OP-D can be effectively overcome by using a low-energy emulsification method to prepare nanoemulsion ophiopogonin D (NOD). In this article, a series of in vitro protocols for cellular activity evaluation are examined. The cytotoxic effects of L929 were determined using a cell counting kit-8 assay. Then, the secreted cytokine levels and corresponding immune cell numbers after the stimulation and culture of splenocytes from immunized mice were detected by ELISA and ELISpot methods. In addition, the antigen uptake ability in bone marrow-derived dendritic cells (BMDCs), which were isolated from C57BL/6 mice and matured after incubation with GM-CSF plus IL-4, was observed by laser scanning confocal microscopy (CLSM). Importantly, macrophage activation was confirmed by measuring the levels of IL-1&#946;, IL-6, and tumor necrosis factor alpha (TNF-&#945;) cytokines by ELISA kits after coculturing peritoneal macrophages (PMs) from blank mice with the adjuvant for 24 h. It is hoped that this protocol will provide other researchers with direct and effective experimental approaches to evaluate the cellular response efficacies of novel vaccine adjuvants.

In Vitro Cellular Activity Evaluation of the Nanoemulsion Vaccine Adjuvant Ophiopogonin D

The protocol presents detailed methods for evaluating whether the nanoemulsion ophiopogonin D adjuvant promotes effective cellular immune responses.

As a principal ingredient of vaccines, adjuvants can directly induce or enhance the powerful, widespread, innate, and adaptive immune responses associated ...

Measuring Immunoglobulin G Levels Against a Test Vaccine in a Mouse Serum

Transcript

Measuring Immunoglobulin G Levels Against a Test Vaccine in a Mouse Serum

Rapid In Vivo Assessment of Adjuvant's Cytotoxic T Lymphocytes Generation Capabilities for Vaccine Development

Cell-Free Scaled Production and Adjuvant Addition to a Recombinant Major Outer Membrane Protein from Chlamydia muridarum for Vaccine Development

In Vitro Cellular Activity Evaluation of the Nanoemulsion Vaccine Adjuvant Ophiopogonin D