Funding for this work was provided by the Fondation Bettencourt Schueller in support of the Paris Bettencourt iGEM team. We thank the INSERM U1001 research unit and Chantal Lotton for technical assistance and advice. Phagemid Litmus28i_J23115-B0032-GFP was provided by Monica Ortiz and Drew Endy of Stanford.

1. Design and Construction of Phagemid Vectors Bearing sRNA Silencing Cassettes
<ol>
	<li>De Novo Design of sRNA Silencing Cassettes8
	<ol>
		<li>Identify the complete sequence of the mRNA to be silenced using a DNA sequence database. To generate the TARGET sequence, note the first 24 bp of coding sequence, from position +1 to +24 beginning with the start codon (e.g., ATG). 
		Note: Silencing is less efficient when other sites or segments of the mRNA are targeted8.</li>
		<li>Take the reverse complement of the TARGET sequence to produce the GUIDE sequence for the sRNA cassette. See Table 1 for examples of TARGET and GUIDE sequences for chloramphenicol acetyltransferase (CAT).</li>
		<li>To design the 292 bp complete sRNA expression cassette, arrange the pR promoter, GUIDE sequence, Hfq protein binding domain and T1/TE transcriptional terminator sequences in series (Table 2).</li>
		<li>Add additional cloning sites of choice to facilitate cloning of the sRNA cassette into the target vector.</li>
		<li>Obtain the complete sRNA cassette through commercial gene synthesis or a similar method and clone it into any phagemid vector with a functional f1 replication origin11. See Supporting Information for the complete sequence of the final phagemid vector.</li>
	</ol>
	</li>
	<li>Altering the Sequence Targeted by an Existing sRNA Expression Cassette using PCR-based Site Directed Mutagenesis12
	<ol>
		<li>Identify the 24 bp GUIDE sequence in an existing sRNA expression cassette. Note: The annotated pAB.001 plasmid, used in this work, is available as a supplemental sequence file.</li>
		<li>Design forward and reverse primers with short regions of homology to the existing sRNA cassette flanking the new 24 bp GUIDE sequence. Obtain the primers through commercial oligonucleotide synthesis. 
		Note: Primer design for site-directed mutagenesis is depicted in Figure 2. Exact primer template sequences are provided in Table 3.</li>
		<li>Prepare a 5 ml culture of E. coli carrying the template sRNA expression phagemid. Grow the cells overnight at 37 &#176;C with shaking, in LB media with appropriate antibiotics.</li>
		<li>Extract and purify the template sRNA expression phagemid from the 5 ml bacterial culture using a DNA miniprep kit or similar method12.</li>
		<li>Prepare two PCR reactions using the template sRNA expression phagemid and high fidelity polymerase, one with the forward and one with the reverse primer (Table 4). Use PCR conditions as recommended by the polymerase supplier (Table 5). Increase the template concentration to 10-50x higher than a standard reaction to account for the fact that the single primer reaction does not produce exponential amplification.</li>
		<li>Combine the two above PCR reactions in a microcentrifuge tube. Anneal the products by heating to 98 &#176;C in a boiling water bath. Immediately after placing the microcentrifuge tube in the water bath, remove the heat source and allow the bath to slowly return to room temperature over 1-2 hr.</li>
		<li>To eliminate the unmutated template sRNA expression phagemid, add 1 &#181;l. DpnI restriction enzyme to the mixture and incubate at 37 &#176;C for 1 hr, or the time recommended by the manufacturer for complete digestion. 
		Note: DpnI digests only methylated target sites, which are present on host-replicated phagemids but not PCR products.</li>
		<li>Transform purchased or prepared13 chemically competent E. coli with 1-5 &#181;l of the annealed PCR product. Isolate single colonies of the transformed strain by selective plating on LB agar plates containing appropriate antibiotics.</li>
		<li>To verify the incorporation of the correct GUIDE sequence, screen the resulting colonies by colony PCR. Using a 200 &#181;l pipette tip, collect a small quantity of cells from a single transformed colony. Mark and preserve the original colony for downstream use after verification.</li>
		<li>Add the collected cells to 50 &#181;l of nuclease-free water in a microcentrifuge tube. Mix by pipetting up and down.</li>
		<li>Using a bench-top thermocycler or a boiling water bath, lyse the cells by heating to 95 &#176;C for 2 min.</li>
		<li>PCR-amplify the phagemid region using 1 &#181;l of heat-lysed cells as a DNA template. PCR conditions and thermocycler protocols are provided in Tables 6 and 7. See the supplemental pAB.001 sequence file for verification primer sequences.</li>
		<li>Sequence the PCR product to verify incorporation of the correct GUIDE sequence.</li>
		<li>Inoculate a 5 ml culture of the E. coli clone carrying the sequence-verified sRNA expression phagemid. Grow the cells overnight at 37 &#176;C with shaking, in selective LB media.</li>
		<li>Prepare a glycerol stock of the sequence-verified clone. Add 750 &#181;l of the overnight culture to 250 &#181;l of 60% glycerol in a screw-cap cryo tube.</li>
		<li>Store the glycerol stock at -80 &#176;C indefinitely. The remainder of the overnight culture may be used as a source for the sRNA expression phagemid in step 2.</li>
	</ol>
	</li>
</ol>
2. Production and Harvest of M13-packaged Phagemid Stocks
<ol>
	<li>Prepare a 5 ml culture of E. coli carrying the sRNA expression phagemid. Grow the cells overnight at 37 &#176;C with shaking, in LB media with appropriate antibiotics. Note: The sRNA expression phagemid may be obtained through de novo cloning as described in step 1.1.5, or modified from an existing phagemid and harvested in step 1.2.16.</li>
	<li>Similarly prepare a 5 ml culture of E. coli carrying the M13KO7 helper plasmid. Grow the cells overnight at 37 &#176;C with shaking, in selective LB media.</li>
	<li>Extract and purify the sRNA expression phagemid and helper plasmid using a DNA extraction kit or similar method12.</li>
	<li>Cotransform purchased or prepared13 chemically competent E. coli with 1 &#181;l each of sRNA expression phagemid and helper plasmid. Select for cotransformants by plating on LB agar with selective antibiotics for both constructs.</li>
	<li>Prepare a 10 ml culture from a single colony of the cotransformed strain in LB with selective antibiotics. Incubate at 37 &#176;C with shaking for 8-12 hr or overnight.</li>
	<li>Centrifuge the culture at 3,300 x g for 10 min. Collect the supernatant and filter through a 0.2 &#181;m filter. Caution: In case of media spill, clean the area with dilute bleach (0.5%) to destroy infective phage particles.</li>
	<li>Store the packaged phagemid filtrate at 4 &#176;C. Note: Samples can be maintained for days to weeks without loss of activity.</li>
</ol>
3. Preparation of F+ Target Cells for Silencing
<ol>
	<li>Determine if the cells to be targeted for silencing express the F pilus14. If the F pilus is already present, proceed to step 4. 
	Note: Common laboratory strains of E. coli are annotated as F+ or F&#39; to indicate the presence of the F pilus in their genome or on a plasmid.</li>
	<li>Obtain an F+ strain of E. coli such as TOP10F&#39;. 
	Note: Ensure that the target strain carries a unique resistance marker in order to be separated from the F-plasmid donor after conjugation.</li>
	<li>To introduce F pilus by conjugation with a F+ strain, prepare 5 ml cultures of both the target strain and F-plasmid donor14. Grow the cells overnight at 37 &#176;C with shaking, in LB media with appropriate antibiotics.</li>
	<li>The following day, dilute both strains 1:100 in 5 ml of selective LB and continue culturing at 37 &#176;C with shaking.</li>
	<li>Determine the growth phase of the cells by measuring the optical density of the culture at 600 nm (OD600) using a benchtop spectrophotometer. Culture the cells for about 2 hr until an OD600 of 0.3 is attained, indicating log-phase growth15.</li>
	<li>Prepare 3 conjugation reactions in microcentrifuge tubes: 0.5 ml F-plasmid donor + 0.5 ml target strain, 0.5 ml F-plasmid donor + 0.5 ml LB media (negative control) and 0.5 ml target strain + 0.5 ml LB media (negative control). Allow the conjugation to proceed for 2 hr at 37 &#176;C with shaking.</li>
	<li>Plate 100 &#181;l of each conjugation reaction on selective LB agar with antibiotics specific to the F-plasmid (typically tetracycline) and target strain. Plate the negative control reactions to confirm that neither donor or recipient strain express both antibiotic resistances.</li>
</ol>
4.&#160;Infection with Packaged Phagemids for Silencing
<ol>
	<li>Inoculate a single colony of F+ target cells into a 5 ml culture of LB media with appropriate antibiotics. Incubate overnight at 37 &#176;C with shaking.</li>
	<li>The following day, dilute the F+ target cells 1:100 in 5 ml of selective LB media and continue to culture at 37 &#176;C with shaking.</li>
	<li>Determine the growth phase of the cells by measuring the optical density of the culture at 600 nm (OD600) using a benchtop spectrophotometer. Culture the cells for about 2 hr until an OD600 of 0.3 is attained, indicating log-phase growth15. Note: Expression of the F pilus and infection efficiency is highest in log phase.</li>
	<li>Add the M13-packaged phagemids (from step 2.6) to the target cells in a volume ratio of 1:100 to achieve nearly 99% infection of the target population. Allow the infection to proceed at 37 &#176;C with shaking for 30-60 min.</li>
	<li>Assay the sRNA-silencing phenotype according to the method of choice. 
	Note: For a fluorescent protein target, the silencing effect can be quantified directly by fluorometry10. Alternately, phenotypic assays may be used to observe the phenotypic consequences of gene knockdown8.</li>
	<li>Prepare a glycerol stock for the sRNA-expressing phagemid host following steps 1.2.14-1.2.16. Note: the phagemid will propagate in the host strain indefinitely and can be maintained with antibiotic similar to a conventional plasmid.</li>
</ol>

<ol>
	<li>Ohkumo, T., Masutani, C., Eki, T., Hanaoka, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+RNAi+in+C.+elegans.">Use of RNAi in C. elegans.</a> RNAi. , 129-137 (2008).</li><li>Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Iordanou, E., Chandran, R. R., Blackstone, N., Jiang, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+interference+by+dsRNA+injection+into+Drosophila+embryos.">RNAi interference by dsRNA injection into Drosophila embryos.</a> J Vis Exp. (50), e2477 (2011).</li><li>Ramadan, N., Flockhart, I., Booker, M., Perrimon, N., Mathey-Prevot, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+implementation+of+high-throughput+RNAi+screens+in+cultured+Drosophila+cells.">Design and implementation of high-throughput RNAi screens in cultured Drosophila cells.</a> Nat Protoc. 2 (9), 2245-2264 (2007).</li><li>Tsong, T. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+of+cell+membranes.">Electroporation of cell membranes.</a> Biophys J. 60 (2), 297-306 (1991).</li><li>Kim, W. J., Chang, C. -. W., Lee, M., Kim, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+siRNA+delivery+using+water+soluble+lipopolymer+for+anti-angiogenic+gene+therapy.">Efficient siRNA delivery using water soluble lipopolymer for anti-angiogenic gene therapy.</a> J Control Release. 118 (3), 357-363 (2007).</li><li>Shi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+RNAi+for+the+masses.">Mammalian RNAi for the masses.</a> Trends Genet. 19 (1), 9-12 (2003).</li><li>Na, D., Yoo, S. M., Chung, H., Park, H., Park, J. H., Lee, S. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metabolic+engineering+of+Escherichia+coli+using+synthetic+small+regulatory+RNAs.">Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs.</a> Nat Biotechnol. 31 (2), 170-174 (2013).</li><li>Ceroni, F., Algar, R., Stan, G. -. B., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+cellular+capacity+identifies+gene+expression+designs+with+reduced+burden.">Quantifying cellular capacity identifies gene expression designs with reduced burden.</a> Nat Methods. 12 (5), 415-418 (2015).</li><li>Libis, V. K., Bernheim, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+Antibiotic+Resistance+in+E.+coli+with+Engineered+Phage+Bearing+Small+Regulatory+RNAs.">Silencing of Antibiotic Resistance in E. coli with Engineered Phage Bearing Small Regulatory RNAs.</a> ACS Synth Biol. 3 (12), 1003-1006 (2014).</li><li>Ortiz, M. E., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+cell-cell+communication+via+DNA+messaging.">Engineered cell-cell communication via DNA messaging.</a> J Biol Eng. 6 (1), 16 (2012).</li><li>Edelheit, O., Hanukoglu, A., Hanukoglu, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simple+and+efficient+site-directed+mutagenesis+using+two+single-primer+reactions+in+parallel+to+generate+mutants+for+protein+structure-function+studies.">Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.</a> BMC Biotechnol. 9 (1), 61 (2009).</li><li>Chung, C. T., Miller, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+storage+of+competent+Escherichia+coli+cells.">Preparation and storage of competent Escherichia coli cells.</a> Recombinant DNA Part I. , 621-627 (1993).</li><li>Phornphisutthimas, S., Thamchaipenet, A., Panijpan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conjugation+in+Escherichia+coli.">Conjugation in Escherichia coli.</a> Biochem Mol Biol Educ. 35 (6), 440-445 (2007).</li><li>Sezonov, G., Joseleau-Petit, D., D'Ari, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Escherichia+coli+Physiology+in+Luria-Bertani+Broth.">Escherichia coli Physiology in Luria-Bertani Broth.</a> J Bacteriol. 189 (23), 8746-8749 (2007).</li><li>Mittal, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improving+the+efficiency+of+RNA+interference+in+mammals.">Improving the efficiency of RNA interference in mammals.</a> Nat Rev Genet. 5 (5), 355-365 (2004).</li><li>Qi, L. S., Larson, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Repurposing+CRISPR+as+an+RNA-guided+platform+for+sequence-specific+control+of+gene+expression.">Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression.</a> Cell. 152 (5), 1173-1183 (2013).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dispersing+biofilms+with+engineered+enzymatic+bacteriophage.">Dispersing biofilms with engineered enzymatic bacteriophage.</a> Proc Natl Acad Sci USA. 104 (27), 11197-11202 (2007).</li><li>Yosef, I., Manor, M., Kiro, R., Qimron, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperate+and+lytic+bacteriophages+programmed+to+sensitize+and+kill+antibiotic-resistant+bacteria.">Temperate and lytic bacteriophages programmed to sensitize and kill antibiotic-resistant bacteria.</a> Proc Natl Acad Sci USA. 112 (23), 7267-7272 (2015).</li><li>Karlsson, F., Malmborg-Hager, A. -. C., Albrekt, A. -. S., Borrebaeck, C. A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+comparison+of+phage+M13-infected+vs.+uninfected+Escherichia+coli.">Genome-wide comparison of phage M13-infected vs. uninfected Escherichia coli.</a> Can J Microbiol. 51 (1), 29-35 (2005).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caveat+of+RNAi+in+plants:+the+off-target+effect.">Caveat of RNAi in plants: the off-target effect.</a> Methods in molecular biology. 744, 13-25 (2011).</li><li>Jackson, A. L., Linsley, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognizing+and+avoiding+siRNA+off-target+effects+for+target+identification+and+therapeutic+application.">Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application.</a> Nat Rev Drug Discov. 9 (1), 57-67 (2010).</li><li>Cho, S. W., Kim, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+off-target+effects+of+CRISPR/Cas-derived+RNA-guided+endonucleases+and+nickases.">Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases.</a> Genome Res. 24 (1), 132-141 (2014).</li><li>Hagens, S., Blasi, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+modified+filamentous+phage+as+bactericidal+agents:+a+pilot+study.">Genetically modified filamentous phage as bactericidal agents: a pilot study.</a> Lett Appl Microbiol. 37 (4), 318-323 (2003).</li><li>Kasman, L. M., Kasman, A., Westwater, C., Dolan, J., Schmidt, M. G., Norris, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overcoming+the+phage+replication+threshold:+a+mathematical+model+with+implications+for+phage+therapy.">Overcoming the phage replication threshold: a mathematical model with implications for phage therapy.</a> J Virol. 76 (11), 5557-5564 (2002).</li><li>Chasteen, L., Ayriss, J., Pavlik, P., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eliminating+helper+phage+from+phage+display.">Eliminating helper phage from phage display.</a> Nucleic Acids Res. 34 (21), e145 (2006).</li><li>Lu, T. K., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+bacteriophage+targeting+gene+networks+as+adjuvants+for+antibiotic+therapy.">Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy.</a> Proc Natl Acad Sci USA. 106 (12), 4629-4634 (2009).</li><li>Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Programmable+repression+and+activation+of+bacterial+gene+expression+using+an+engineered+CRISPR-Cas+system.">Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system.</a> Nucleic Acids Res. 41 (15), 7429-7437 (2013).</li></ol>

The authors have nothing to disclose.

&#160;The present method achieved 80% reduction in mKate fluorescence levels compared to untargeted controls. This is in line with other RNA knockdown methods, where complete silencing is not observed and 50-90% efficiency is typical16,17. At the phenotypic level, CAT-targeted knockdowns were able to significantly attenuate chloramphenicol resistance, and eliminate it under some conditions.
The knockdown phenotype was detectable at the population level after only a few hours post-infection (Figure 3B). This illustrates an important feature of phage-based delivery: a high knockdown frequency can be obtained directly in batch culture without prior genetic modification. Unlike conventional genetic modifications using plasmid transformation or genomic integration, phage infection does not require that a population be re-grown from a single isolated colony. This allows the effects of phage infection to be explored in populations with complex spatial dynamics11, with pre-existing spatial structures like biofilms18, or in genetically mixed natural populations19.
A critical step in this method is the production of packaged phagemid at high titer. The metabolic burden associated with phage particle production may lead to high rates of mutation or plasmid loss in the phagemid production strain. It is recommended that the phagemid production strain be cultured directly from a single cotransformed colony and not refrigerated, frozen or sub-cultured prior to phage harvest. A low efficiency of co-transformation may also be observed when introducing the phagemid and helper plasmid to E. coli simultaneously. In this case, higher efficiencies may be obtained by transforming the helper plasmid first, then preparing competent cells bearing the helper plasmid for subsequent transformation with the phagemid.
Phagemid infection or sRNA expression also imposes a detectable metabolic burden on the target cells, and may result in some phenotypic perturbation. For example, a reduction in mKate2 fluorescence was observed even when cells were infected with a phagemid targeting CAT (Figure 3). Infection with M13 is not thought to trigger systemic stress responses in E. coli20, but may alter transcriptional patterns indirectly. Alternately, the GFP or ampicillin resistance markers included on the phagemid may compete for cellular resources, reducing mKate2 expression and growth9. Finally, the sRNA cassette itself may globally alter gene expression profiles by titrating the Hfq protein, or through off-target mRNA silencing. Off target effects are common in in vivo RNAi targeting21-23, but they have yet to be systematically investigated for this system.
One limitation of this method is that the infection efficiency is less than 100%, allowing some non-infected bacteria to persist in the population. The results of this work and earlier work10 suggest that noninfected cells represent 1-10% of the final population, and are responsible for most of the nonsilenced phenotypes observed. A variety of routes to M13-resistance are known, with the most common being mutational loss of pilus expression24. In light of these limitations, controls should be used to confirm high infection rates and knockdown efficiency.
Another potential limitation for some applications is the occasional transfer of contaminating helper phage. Although M13K07 contains a mutated packaging signal, it can be packaged into phage capsid at low frequency and transferred to infected populations, resulting in cells competent for phage production and the continued spread of phage beyond the initial infection event25. Modifications to the helper phage have proven effective at reducing nonspecific packaging, although sometimes at the cost of reduced phage production26.
Engineered bacteriophage have become an indispensable tool for E. coli synthetic biology, allowing quick delivery of new genes to a growing population. Recent work has produced intercellular communication circuits11 or expressed transcription factors to suppress antibiotic resistance pathways27. The protocol presented here adds to a growing collection of tools that allow control of bacterial physiology through programmed RNAs. CRISPR-Cas nucleases, when mutated to eliminate nuclease activity, have been shown to repress transcription at RNA-guided gene targets17,28. In contrast, sRNA silencing works at the translational level and does not require exogenous protein expression. Next-generation biotechnologies may unite transcriptional and translational control with phage-mediated delivery to program complex phenotypes in real time.

RNA-mediated gene knockdowns proceed in two stages. First, an RNA molecule is introduced to a cell line or organism of study. Second, endogenous RNA-binding proteins facilitate RNA-target recognition and produce the silencing effect. All RNA knockdown technologies benefit from the customizable nature of synthetic sRNAs, which can be easily produced to match a specific target of interest. However, the molecular details of RNA uptake and silencing vary widely across model system, constraining where and how RNA knockdowns can be applied.
In nematodes, double-stranded RNA (dsRNA) molecules can be introduced directly in the media or by feeding the worms with a population of dsRNA-expressing E. coli cells1,2. In Drosophila, RNAi can be achieved by microinjecting embryos with dsRNA3, or implemented in cell lines by simply adding dsRNA to the culture medium4. In mammalian cell lines, synthetic small interfering RNAs (siRNAs) may be delivered to living cells by electroporation1,2,5, packaged in liposomes3,6, or expressed from DNA plasmid vectors4,7. Once the RNA species reaches the cytosol, the RNAi pathway relies on the RISC complex to process dsRNA, facilitate antisense recognition of the target, and catalyze translational repression, mRNA degradation, or heterochromatin formation, depending on the host.
Because of these requirements, classical RNAi can be performed only in organisms that take up exogenous RNA efficiently and express RISC or a RISC-like activity. Notably, this excludes the model bacterium E. coli, which lacks the RNAi pathway. However, recent advances in synthetic biology provide the tools to solve both the delivery problem and the silencing problem.
In this protocol, sRNA constructs are expressed in E. coli from a DNA vector delivered to living cells using the M13 phagemid/helper system. A phagemid is any plasmid with a phage-derived f1 origin of replication. A helper plasmid, in this case M13KO, carries all the machinery required to produce viral particles, but is not itself competent for replication and packaging. When a phagemid and helper plasmid are co-transformed, the phagemid alone is replicated at the f1 origin, packaged and secreted. The vectorized phagemid is then competent to infect live E. coli via the F pilus.
In this system, the silencing effect is produced by custom sRNA cassettes combining a scaffold sequence with a target-binding sequence. The target-binding sequence is 24 base pairs antisense to an mRNA target, typically at the ribosome-binding site (RBS). The scaffold sequence, developed by Na and colleagues8, contains an Hfq-binding motif extracted from MicC, a small regulatory RNA endogenous to E. coli. The Hfq protein stimulates RNA-RNA binding and mRNA degradation, serving a role in this system similar to RISC in RNAi. Figure 1 depicts a complete scheme for phage-mediated sRNA knockdowns, including the sRNA cassette structure, phagemid vectorization, and silencing mechanism.
As a method to modulate gene expression in E. coli, sRNA silencing is simple, rapid and versatile. The targeted E. coli is not burdened beyond propagating the phagemid and expressing the sRNA. This may be relevant in the context of synthetic biology or basic research where the expression of larger heterologous constructs can strain cellular resources9. Phagemids with new targets can be produced with a single PCR and harvested one day after phagemid transformation. Finally, nearly any mRNA can be targeted. The sRNA regulation cassette (on a standard plasmid) has been shown to work on a variety of targets in metabolism with typical repression levels &#62;90%8.
This protocol reproduces and expands on earlier work using phagemid-born sRNA cassettes10. First, a packaged phagemid is introduced to a batch culture of E. coli cells and used to silence expression of the fluorescent protein mKate2. Subsequent fluorescence changes are monitored in real time. Second, knocking down the CAT gene is shown to reduce phenotypic chloramphenicol resistance on agar plates. In both cases, the phagemid itself carries a GFP marker, allowing infection rate to be measured independently of the knockdown efficiency.

<table border="0" cellpadding="0" cellspacing="0" width="637">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Plasmid Miniprep Kit</td>
			<td style="width:135px;">Qiagen</td>
			<td style="width:119px;">27104</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DpnI Enzyme</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">R0176S</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phusion High Fidelity Polymerase</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">M0530S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Taq 2x Master Mix</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">M0270L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">M13KO7 Helper Phage</td>
			<td style="width:135px;">NEB</td>
			<td style="width:119px;">N0315S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DH5&#945; Competent Cells</td>
			<td style="width:135px;">Life Technologies</td>
			<td style="width:119px;">18265-017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">TOP10F&#39; Cells</td>
			<td style="width:135px;">Life Technologies</td>
			<td style="width:119px;">C3030-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">LB Broth</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">L3022-250G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Ampicillin</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">A9393-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Kanamycin</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">60615-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Chloramphenicol</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">C0378-5G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tetracycline</td>
			<td style="width:135px;">Sigma</td>
			<td style="width:119px;">87128-25G</td>
			<td></td>
		</tr>
	</tbody>
</table>

phage-mediated delivery of targeted srna constructs to knock down gene expression in e. coli

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Silencing of mKate2 Fluorescence in Liquid Media
Figure 1 depicts the scheme for sRNA-mediated knockdowns described in this work, including the sRNA cassette design, phagemid vectorization, and silencing mechanism. Following protocol 1.2, the sRNA silencing cassette of plasmid pAB.001 was altered to target mKate. The sRNA cassette was synthetized and cloned into phagemid Litmus28i_J23115-B0032-GFP, a gift from Monica Ortiz and Drew Endy11. This phagemid carries markers for GFP expression and kanamycin resistance, allowing successful infections to be tracked. Packaged phagemid stocks were prepared following protocol 2.
A derivative of E. coli K12 MG1655 carrying a constitutively expressed, chromosomally integrated mKate2 marker was prepared for phage infection by conjugation with an F plasmid donor strain following protocol 3. The cells were grown to mid log phase and the phagemid introduced following protocol 4. After phagemid infection, 200 &#956;l cultures were transferred to a fluorescence plate reader and fluorescence was monitored continuously for 24 hr.
Figure 3 shows the effect of sRNA-mediated silencing on mKate2 expression. The strain infected with an anti-mKate2 phagemid showed no detectable mKate2 fluorescence over background. In contrast, this strain did express the GFP marker, indicating successful uptake of the phagemid. Uninfected control cells produced mKate2 fluorescence but not GFP. An additional control, in which the anti-mKate2 targeting domain was replaced with a sequence targeting CAT, had no effect on mKate2 fluorescence.
Silencing of Chloramphenicol Resistance on Agar Plates
Following protocol 1.1, an sRNA silencing cassette was produced to target CAT. A derivative of E. coli K12 MG1655 carrying a constitutively expressed, chromosomally integrated CAT marker was prepared for phage infection by conjugation with an F-plasmid donor strain following protocol 3. The cells were grown to mid log phase and the phagemid introduced following protocol 4. After 1 hr of incubation at 37 &#176;C, infected cells were serially diluted and plated at a range of chloramphenicol concentrations. Plates were incubated overnight, and the proportion of resistant cells at each chloramphenicol concentration was determined by counting colony forming units (CFUs) the next day.
Figure 4 shows the effect of sRNA-mediated silencing on the chloramphenicol resistance phenotype. Uninfected cells, or cells infected with phagemid targeting mKate2, were resistant to chloramphenicol at all concentrations tested. In contrast, cells infected with phagemid targeting CAT showed reduced survival at low chloramphenicol concentrations, and nearly 99% killing at higher concentrations. The addition of ampicillin, to select for only bacteria carrying the phagemid, reduced chloramphenicol survival to undetectable levels. This is consistent with earlier work showing that escape from phage infection is a common route to escape silencing10.
<img alt="Figure 1" src="/files/ftp_upload/53618/53618fig1.jpg" /> 
Figure 1: Gene Silencing in E. coli with sRNA Expression Cassettes Delivered by M13 Phage.&#160;The sRNA cassette is composed of 4 modules: the pR promoter (a constitutive promoter derived from bacteriophage lambda), a 24 bp targeting domain, an Hfq binding domain extracted from MicC and a transcriptional terminator8. The cassette is incorporated into a phagemid bearing the M13 f1 replication origin and packaged into the M13 capsid using the helper phage M13KO7. Packaged phagemids are able to infect E. coli expressing the F pilus, where sRNA expression begins. The sRNA then recruits the Hfq protein (depicted in red) and binds an antisense mRNA target near the ribosome binding site, resulting in translational repression and mRNA degradation. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53618/53618fig2.jpg" /> 
Figure 2: Primer Design and Site-Directed Mutagenesis of the sRNA Target Site. Two primers are designed with partial homology to an existing sRNA cassette. The forward primer contains 20 bp homologous to the pR promoter at the 5&#39; end, followed by 24 bp representing the new GUIDE sequence, then 18 bp homologous to the Hfq-binding domain at the 3&#39; end. The reverse primer is the exact reverse complement of the forward primer, with regions of homology to the existing sRNA cassette flanking the reverse complement of the new GUIDE sequence. Exact primer sequences are given in Table 3. Separate single-primer PCR reactions with the forward and the reverse primers produce linear, single-stranded DNA with the desired modified sequence. Annealing the forward and reverse reaction products, following clean-up as described in the protocol, results in double-stranded plasmid DNA bearing the desired modified sRNA cassette. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53618/53618fig3.jpg" /> 
Figure 3: Knockdown of a Chromosomally Integrated mKate2 Fluorescent Reporter. E. coli MG1655 K12 expressing mKate2 were either left untreated (red lines and bars), infected with an anti-mKate2 phagemid (green lines and bars), or infected with a control phagemid targeting CAT (blue lines and bars). (A) Untreated E. coli grew to higher saturation densities, indicating a metabolic cost to phage infection. Dotted lines indicate standard deviations of 3 replicates. (B) The mKate2 signal was reduced to near background levels in the anti-mKate2 treated strain, but not in control strains. (C) GFP fluorescence, also carried by the phagemid, was detectable only in phagemid-treated controls. (D, E) Final fluorescence readings after 24 hr of growth were normalized to OD. GFP signal, indicating phagemid infection, was absent in untreated controls, but also substantially reduced following anti-CAT phagemid treatment. This may indicate off-target effects of the phagemid. The mKate2 signal was reduced by anti-mKate2 phagemid treatment compared to untreated controls. The CAT-targeted control phagemid showed no effect on mKate2 fluorescence. Error bars represent standard deviation of 3 replicates. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53618/53618fig4.jpg" /> 
Figure 4: Knockdown of CAT Restores Chloramphenicol Sensitivity to a Genetically Resistant Population. E. coli MG1655 K12 expressing a chromosomally integrated CAT gene were left untreated (red bars), treated with a control phagemid targeting mKate2 (green bars), or treated with a phagemid expressing an anti-CAT sRNA (blue bars). After 1 hr of infection, viability on the indicated antibiotics was assessed by serial dilutions and plating. Strains treated with anti-CAT phagemid were significantly killed (&#62;90%) by chloramphenicol at higher concentrations, while control treatments were unaffected. Adding ampicillin to the culture plates positively selects for phagemid infection and eliminates uninfected cells. Under these conditions, no chloramphenicol resistant colonies were observed after anti-CAT treatment. This indicates that most survivors represent a failure of infection, rather than a failure of silencing. Error bars represent the standard deviation of 3 replicates. <a href="https://www.jove.com/files/ftp_upload/53618/53618fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>CAT TARGET sequence</td>
			<td>5&#39; - ATGGAGAAAAAAATCACTGGATAT - 3&#39;</td>
		</tr>
		<tr>
			<td>CAT GUIDE sequence</td>
			<td>5&#39; - ATATCCAGTGATTTTTTTCTCCAT - 3&#39;</td>
		</tr>
	</tbody>
</table>
Table 1: An example TARGET and GUIDE Sequence for the CAT Gene. Note the reverse complement relationship.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>pR promoter</td>
			<td colspan="5">TAACACCGTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGC</td>
		</tr>
		<tr>
			<td>GUIDE sequence</td>
			<td colspan="5">ATATCCAGTGATTTTTTTCTCCAT</td>
		</tr>
		<tr>
			<td>Hfq binding domain</td>
			<td colspan="5">TTTCTGTTGGGCCATTGCATTGCCACTGATTTTCCAACATATAAAAAGACAAGCCCGAACAGTCGTCCGGGCTTTTTT 
			TCTCGAG</td>
		</tr>
		<tr>
			<td>T1/TE terminator</td>
			<td colspan="5">CTCGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTTTTGTCGGTGAA 
			CGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA</td>
		</tr>
	</tbody>
</table>
Table 2: Sequence Components of the sRNA Cassette. Each sequence is written 5&#39;-3&#39;. The complete cassette is the concatenation of these 4 elements in order and comprises 292 bp.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Forward Primer</td>
			<td>5&#39; - CTGGCGGTGATAATGGTTGC[GUIDE]TTTCTGTTGGGCCATTGC - 3&#39;</td>
		</tr>
		<tr>
			<td>Reverse Primer</td>
			<td>5&#39; - GCAATGGCCCAACAGAAA[TARGET]GCAACCATTATCACCGCCAG - 3&#39;</td>
		</tr>
	</tbody>
</table>
Table 3: Primer Design to Alter Existing GUIDE Elements. The forward primer includes the last 20 bp of the pR promoter, the new GUIDE sequence, and the first 18 bp of the Hfq-binding domain. The TARGET sequence is the exact reverse complement of the GUIDE sequence. The reverse primer is the exact reverse complement of the forward primer.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Volume</td>
		</tr>
		<tr>
			<td>Template plasmid</td>
			<td>500 ng</td>
		</tr>
		<tr>
			<td>10 &#181;M Primer</td>
			<td>2.5 &#956;l</td>
		</tr>
		<tr>
			<td>10 mM dNTPs</td>
			<td>0.4 &#956;l</td>
		</tr>
		<tr>
			<td>High-fidelity Polymerase (2 U/&#956;l)</td>
			<td>0.5 &#956;l</td>
		</tr>
		<tr>
			<td>5x PCR Buffer</td>
			<td>10 &#956;l</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>50 &#956;l</td>
		</tr>
	</tbody>
</table>
Table 4: Suggested Conditions for the Single-Primer Mutagenic PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temp</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>98 &#176;C</td>
			<td>30 sec</td>
		</tr>
		<tr>
			<td rowspan="3">30 cycles</td>
			<td>98 &#176;C</td>
			<td>10 sec</td>
		</tr>
		<tr>
			<td>55 &#176;C</td>
			<td>30 sec</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>120 sec</td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>72 &#176;C</td>
			<td>300 sec</td>
		</tr>
		<tr>
			<td>Storage</td>
			<td>10 &#176;C</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 5: Suggested Thermocycler Protocol for the Single-Primer Mutagenic PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Volume</td>
		</tr>
		<tr>
			<td>Template DNA</td>
			<td>1 &#956;l</td>
		</tr>
		<tr>
			<td>10 &#181;M Forward Primer</td>
			<td>0.5 &#956;l</td>
		</tr>
		<tr>
			<td>10 &#181;M Reverse Primer</td>
			<td>0.5 &#956;l</td>
		</tr>
		<tr>
			<td>Taq 2X Master Mix</td>
			<td>25 &#956;l</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>23 &#956;l</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>50 &#956;l</td>
		</tr>
	</tbody>
</table>
Table 6: Suggested Conditions for the Sequence Verification PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temp</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>95 &#176;C</td>
			<td>30 sec</td>
		</tr>
		<tr>
			<td rowspan="3">30 cycles</td>
			<td>95 &#176;C</td>
			<td>30 sec</td>
		</tr>
		<tr>
			<td>55 &#176;C</td>
			<td>30 sec</td>
		</tr>
		<tr>
			<td>68 &#176;C</td>
			<td>30 sec</td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>68 &#176;C</td>
			<td>300 sec</td>
		</tr>
		<tr>
			<td>Storage</td>
			<td>10 &#176;C</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 7: Suggested Thermocycler Protocol for the Sequence Verification PCR.

Watch this Scientific Journal Video about Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli at JoVE.com

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be ...

phage-mediated-delivery-targeted-srna-constructs-to-knock-down-gene

Research

JoVE Journal

Biology

12.5K Views.  Institut National de la Santé et de la Recherche Médicale (INSERM), Université Paris Descartes. We describe a method to knock down gene expression in a growing population of E. coli cells using sequence-targeted sRNA expression cassettes delivered by an M13 phagemid vector.

Video: Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Using the Gene Pulser MXcell Electroporation System to Transfect Primary Cells with High Efficiency

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer (Bio-Rad) were specifically developed to easily transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells. We will demonstrate how to perform a simple experiment to quickly identify the best electroporation conditions. We will demonstrate how to run several samples through a range of electroporation conditions so that an experiment can be conducted at the same time as optimization is performed. We will also show how optimal conditions identified using 96-well electroporation plates can be used with standard electroporation cuvettes, facilitating the switch from electroporation plates to electroporation cuvettes while maintaining the same electroporation efficiency. In the video, we will also discuss some of the key factors that can lead to the success or failure of electroporation experiments.

This procedure shows how to use the Gene Pulser MXcell electroporation system to rapidly and easily identify the best electroporation conditions for mouse embryonic fibroblasts (MEFs) or other primary cells. Considerations for troubleshooting are also discussed in the associated video.

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, compromising downstream analyses. Considering the complex and dynamic cellular associations existing within many tissues, in order to recapitulate the in vivo interactions thorough molecular analysis one must be able to analyze specific cell populations within their native context. Laser-mediated microdissection can achieve this goal, allowing unambiguous identification and successful harvest of cells of interest under direct microscopic visualization while maintaining molecular integrity. We have applied this technology to analyse gene expression within defined areas of the developing Drosophila wing disc, which represents an advantageous model system to study growth control, cell differentiation and organogenesis. Larval imaginal discs are precociously subdivided into anterior and posterior, dorsal and ventral compartments by lineage restriction boundaries. Making use of the inducible GAL4-UAS binary expression system, each of these compartments can be specifically labelled in transgenic flies expressing an UAS-GFP transgene under the control of the appropriate GAL4-driver construct. In the transgenic discs, gene expression profiling of discrete subsets of cells can precisely be determined after laser-mediated microdissection, using the fluorescent GFP signal to guide laser cut. 
Among the variety of downstream applications, we focused on RNA transcript profiling after localised RNA interference (RNAi). With the advent of RNAi technology, GFP labelling can be coupled with localised knockdown of a given gene, allowing to determinate the transcriptional response of a discrete cell population to the specific gene silencing. To validate this approach, we dissected equivalent areas of the disc from the posterior (labelled by GFP expression), and the anterior (unlabelled) compartment upon regional silencing in the P compartment of an otherwise ubiquitously expressed gene. RNA was extracted from microdissected silenced and unsilenced areas and comparative gene expression profiling determined by quantitative real-time RT-PCR. We show that this method can effectively be applied for accurate transcriptomics of subsets of cells within the Drosophila imaginal discs. Indeed, while massive disc preparation as source of RNA generally assumes cell homogeneity, it is well known that transcriptional expression can vary greatly within these structures in consequence of positional information. Using localized fluorescent GFP signal to guide laser cut, more accurate transcriptional analyses can be performed and profitably applied to disparate applications, including transcript profiling of distinct cell lineages within their native context.

Laser Microdissection Applied to Gene Expression Profiling of Subset of Cells from the Drosophila Wing Disc

Laser microdissection was applied to analyse gene expression profiling in specific compartments of Drosophila wing disc subjected to localised RNAi in vivo. RNA extracted from equivalent areas of silenced and unsilenced compartments was analysed by quantitative RT-PCR to determine comparative gene expression profiling within the context of native tissue microecology.

Heterogeneous nature of tissues has proven to be a limiting factor in the amount of information that can be generated from biological samples, ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular signatures, or to evolve proteins in the laboratory. Here, we present a protocol that allows the generation of large (>1011) mutant libraries for a given target sequence. This method is based on replication of a ColE1 plasmid encoding the desired sequence by a low-fidelity variant of DNA polymerase I (LF-Pol I). The target plasmid is transformed into a mutator strain of E. coli and plated on solid media, yielding between 0.2 and 1 mutations/kb, depending on the location of the target gene. Higher mutation frequencies are achieved by iterating this process of mutagenesis. Compared to alternative methods of mutagenesis, our protocol stands out for its simplicity, as no cloning or PCR are involved. Thus, our method is ideal for mutational labeling of plasmids or other Pol I templates or to explore large sections of sequence space for the evolution of activities not present in the original target. The tight spatial control that PCR or randomized oligonucleotide-based methods offer can also be achieved through subsequent cloning of specific sections of the library. Here we provide protocols showing how to create a random mutant library and how to establish drug-based selections in E. coli to identify mutants exhibiting new biochemical activities.

Mutagenesis and Functional Selection Protocols for Directed Evolution of Proteins in E. coli

Here we demonstrate a simple protocol to create a random mutant library for a given target sequence. We show how this method, which is performed in vivo in Escherichia coli, can be coupled with functional selections to evolve new enzymatic activities.

The efficient generation of genetic diversity represents an invaluable molecular tool that can be used to label DNA synthesis, to create unique molecular ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.&nbsp; Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

We describe a technique for analysis of global RNA synthesis in hypoxia using imaging. Click-chemistry labeling of RNA has not previously been performed under hypoxia and allows visualization of global RNA changes at the single cell level. This approach complements the existing averaged RNA techniques, allowing direct visualization of cell-to-cell changes in global RNA synthesis.

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a ...

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. However, purifying proteins is sometimes challenging since many proteins are expressed in an insoluble form. When working with difficult or multiple targets it is therefore recommended to use high throughput (HTP) protein expression screening on a small scale (1-4&#160;ml cultures) to quickly identify conditions for soluble expression. To cope with the various structural genomics programs of the lab, a quantitative (within a range of 0.1-100 mg/L culture of recombinant protein) and HTP protein expression screening protocol was implemented and validated on thousands of proteins. The protocols were automated with the use of a liquid handling robot but can also be performed manually without specialized equipment.
Disulfide-rich venom proteins are gaining increasing recognition for their potential as therapeutic drug leads. They can be highly potent and selective, but their complex disulfide bond networks make them challenging to produce. As a member of the FP7 European Venomics project (<a href="http://www.venomics.eu">www.venomics.eu</a>), our challenge is to develop successful production strategies with the aim of producing thousands of novel venom proteins for functional characterization. Aided by the redox properties of disulfide bond isomerase DsbC, we adapted our HTP production pipeline for the expression of oxidized, functional venom peptides in the E. coli cytoplasm. The protocols are also applicable to the production of diverse disulfide-rich proteins. Here we demonstrate our pipeline applied to the production of animal venom proteins. With the protocols described herein it is likely that soluble disulfide-rich proteins will be obtained in as little as a week. Even from a small scale, there is the potential to use the purified proteins for validating the oxidation state by mass spectrometry, for characterization in pilot studies, or for sensitive micro-assays.

High Throughput Quantitative Expression Screening and Purification Applied to Recombinant Disulfide-rich Venom Proteins Produced in E. coli

A protocol for the quantitative, high throughput expression screening and analytical purification of fusion proteins from small-scale Escherichia coli cultures is described and applied to the expression of disulfide-rich animal venom protein targets.

Escherichia coli (E. coli) is the most widely used expression system for the production of recombinant proteins for structural and functional studies. ...

Transient Expression of Proteins by Hydrodynamic Gene Delivery in Mice

Efficient expression of transgenes in vivo is of critical importance in studying gene function and developing treatments for diseases. Over the past years, hydrodynamic gene delivery (HGD) has emerged as a simple, fast, safe and effective method for delivering transgenes into rodents. This technique relies on the force generated by the rapid injection of a large volume of physiological solution to increase the permeability of cell membranes of perfused organs and thus deliver DNA into cells. One of the main advantages of HGD is the ability to introduce transgenes into mammalian cells using naked plasmid DNA (pDNA). Introducing an exogenous gene using a plasmid is minimally laborious, highly efficient and, contrary to viral carriers, remarkably safe. HGD was initially used to deliver genes into mice, it is now used to deliver a wide range of substances, including oligonucleotides, artificial chromosomes, RNA, proteins and small molecules into mice, rats and, to a limited degree, other animals. This protocol describes HGD in mice and focuses on three key aspects of the method that are critical to performing the procedure successfully: correct insertion of the needle into the vein, the volume of injection and the speed of delivery. Examples are given to show the application of this method to the transient expression of two genes that encode secreted, primate-specific proteins, apolipoprotein L-I (APOL-I) and haptoglobin-related protein (HPR).

In vivo transfection of naked DNA by hydrodynamic gene delivery introduces genes into the tissue of an animal with minimal inflammatory response. Sufficient amounts of gene product are generated such that gene function and regulation as well as protein structure and function can be analyzed.

Efficient expression of transgenes in vivo is of critical importance in studying gene function and developing treatments for diseases. Over the past ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli

Summary

Explore More Videos

PLAYLIST