Name: a facile protocol to generate site-specifically acetylated proteins in escherichia coli
Uploaded: 2017-12-09T14:00:00
Description: Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

이 작품은 NIH (AI119813), 아칸소 대학에서에서 시작 및 아칸소 생명과학 연구소에서 수상에 의해 지원 되었다.

1. 사이트 감독 Mutagenesis 대상 유전자의
참고: MDH T7 발기인 CloDF13 원본 및 복사본 수가 20 ~ 4034 pCDF 1 벡터에서 아래 표시 됩니다.
<ol><li>뇌관에 의해 유전자에 140 위치에서 황색 정지 codon를 소개 (뇌관을 앞으로: GGTGTTTATGAC태그AACAAACTGTTCGGCG 및 뇌관을 역방향: GGCTTTTTTCAGCACTTCAGCAGCAATTGC)의 사이트 지시 된 mutagenesis 키트 명령 다음.</li>
	<li>?...

<ol>
	<li>Krishna, R. G., Wold, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-translational+modification+of+proteins.">Post-translational modification of proteins.</a> Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).</li><li>Lothrop, A. P., Torres, M. P., Fuchs, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+post-translational+modification+codes.">Deciphering post-translational modification codes.</a> FEBS Lett. 587 (8), 1247-1257 (2013).</li><li>Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Posttranslational modification of proteins : expanding nature's inventory. , (2006).</li><li>Khoury, G. A., Baliban, R. C., Floudas, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome-wide+post-translational+modification+statistics:+frequency+analysis+and+curation+of+the+swiss-prot+database.">Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database.</a> Sci Rep. 1, (2011).</li><li>Grotenbreg, G., Ploegh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology:+dressed-up+proteins.">Chemical biology: dressed-up proteins.</a> Nature. 446 (7139), 993-995 (2007).</li><li>Arif, M., Selvi, B. R., Kundu, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+the+tale+of+a+modification+from+transcription+regulation+to+metabolism.">Lysine acetylation: the tale of a modification from transcription regulation to metabolism.</a> Chembiochem. 11 (11), 1501-1504 (2010).</li><li>Cohen, T., Yao, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AcK-knowledge+reversible+acetylation.">AcK-knowledge reversible acetylation.</a> Science's STKE : signal transduction knowledge environment. (245), pe42 (2004).</li><li>Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+world+of+protein+acetylation.">The world of protein acetylation.</a> Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).</li><li>Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N&#949;-acetylation+control+conserved+in+all+three+life+domains.">N&#949;-acetylation control conserved in all three life domains.</a> Microbe. 5, 340-344 (2010).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation:+a+regulatory+modification+to+rival+phosphorylation?.">Acetylation: a regulatory modification to rival phosphorylation?.</a> The EMBO journal. 19 (6), 1176-1179 (2000).</li><li>Soppa, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+archaea,+bacteria,+and+eukaryotes.">Protein acetylation in archaea, bacteria, and eukaryotes.</a> Archaea. , (2010).</li><li>Verdin, E., Ott, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=50+years+of+protein+acetylation:+from+gene+regulation+to+epigenetics,+metabolism+and+beyond.">50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond.</a> Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).</li><li>Allfrey, V. G., Faulkner, R., Mirsky, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+Methylation+of+Histones+and+Their+Possible+Role+in+the+Regulation+of+Rna+Synthesis.">Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis.</a> P Natl Acad Sci USA. 51, 786-794 (1964).</li><li>Phillips, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+acetyl+groups+of+histones.">The presence of acetyl groups of histones.</a> Biochem j. 87, 258-263 (1963).</li><li>Sterner, D. E., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+of+histones+and+transcription-related+factors.">Acetylation of histones and transcription-related factors.</a> Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).</li><li>Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+deacetylation+of+non-histone+proteins.">Acetylation and deacetylation of non-histone proteins.</a> Gene. 363, 15-23 (2005).</li><li>Close, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+lysine+acetylation+of+non-nuclear+proteins.">The emerging role of lysine acetylation of non-nuclear proteins.</a> Cell Mol Life Sci. 67 (8), 1255-1264 (2010).</li><li>Iyer, A., Fairlie, D. P., Brown, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation+in+obesity,+diabetes+and+metabolic+disease.">Lysine acetylation in obesity, diabetes and metabolic disease.</a> Immunol Cell Biol. 90 (1), 39-46 (2012).</li><li>You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+enzymes,+bromodomains+and+links+to+different+diseases.">Lysine acetylation: enzymes, bromodomains and links to different diseases.</a> Essays Biochem. 52, 1-12 (2012).</li><li>Bonnaud, E. M., Suberbielle, E., Malnou, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+acetylation+in+neuronal+(dys)function.">Histone acetylation in neuronal (dys)function.</a> Biomol Concepts. 7 (2), 103-116 (2016).</li><li>Fukushima, A., Lopaschuk, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+control+of+cardiac+fatty+acid+beta-oxidation+and+energy+metabolism+in+obesity,+diabetes,+and+heart+failure.">Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure.</a> Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).</li><li>Kaypee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+lysine+acetylation+in+tumorigenesis:+Implications+in+the+development+of+therapeutics.">Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics.</a> Pharmacol Ther. 162, 98-119 (2016).</li><li>Tapias, A., Wang, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+Acetylation+and+Deacetylation+in+Brain+Development+and+Neuropathies.">Lysine Acetylation and Deacetylation in Brain Development and Neuropathies.</a> Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).</li><li>Hu, L. I., Lima, B. P., Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+the+dawning+of+a+new+age.">Bacterial protein acetylation: the dawning of a new age.</a> Molecular microbiology. 77 (1), 15-21 (2010).</li><li>Jones, J. D., O'Connor, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+prokaryotes.">Protein acetylation in prokaryotes.</a> Proteomics. 11 (15), 3012-3022 (2011).</li><li>Bernal, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+bacterial+physiology+by+lysine+acetylation+of+proteins.">Regulation of bacterial physiology by lysine acetylation of proteins.</a> New biotechnol. 31 (6), 586-595 (2014).</li><li>Hentchel, K. L., Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acylation+of+Biomolecules+in+Prokaryotes:+a+Widespread+Strategy+for+the+Control+of+Biological+Function+and+Metabolic+Stress.">Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress.</a> Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).</li><li>Ouidir, T., Kentache, T., Hardouin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+lysine+acetylation+in+bacteria:+Current+state+of+the+art.">Protein lysine acetylation in bacteria: Current state of the art.</a> Proteomics. 16 (2), 301-309 (2016).</li><li>Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+new+discoveries+unanswered+questions.">Bacterial protein acetylation: new discoveries unanswered questions.</a> Curr Genet. 62 (2), 335-341 (2016).</li><li>Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoacetylation+of+the+histone+acetyltransferase+Rtt109.">Autoacetylation of the histone acetyltransferase Rtt109.</a> J Biol Chem. 286 (28), 24694-24701 (2011).</li><li>Neumann, H., Peak-Chew, S. Y., Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+N&#949;-acetyllysine+in+recombinant+proteins.">Genetically encoding N&#949;-acetyllysine in recombinant proteins.</a> Nat chem biol. 4 (4), 232-234 (2008).</li><li>Fan, C., Xiong, H., Reynolds, N. M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationally+evolving+tRNAPyl+for+efficient+incorporation+of+noncanonical+amino+acids.">Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids.</a> Nucleic Acids Res. 43 (22), e156 (2015).</li><li>Bryson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+directed+evolution+of+aminoacyl-tRNA+synthetases+to+alter+amino+acid+specificity+and+enhance+activity.">Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity.</a> Nat Chem Biol. , (2017).</li><li>Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+the+Lysine+Acetylation+of+Malate+Dehydrogenase.">Studying the Lysine Acetylation of Malate Dehydrogenase.</a> J Mol Biol. 429 (9), 1396-1405 (2017).</li><li>Venkat, S., Gregory, C., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+the+lysine+acetylation+of+tyrosyl-tRNA+synthetase+in+Escherichia+coli.">Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli.</a> Chembiochem. 18 (19), 1928-1934 (2017).</li><li>Liu, C. C., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adding+new+chemistries+to+the+genetic+code.">Adding new chemistries to the genetic code.</a> Annu Rev Biochem. 79, 413-444 (2010).</li><li>Mukai, T., Lajoie, M. J., Englert, M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rewriting+the+Genetic+Code.">Rewriting the Genetic Code.</a> Annu Rev Microbiol. , (2017).</li><li>O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upgrading+protein+synthesis+for+synthetic+biology.">Upgrading protein synthesis for synthetic biology.</a> Nat Chem Biol. 9 (10), 594-598 (2013).</li><li>Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+and+reprogramming+the+genetic+code+of+cells+and+animals.">Expanding and reprogramming the genetic code of cells and animals.</a> Annu Rev Biochem. 83, 379-408 (2014).</li><li>O'Donoghue, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-cognate+suppression+of+amber,+opal+and+quadruplet+codons+competes+with+aminoacyl-tRNAPyl+for+genetic+code+expansion.">Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion.</a> FEBS Lett. 586 (21), 3931-3937 (2012).</li><li>Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+amino+acid+composition+of+proteins+within+an+expanded+genetic+code.">Revealing the amino acid composition of proteins within an expanded genetic code.</a> Nucleic Acids Res. 43 (2), e8 (2015).</li><li>Huang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+convenient+method+for+genetic+incorporation+of+multiple+noncanonical+amino+acids+into+one+protein+in+Escherichia+coli.">A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli.</a> Mol Biosyst. 6 (4), 683-686 (2010).</li><li>Venkat, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+thioacetyl-lysine+as+a+nondeacetylatable+analog+of+lysine+acetylation+in+Escherichia+coli.">Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli.</a> FEBS Open. , (2017).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).</li><li>Gregoretti, I. V., Lee, Y. M., Goodson, H. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evolution+of+the+histone+deacetylase+family:+functional+implications+of+phylogenetic+analysis.">Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis.</a> J Mol Biol. 338 (1), 17-31 (2004).</li><li>Weinert, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetyl-phosphate+is+a+critical+determinant+of+lysine+acetylation+in+E.+coli.">Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli.</a> Mol cell. 51 (2), 265-272 (2013).</li></ol>

비정규 아미노산 (ncAAs)의 유전 결합 ncAA 청구 tRNA에 의해 할당 된 codon, 주로는 황색 정지 codon UAG36,37,38,39의 억제에 기반 해당 anticodon 포함 하. UAG codon 릴리스 요소-1 (RF1) 박테리아에 의해 인식 된다로 알려져 있다 그리고 그것은 또한 억제할 수 있습니다 의해 정식 아미노산 (cAAs)로 청구 하는 호스트에?...

포스트 번역 상 수정 (PTMs) 단백질의 번역 과정 후 발생 하 고 공유 추가 기능 그룹에서 발생 하는 아미노산 잔류물, 유전자를 포함 하 여 거의 모든 생물 학적 과정에 중요 한 역할을 재생을 전사, 스트레스 반응, 세포 분화, 및 물질 대사1,2,3 날짜 하려면, 약 400 독특한 PTMs 확인된4되었습니다. 게놈과는 프로테옴의 intricacy는 단백질 PTMs로 대부분 증폭 단백질 활동 및 지역화, 고 단백질, 핵 산, 지질, 및 공동 인자5등 다른 분자와 상호 작용에 영향을 미칠.
단백질 acetylation 지난 2 년간6,7,,89,10,11,12PTMs 연구의 최전선에 왔다. Lysine acetylation 처음 발견 되었다 히스톤에 이상의 50 년 전13,14은 잘 조사 되어, 80 개 이상의 녹음 방송 요인, 레 귤 레이 터, 및 다양 한 단백질15에 알려져 있다 16,17. 단백질 acetylation에 대 한 연구 뿐만 아니라, 규제 메커니즘의 깊은 이해를 제공 하지만 다양 한 역 기능 acetylation18,19, 로 인 한 질병에 대 한 치료 가이드 20 , 21 , 22 , 23. lysine acetylation 진핵생물에서 발생 하지만 최근 연구는 단백질 acetylation 또한 세균 생리학, chemotaxis, 내 산 성, 활성화 및 안정화를 포함 하 여 주요 역할 재생 믿어 pathogenicity 섬과 다른 독성 단백질24,25,26,27,,2829관련.
Lysine acetylation 화학적 특성을 일반적으로 사용 되는 방법은 사이트 지시 된 mutagenesis 사용 하는. 글루타민은 비슷한 크기와 극성 때문에 acetyllysine의 모방으로 사용 됩니다. 아르기닌은 생리 적인 조건 하에서 그것의 긍정적인 요금을 유지 하지만 acetylated 수 없습니다 비 acetylated lysine 모방으로 활용 됩니다. 그러나, 두 모방 하지 진짜 isosteres 이며 항상 예상된 결과30를 생성 하지 않습니다. 가장 엄격한 접근은 어렵거나 lysine acetylation 자연7,11의 낮은 산출할 인해 가장 고전적인 방법에 대 한 특정 리 진 잔류물에 균질 acetylated 단백질을 생성 하는 것입니다. 이 문제는 설계 pyrrolysyl-tRNA 합성을 사용 하 여 유전자 코드 확장 전략에 의해 unraveled 되었습니다 tRNA 충전 Methanosarcinaceae 종에서 벗어나 acetyllysine와Pyl 활용 호스트 변환 기계는 UAG를 억제 하는 mRNA에 codon를 중지 하 고 대상 단백질31의 설계 위치에 acetyllysine의 지휘. 최근에, 우리는 향상 된 EF-부 엉-바인딩 tRNA32 와 업그레이드 된 acetyllysyl-tRNA 합성33이 시스템을 최적화 했습니다. 또한, 우리는 malate 효소34 와 tyrosyl-tRNA 합성35의 acetylation 연구에서이 향상 된 통합 시스템을 적용 했습니다. 여기, 우리가 우리가 광범위 하 게 실증 사례로 공부 malate 효소 (MDH)를 사용 하 여 생화학 식별 분자 클로닝에서 순전히 acetylated 단백질을 생성 하기 위한 프로토콜을 보여 줍니다.

<table border="0" cellpadding="0" cellspacing="0" width="615">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bradford protein assay</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">5000006</td>
			<td style="width:167px;">Protein concentration</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4x Laemmli Sample Buffer</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610747</td>
			<td style="width:167px;">SDS sample buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Coomassie G-250 Stain</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610786</td>
			<td style="width:167px;">SDS-PAGE gel staining</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4-20% SDS-PAGE ready gel</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">4561093</td>
			<td style="width:167px;">Protein determination</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ac-K-100 (HRP Conjugate)</td>
			<td style="width:113px;">Cell Signaling</td>
			<td style="width:119px;">6952</td>
			<td style="width:167px;">Antibody</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">IPTG</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">194</td>
			<td style="width:167px;">Expression inducer</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:216px;">N&#949;-Acetyl-L-lysine</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">5364</td>
			<td style="width:167px;">Noncanonical amino acid</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">PD-10 desalting column</td>
			<td style="width:113px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:167px;">Desalting</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Q5 Site-Directed Mutagenesis Kit</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">E0554</td>
			<td style="width:167px;">Introducing the stop codon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">BL21 (DE3) cells</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">C2527</td>
			<td style="width:167px;">Expressing strain</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">27106</td>
			<td style="width:167px;">Extracting plasmids</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ni-NTA resin</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">30210</td>
			<td style="width:167px;">Affinity purification resin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">nicotinamide</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">N3376</td>
			<td style="width:167px;">Deacetylase inhibitor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">&#946;-Mercaptoethanol</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6250</td>
			<td style="width:167px;">Reducing agent</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">BugBuster Protein Extraction Reagent</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">70584</td>
			<td style="width:167px;">Breaking cells</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Benzonase nuclease</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">E1014</td>
			<td style="width:167px;">DNase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">ECL Western Blotting Substrate</td>
			<td style="width:113px;">ThermoFisher</td>
			<td style="width:119px;">32106</td>
			<td style="width:167px;">Chemiluminescence</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Premixed LB Broth</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97064</td>
			<td style="width:167px;">Cell growth medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bovine serum albumin</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97061-416</td>
			<td style="width:167px;">western blots blocking</td>
		</tr>
	</tbody>
</table>

a facile protocol to generate site-specifically acetylated proteins in escherichia coli

포스트 번역 상 수정 단백질의 특정 위치에서 발생 하는 다양 한 세포질 프로세스에서에서 중요 한 역할을 보여왔다. 그 중, 가역 lysine acetylation 생활의 모든 영역에서 가장 넓게 분배 된 중 하나입니다. 수많은 acetylome 질량 분석 기반 연구를 수행 하는 있지만 더이 상 상속 acetylation 대상의 제한 되었습니다. 가능한 이유 하나 대부분 클래식 생 화 확 적인 방법에 의해 원하는 위치에 순전히 acetylated 단백질을 생성 하기 어렵습니다. 이 문제를 해결 하려면 유전자 코드 확장 기술 cotranslational 설립을 직접 설계 pyrrolysyl-tRNA 합성 변종, Methanosarcinaceae 종에서 그것의 동족 tRNA의 쌍을 사용 하 여 적용 된 관심사의 단백질에 특정 사이트에 acetyllysine의. Histone acetylation의 연구에서 첫 번째 응용 프로그램, 후이 이렇게 다양 한 단백질에 acetylation 연구 촉진 했다. 이 작품에서는, 우리는 호스트 모델 박테리아 대장균 을 사용 하 여 site-specifically acetylated 단백질을 생산 하는 손쉬운 프로토콜을 증명 하고있다. Malate 효소는이 작품에서 데모 예제로 사용 되었습니다.

야생-타입 MDH 그건 1 L 문화 당 31 mg acetylated MDH 단백질의 수익률 1 L 문화, 당 15 밀리 그램 이었다. 그림 1에서 보듯이 순화 된 단백질 SDS-PAGE로 분석 되었다. 야생-타입 MDH 긍정적인 제어34로 사용 되었다. 성장 매체에서 acetyllysine (AcK) 설립 시스템 및 돌연변이 mdh 유전자를 은닉 하는 세포에서 하지만 AcK 없이 순화 하는 단백질은 ...

Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

유전자 코드 확장 acetylation 단백질을 포함 한 생물 학적 과정의 넓은 범위를 공부 하는 강력한 도구 역할을 합니다. 여기 균질 생성 하기 위한이 기술을 악용 하는 손쉬운 프로토콜 acetylated 단백질 대장균 세포에 특정 사이트에 설명 합니다.

Site-Specifically 생성 하는 손쉬운 프로토콜 Acetylated 대장균 에서 단백질

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Research

JoVE Journal

Immunology and Infection

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

시각화 및 정량하기 위해 형광 단백질을 사용하여<em&gt; 클라미디아</em&gt; 액포 성장 역학 살아있는 세포에서

The obligate intracellular bacterium Chlamydia elicits a great burden on global public health. C.&#160;trachomatis is the leading bacterial cause of ...

연구

면역학 및 감염병학

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Neuropathogenic의 비 침습 모델<em&gt; 대장균</em&gt; 신생아 쥐에 감염

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

파지 Phenomics : 생리 학적 접근 방법은 소설 바이러스 성 단백질의 특성을

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

한 단계의 부정적인 크로마토 그래피 정제<em&gt; 헬리코박터 파이로리</em&gt; 호중구 - 활성화 단백질 과발현<em&gt; 대장균</em&gt; 배치 모드에서

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

형태 변화를 규명하기위한 프로토콜<em&gt; 클로스 트리 디움 디피 실</em&gt; 항생제 치료에 대한 반응

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

생물 발광 시스템 비-침략 적 비보에 의해 Murine 호스트에서 Enterohemorrhagic 대장균 식민지의 검출

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

밀도 Transposon 삽입 라이브러리를 사용 하 여 세균성 활용 Enterobacterial 종자와 같은 대장균 또는 Shigella flexneri 의 창조

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

인간의 과발현과 정제<em&gt; 시스</em&gt; - 프레 닐 트랜스퍼 라제<em&gt; 대장균</em

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

인간 T 세포 회수 응답에서 Vivo에서 공부 하는 흡입 물집 프로토콜

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

녹색 형광 단백질 표현 하는 향상 된 사용 하 여 대장균 마우스 복 막 대 식 세포 식 균 작용을 평가 하기 위해

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a ...