Name: a facile protocol to generate site-specifically acetylated proteins in escherichia coli
Uploaded: 2017-12-09T14:00:00
Description: Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

Dette arbeidet ble støttet av NIH (AI119813), oppstart fra University of Arkansas, og award fra Arkansas biovitenskap Instituttet.

1. stedet rettet mutagenese av målet genet
Merk: MDH er uttrykt under T7 arrangøren i pCDF-1 vektoren CloDF13 opprinnelse og kopiere flere 20 til 4034.
<ol><li>Introdusere den oransje stopp codon der 140 i genet av primere (videresende primer: GGTGTTTATGACTAGAACAAACTGTTCGGCG og reversere primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), følge instruksjonen av området-rettet mutagenese kit.</li>
	<li>Forsterke mal plasmider inneholder gene...

<ol>
	<li>Krishna, R. G., Wold, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-translational+modification+of+proteins.">Post-translational modification of proteins.</a> Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).</li><li>Lothrop, A. P., Torres, M. P., Fuchs, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+post-translational+modification+codes.">Deciphering post-translational modification codes.</a> FEBS Lett. 587 (8), 1247-1257 (2013).</li><li>Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Posttranslational modification of proteins : expanding nature's inventory. , (2006).</li><li>Khoury, G. A., Baliban, R. C., Floudas, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome-wide+post-translational+modification+statistics:+frequency+analysis+and+curation+of+the+swiss-prot+database.">Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database.</a> Sci Rep. 1, (2011).</li><li>Grotenbreg, G., Ploegh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology:+dressed-up+proteins.">Chemical biology: dressed-up proteins.</a> Nature. 446 (7139), 993-995 (2007).</li><li>Arif, M., Selvi, B. R., Kundu, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+the+tale+of+a+modification+from+transcription+regulation+to+metabolism.">Lysine acetylation: the tale of a modification from transcription regulation to metabolism.</a> Chembiochem. 11 (11), 1501-1504 (2010).</li><li>Cohen, T., Yao, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AcK-knowledge+reversible+acetylation.">AcK-knowledge reversible acetylation.</a> Science's STKE : signal transduction knowledge environment. (245), pe42 (2004).</li><li>Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+world+of+protein+acetylation.">The world of protein acetylation.</a> Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).</li><li>Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N&#949;-acetylation+control+conserved+in+all+three+life+domains.">N&#949;-acetylation control conserved in all three life domains.</a> Microbe. 5, 340-344 (2010).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation:+a+regulatory+modification+to+rival+phosphorylation?.">Acetylation: a regulatory modification to rival phosphorylation?.</a> The EMBO journal. 19 (6), 1176-1179 (2000).</li><li>Soppa, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+archaea,+bacteria,+and+eukaryotes.">Protein acetylation in archaea, bacteria, and eukaryotes.</a> Archaea. , (2010).</li><li>Verdin, E., Ott, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=50+years+of+protein+acetylation:+from+gene+regulation+to+epigenetics,+metabolism+and+beyond.">50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond.</a> Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).</li><li>Allfrey, V. G., Faulkner, R., Mirsky, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+Methylation+of+Histones+and+Their+Possible+Role+in+the+Regulation+of+Rna+Synthesis.">Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis.</a> P Natl Acad Sci USA. 51, 786-794 (1964).</li><li>Phillips, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+acetyl+groups+of+histones.">The presence of acetyl groups of histones.</a> Biochem j. 87, 258-263 (1963).</li><li>Sterner, D. E., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+of+histones+and+transcription-related+factors.">Acetylation of histones and transcription-related factors.</a> Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).</li><li>Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+deacetylation+of+non-histone+proteins.">Acetylation and deacetylation of non-histone proteins.</a> Gene. 363, 15-23 (2005).</li><li>Close, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+lysine+acetylation+of+non-nuclear+proteins.">The emerging role of lysine acetylation of non-nuclear proteins.</a> Cell Mol Life Sci. 67 (8), 1255-1264 (2010).</li><li>Iyer, A., Fairlie, D. P., Brown, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation+in+obesity,+diabetes+and+metabolic+disease.">Lysine acetylation in obesity, diabetes and metabolic disease.</a> Immunol Cell Biol. 90 (1), 39-46 (2012).</li><li>You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+enzymes,+bromodomains+and+links+to+different+diseases.">Lysine acetylation: enzymes, bromodomains and links to different diseases.</a> Essays Biochem. 52, 1-12 (2012).</li><li>Bonnaud, E. M., Suberbielle, E., Malnou, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+acetylation+in+neuronal+(dys)function.">Histone acetylation in neuronal (dys)function.</a> Biomol Concepts. 7 (2), 103-116 (2016).</li><li>Fukushima, A., Lopaschuk, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+control+of+cardiac+fatty+acid+beta-oxidation+and+energy+metabolism+in+obesity,+diabetes,+and+heart+failure.">Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure.</a> Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).</li><li>Kaypee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+lysine+acetylation+in+tumorigenesis:+Implications+in+the+development+of+therapeutics.">Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics.</a> Pharmacol Ther. 162, 98-119 (2016).</li><li>Tapias, A., Wang, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+Acetylation+and+Deacetylation+in+Brain+Development+and+Neuropathies.">Lysine Acetylation and Deacetylation in Brain Development and Neuropathies.</a> Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).</li><li>Hu, L. I., Lima, B. P., Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+the+dawning+of+a+new+age.">Bacterial protein acetylation: the dawning of a new age.</a> Molecular microbiology. 77 (1), 15-21 (2010).</li><li>Jones, J. D., O'Connor, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+prokaryotes.">Protein acetylation in prokaryotes.</a> Proteomics. 11 (15), 3012-3022 (2011).</li><li>Bernal, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+bacterial+physiology+by+lysine+acetylation+of+proteins.">Regulation of bacterial physiology by lysine acetylation of proteins.</a> New biotechnol. 31 (6), 586-595 (2014).</li><li>Hentchel, K. L., Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acylation+of+Biomolecules+in+Prokaryotes:+a+Widespread+Strategy+for+the+Control+of+Biological+Function+and+Metabolic+Stress.">Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress.</a> Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).</li><li>Ouidir, T., Kentache, T., Hardouin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+lysine+acetylation+in+bacteria:+Current+state+of+the+art.">Protein lysine acetylation in bacteria: Current state of the art.</a> Proteomics. 16 (2), 301-309 (2016).</li><li>Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+new+discoveries+unanswered+questions.">Bacterial protein acetylation: new discoveries unanswered questions.</a> Curr Genet. 62 (2), 335-341 (2016).</li><li>Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoacetylation+of+the+histone+acetyltransferase+Rtt109.">Autoacetylation of the histone acetyltransferase Rtt109.</a> J Biol Chem. 286 (28), 24694-24701 (2011).</li><li>Neumann, H., Peak-Chew, S. Y., Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+N&#949;-acetyllysine+in+recombinant+proteins.">Genetically encoding N&#949;-acetyllysine in recombinant proteins.</a> Nat chem biol. 4 (4), 232-234 (2008).</li><li>Fan, C., Xiong, H., Reynolds, N. M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationally+evolving+tRNAPyl+for+efficient+incorporation+of+noncanonical+amino+acids.">Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids.</a> Nucleic Acids Res. 43 (22), e156 (2015).</li><li>Bryson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+directed+evolution+of+aminoacyl-tRNA+synthetases+to+alter+amino+acid+specificity+and+enhance+activity.">Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity.</a> Nat Chem Biol. , (2017).</li><li>Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+the+Lysine+Acetylation+of+Malate+Dehydrogenase.">Studying the Lysine Acetylation of Malate Dehydrogenase.</a> J Mol Biol. 429 (9), 1396-1405 (2017).</li><li>Venkat, S., Gregory, C., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+the+lysine+acetylation+of+tyrosyl-tRNA+synthetase+in+Escherichia+coli.">Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli.</a> Chembiochem. 18 (19), 1928-1934 (2017).</li><li>Liu, C. C., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adding+new+chemistries+to+the+genetic+code.">Adding new chemistries to the genetic code.</a> Annu Rev Biochem. 79, 413-444 (2010).</li><li>Mukai, T., Lajoie, M. J., Englert, M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rewriting+the+Genetic+Code.">Rewriting the Genetic Code.</a> Annu Rev Microbiol. , (2017).</li><li>O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upgrading+protein+synthesis+for+synthetic+biology.">Upgrading protein synthesis for synthetic biology.</a> Nat Chem Biol. 9 (10), 594-598 (2013).</li><li>Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+and+reprogramming+the+genetic+code+of+cells+and+animals.">Expanding and reprogramming the genetic code of cells and animals.</a> Annu Rev Biochem. 83, 379-408 (2014).</li><li>O'Donoghue, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-cognate+suppression+of+amber,+opal+and+quadruplet+codons+competes+with+aminoacyl-tRNAPyl+for+genetic+code+expansion.">Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion.</a> FEBS Lett. 586 (21), 3931-3937 (2012).</li><li>Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+amino+acid+composition+of+proteins+within+an+expanded+genetic+code.">Revealing the amino acid composition of proteins within an expanded genetic code.</a> Nucleic Acids Res. 43 (2), e8 (2015).</li><li>Huang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+convenient+method+for+genetic+incorporation+of+multiple+noncanonical+amino+acids+into+one+protein+in+Escherichia+coli.">A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli.</a> Mol Biosyst. 6 (4), 683-686 (2010).</li><li>Venkat, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+thioacetyl-lysine+as+a+nondeacetylatable+analog+of+lysine+acetylation+in+Escherichia+coli.">Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli.</a> FEBS Open. , (2017).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).</li><li>Gregoretti, I. V., Lee, Y. M., Goodson, H. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evolution+of+the+histone+deacetylase+family:+functional+implications+of+phylogenetic+analysis.">Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis.</a> J Mol Biol. 338 (1), 17-31 (2004).</li><li>Weinert, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetyl-phosphate+is+a+critical+determinant+of+lysine+acetylation+in+E.+coli.">Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli.</a> Mol cell. 51 (2), 265-272 (2013).</li></ol>

Genetisk inkorporering av noncanonical aminosyrer (ncAAs) er basert på undertrykkelse av en tilordnet codon, hovedsakelig den oransje stopp codon UAG36,37,38,39, av ncAA-ladet tRNA som inneholder de tilsvarende anticodon. Som er kjent, UAG codon er anerkjent av det løslate faktor-1 (RF1) i bakterier, og det kan også være undertrykt nær beslektet tRNAs fra vertene av kanoniske aminosyrer (c...

Post-translasjonell endringer (PTMs) proteiner oppstår etter oversettelsesprosessen, og oppstår kovalente tillegg av funksjonelle grupper til aminosyre rester, spiller viktige roller i nesten alle biologiske prosesser, herunder genet transkripsjon, stressrespons, differensiering og metabolisme1,2,3. Hittil om 400 særegne vært PTMs identifisert4. Intrikate genomet og proteom forsterkes i stor grad av protein PTMs, som de regulerer protein aktivitet og lokalisering, og påvirker samspill med andre molekyler som proteiner, atomer syren, lipider og kofaktorer5.
Protein acetylation har vært i forkant av PTMs studier i de siste to tiårene6,7,8,9,10,11,12. Lysin acetylation ble først oppdaget i histones mer enn 50 år siden13,14, har blitt godt gransket, og er kjent i mer enn 80 transkripsjonsfaktorer, regulatorer og ulike proteiner15, 16,17. Studier på protein acetylation har ikke bare gitt oss en dypere forståelse av dens forskrifter mekanismer, men også veiledet behandlinger for en rekke sykdommer forårsaket av dysfunksjonelle acetylation18,19, 20 , 21 , 22 , 23. det ble antatt at lysin acetylation skjer bare i eukaryoter, men nyere studier har vist at protein acetylation spiller også nøkkelroller i bakteriell fysiologi, inkludert chemotaxis, acid motstand, aktivisering og stabilisering av virusets øyer og andre virulens relaterte proteiner24,25,26,27,28,29.
En vanlig metode å karakterisere biokjemisk lysin acetylation bruker nettstedet-rettet mutagenese. Glutamin er brukt som en etterligne av acetyllysine på grunn av sin liknende størrelse og polaritet. Arginine er brukt som en ikke-acetylated lysin etterligne, siden den opprettholder sitt positive ladningen under fysiologiske forhold, men kan ikke være acetylated. Men begge imiterer er ikke ekte isosteres og alltid gir ikke de forventede resultater30. Den strengeste tilnærmingen er å generere homogent acetylated proteiner på bestemte lysin rester, som er vanskelig eller umulig for mest klassiske metodene på grunn av den lave støkiometri av lysin acetylation i naturen7,11. Denne utfordringen har vært unraveled av den genetiske kode ekspansjon strategien, som sysselsetter en utviklet pyrrolysyl-tRNA synthetase variant fra Methanosarcinaceae Art å lade tRNAPyl med acetyllysine, utnytter verten translasjonsforskning maskiner å undertrykke UAG stoppe codon i mRNA og dirigerer inkorporering av acetyllysine i designet plasseringen av målet protein31. Vi har nylig optimalisert dette systemet med en forbedret EF-Tu-bindende tRNA32 og en oppgradert acetyllysyl-tRNA synthetase33. Videre har vi brukt dette forbedret innlemmelse systemet i acetylation studier malate dehydrogenase34 og tyrosyl-tRNA synthetase35. Her viser vi protokollen for å generere rent acetylated proteiner fra molekylær kloning til biokjemisk identifisering ved hjelp av malate dehydrogenase (MDH), som vi har mye studert som en demonstrativt eksempel.

<table border="0" cellpadding="0" cellspacing="0" width="615">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bradford protein assay</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">5000006</td>
			<td style="width:167px;">Protein concentration</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4x Laemmli Sample Buffer</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610747</td>
			<td style="width:167px;">SDS sample buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Coomassie G-250 Stain</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610786</td>
			<td style="width:167px;">SDS-PAGE gel staining</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4-20% SDS-PAGE ready gel</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">4561093</td>
			<td style="width:167px;">Protein determination</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ac-K-100 (HRP Conjugate)</td>
			<td style="width:113px;">Cell Signaling</td>
			<td style="width:119px;">6952</td>
			<td style="width:167px;">Antibody</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">IPTG</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">194</td>
			<td style="width:167px;">Expression inducer</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:216px;">N&#949;-Acetyl-L-lysine</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">5364</td>
			<td style="width:167px;">Noncanonical amino acid</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">PD-10 desalting column</td>
			<td style="width:113px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:167px;">Desalting</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Q5 Site-Directed Mutagenesis Kit</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">E0554</td>
			<td style="width:167px;">Introducing the stop codon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">BL21 (DE3) cells</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">C2527</td>
			<td style="width:167px;">Expressing strain</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">27106</td>
			<td style="width:167px;">Extracting plasmids</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ni-NTA resin</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">30210</td>
			<td style="width:167px;">Affinity purification resin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">nicotinamide</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">N3376</td>
			<td style="width:167px;">Deacetylase inhibitor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">&#946;-Mercaptoethanol</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6250</td>
			<td style="width:167px;">Reducing agent</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">BugBuster Protein Extraction Reagent</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">70584</td>
			<td style="width:167px;">Breaking cells</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Benzonase nuclease</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">E1014</td>
			<td style="width:167px;">DNase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">ECL Western Blotting Substrate</td>
			<td style="width:113px;">ThermoFisher</td>
			<td style="width:119px;">32106</td>
			<td style="width:167px;">Chemiluminescence</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Premixed LB Broth</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97064</td>
			<td style="width:167px;">Cell growth medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bovine serum albumin</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97061-416</td>
			<td style="width:167px;">western blots blocking</td>
		</tr>
	</tbody>
</table>

a facile protocol to generate site-specifically acetylated proteins in escherichia coli

Post-translasjonell endringer som oppstår på bestemte plasseringer av proteiner har vist å spille viktige roller i en rekke cellulære prosesser. Blant dem er reversibel lysin acetylation en av de mest distribuerte inne alle domenen av livet. Selv om flere masse massespektrometri-baserte acetylome studier er utført, ytterligere er karakteristikk av disse antatte acetylation mål begrenset. En mulig årsak er at det er vanskelig å generere rent acetylated proteiner på ønsket plassering ved de fleste klassiske biokjemiske tilnærminger. For å overvinne denne utfordringen, brukes genetiske koden ekspansjon teknikken for å bruke paret en utviklet pyrrolysyl-tRNA synthetase variant og dens beslektet tRNA fra Methanosarcinaceae arter, til direkte cotranslational inkorporering av acetyllysine i det bestemte området i protein av interesse. Etter første søknad i studiet av histone acetylation, har denne tilnærmingen tilrettelagt acetylation studier på en rekke proteiner. I dette arbeidet viste vi en lettvinte protokoll for å produsere site-specifically acetylated proteiner ved hjelp av modellen bakterien Escherichia coli som vert. Malate dehydrogenase ble brukt som en demonstrasjon eksempel i dette arbeidet.

Avkastningen av acetylated MDH protein ble 15 mg per 1 L kultur, av vill-type MDH 31 mg per 1 L kultur. Renset proteiner ble analysert av SDS side som vist i figur 1. Vill-type MDH ble brukt som en positiv kontroll34. Protein renset fra celler skjuler acetyllysine (AcK) inkorporering systemet og mutant mdh genet, men uten bekreftelser i vekst medier, ble brukt som en negativ kontroll. Lysin acetylation renset proteiner ble opp...

Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetisk kode utvidelse fungerer som et kraftig verktøy for å studere en rekke biologiske prosesser, herunder protein acetylation. Her viser vi en lettvinte protokoll for å utnytte denne teknikken for å generere homogent acetylated proteiner ved bestemte områder i Escherichia coli celler.

En lettvinte protokoll for å generere Site-Specifically Acetylated proteiner i Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Research

JoVE Journal

Immunology and Infection

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

Bruke Fluorescent Proteiner å visualisere og kvantifisere<em&gt; Chlamydia</em&gt; Vakuole Vekst Dynamics i levende celler

The obligate intracellular bacterium Chlamydia elicits a great burden on global public health. C.&#160;trachomatis is the leading bacterial cause of ...

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Non-invasiv Model of Neuropathogenic<em&gt; Escherichia coli</em&gt; Infeksjon i Neonatal Rat

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Fag Phenomics: Fysiologiske tilnærminger for å karakter Novel virale proteiner

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

Ett-trinns Negativ kromatografiske rensing i<em&gt; Helicobacter pylori</em&gt; Neutrofilaktiverende Protein overuttrykkes i<em&gt; Escherichia coli</em&gt; I batch-modus

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

En protokoll for å karakterisere de morfologiske endringene av<em&gt; Clostridium difficile</em&gt; Som svar på antibiotisk behandling

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Påvisning av enterohemorrhagiske Escherichia Coli kolonisering i Murine vert av ikke-invasiv i Vivo bioluminescens System

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Etableringen av et tett Transposon innsetting biblioteket bruker bakteriell bøyning i Enterobacterial stammer som Escherichia Coli eller Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Overekspresjon og rensing av menneske<em&gt; Cis</em&gt; -prenyltransferase i<em&gt; Escherichia coli</em

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

En suge blemme protokoll å studere Human T-celle tilbakekalling svar i Vivo

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Bruke forbedret grønne fluorescens Protein-uttrykke Escherichia Coli å vurdere musen Peritoneal Macrophage fagocytose

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a ...