Name: a facile protocol to generate site-specifically acetylated proteins in escherichia coli
Uploaded: 2017-12-09T14:00:00
Description: Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

Este trabajo fue financiado por los NIH (AI119813), la puesta en marcha de la Universidad de Arkansas y el premio del Instituto de biociencias de Arkansas.

1. dirigida mutagénesis Gene de la blanco
Nota: MDH se expresa bajo el promotor de T7 en el vector de pCDF-1 con el origen de CloDF13 y un número de copia de 20 a 4034.
<ol><li>Introducir el codón ámbar en la posición 140 en el gene de cartillas (adelante cartilla: GGTGTTTATGACetiquetaAACAAACTGTTCGGCG y revertir la cartilla: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), siguiendo las instrucciones del kit de mutagénesis sitio-dirigida.</li>...

<ol>
	<li>Krishna, R. G., Wold, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-translational+modification+of+proteins.">Post-translational modification of proteins.</a> Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).</li><li>Lothrop, A. P., Torres, M. P., Fuchs, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+post-translational+modification+codes.">Deciphering post-translational modification codes.</a> FEBS Lett. 587 (8), 1247-1257 (2013).</li><li>Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Posttranslational modification of proteins : expanding nature's inventory. , (2006).</li><li>Khoury, G. A., Baliban, R. C., Floudas, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome-wide+post-translational+modification+statistics:+frequency+analysis+and+curation+of+the+swiss-prot+database.">Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database.</a> Sci Rep. 1, (2011).</li><li>Grotenbreg, G., Ploegh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology:+dressed-up+proteins.">Chemical biology: dressed-up proteins.</a> Nature. 446 (7139), 993-995 (2007).</li><li>Arif, M., Selvi, B. R., Kundu, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+the+tale+of+a+modification+from+transcription+regulation+to+metabolism.">Lysine acetylation: the tale of a modification from transcription regulation to metabolism.</a> Chembiochem. 11 (11), 1501-1504 (2010).</li><li>Cohen, T., Yao, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AcK-knowledge+reversible+acetylation.">AcK-knowledge reversible acetylation.</a> Science's STKE : signal transduction knowledge environment. (245), pe42 (2004).</li><li>Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+world+of+protein+acetylation.">The world of protein acetylation.</a> Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).</li><li>Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N&#949;-acetylation+control+conserved+in+all+three+life+domains.">N&#949;-acetylation control conserved in all three life domains.</a> Microbe. 5, 340-344 (2010).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation:+a+regulatory+modification+to+rival+phosphorylation?.">Acetylation: a regulatory modification to rival phosphorylation?.</a> The EMBO journal. 19 (6), 1176-1179 (2000).</li><li>Soppa, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+archaea,+bacteria,+and+eukaryotes.">Protein acetylation in archaea, bacteria, and eukaryotes.</a> Archaea. , (2010).</li><li>Verdin, E., Ott, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=50+years+of+protein+acetylation:+from+gene+regulation+to+epigenetics,+metabolism+and+beyond.">50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond.</a> Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).</li><li>Allfrey, V. G., Faulkner, R., Mirsky, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+Methylation+of+Histones+and+Their+Possible+Role+in+the+Regulation+of+Rna+Synthesis.">Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis.</a> P Natl Acad Sci USA. 51, 786-794 (1964).</li><li>Phillips, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+acetyl+groups+of+histones.">The presence of acetyl groups of histones.</a> Biochem j. 87, 258-263 (1963).</li><li>Sterner, D. E., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+of+histones+and+transcription-related+factors.">Acetylation of histones and transcription-related factors.</a> Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).</li><li>Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+deacetylation+of+non-histone+proteins.">Acetylation and deacetylation of non-histone proteins.</a> Gene. 363, 15-23 (2005).</li><li>Close, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+lysine+acetylation+of+non-nuclear+proteins.">The emerging role of lysine acetylation of non-nuclear proteins.</a> Cell Mol Life Sci. 67 (8), 1255-1264 (2010).</li><li>Iyer, A., Fairlie, D. P., Brown, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation+in+obesity,+diabetes+and+metabolic+disease.">Lysine acetylation in obesity, diabetes and metabolic disease.</a> Immunol Cell Biol. 90 (1), 39-46 (2012).</li><li>You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+enzymes,+bromodomains+and+links+to+different+diseases.">Lysine acetylation: enzymes, bromodomains and links to different diseases.</a> Essays Biochem. 52, 1-12 (2012).</li><li>Bonnaud, E. M., Suberbielle, E., Malnou, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+acetylation+in+neuronal+(dys)function.">Histone acetylation in neuronal (dys)function.</a> Biomol Concepts. 7 (2), 103-116 (2016).</li><li>Fukushima, A., Lopaschuk, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+control+of+cardiac+fatty+acid+beta-oxidation+and+energy+metabolism+in+obesity,+diabetes,+and+heart+failure.">Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure.</a> Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).</li><li>Kaypee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+lysine+acetylation+in+tumorigenesis:+Implications+in+the+development+of+therapeutics.">Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics.</a> Pharmacol Ther. 162, 98-119 (2016).</li><li>Tapias, A., Wang, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+Acetylation+and+Deacetylation+in+Brain+Development+and+Neuropathies.">Lysine Acetylation and Deacetylation in Brain Development and Neuropathies.</a> Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).</li><li>Hu, L. I., Lima, B. P., Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+the+dawning+of+a+new+age.">Bacterial protein acetylation: the dawning of a new age.</a> Molecular microbiology. 77 (1), 15-21 (2010).</li><li>Jones, J. D., O'Connor, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+prokaryotes.">Protein acetylation in prokaryotes.</a> Proteomics. 11 (15), 3012-3022 (2011).</li><li>Bernal, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+bacterial+physiology+by+lysine+acetylation+of+proteins.">Regulation of bacterial physiology by lysine acetylation of proteins.</a> New biotechnol. 31 (6), 586-595 (2014).</li><li>Hentchel, K. L., Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acylation+of+Biomolecules+in+Prokaryotes:+a+Widespread+Strategy+for+the+Control+of+Biological+Function+and+Metabolic+Stress.">Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress.</a> Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).</li><li>Ouidir, T., Kentache, T., Hardouin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+lysine+acetylation+in+bacteria:+Current+state+of+the+art.">Protein lysine acetylation in bacteria: Current state of the art.</a> Proteomics. 16 (2), 301-309 (2016).</li><li>Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+new+discoveries+unanswered+questions.">Bacterial protein acetylation: new discoveries unanswered questions.</a> Curr Genet. 62 (2), 335-341 (2016).</li><li>Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoacetylation+of+the+histone+acetyltransferase+Rtt109.">Autoacetylation of the histone acetyltransferase Rtt109.</a> J Biol Chem. 286 (28), 24694-24701 (2011).</li><li>Neumann, H., Peak-Chew, S. Y., Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+N&#949;-acetyllysine+in+recombinant+proteins.">Genetically encoding N&#949;-acetyllysine in recombinant proteins.</a> Nat chem biol. 4 (4), 232-234 (2008).</li><li>Fan, C., Xiong, H., Reynolds, N. M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationally+evolving+tRNAPyl+for+efficient+incorporation+of+noncanonical+amino+acids.">Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids.</a> Nucleic Acids Res. 43 (22), e156 (2015).</li><li>Bryson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+directed+evolution+of+aminoacyl-tRNA+synthetases+to+alter+amino+acid+specificity+and+enhance+activity.">Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity.</a> Nat Chem Biol. , (2017).</li><li>Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+the+Lysine+Acetylation+of+Malate+Dehydrogenase.">Studying the Lysine Acetylation of Malate Dehydrogenase.</a> J Mol Biol. 429 (9), 1396-1405 (2017).</li><li>Venkat, S., Gregory, C., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+the+lysine+acetylation+of+tyrosyl-tRNA+synthetase+in+Escherichia+coli.">Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli.</a> Chembiochem. 18 (19), 1928-1934 (2017).</li><li>Liu, C. C., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adding+new+chemistries+to+the+genetic+code.">Adding new chemistries to the genetic code.</a> Annu Rev Biochem. 79, 413-444 (2010).</li><li>Mukai, T., Lajoie, M. J., Englert, M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rewriting+the+Genetic+Code.">Rewriting the Genetic Code.</a> Annu Rev Microbiol. , (2017).</li><li>O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upgrading+protein+synthesis+for+synthetic+biology.">Upgrading protein synthesis for synthetic biology.</a> Nat Chem Biol. 9 (10), 594-598 (2013).</li><li>Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+and+reprogramming+the+genetic+code+of+cells+and+animals.">Expanding and reprogramming the genetic code of cells and animals.</a> Annu Rev Biochem. 83, 379-408 (2014).</li><li>O'Donoghue, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-cognate+suppression+of+amber,+opal+and+quadruplet+codons+competes+with+aminoacyl-tRNAPyl+for+genetic+code+expansion.">Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion.</a> FEBS Lett. 586 (21), 3931-3937 (2012).</li><li>Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+amino+acid+composition+of+proteins+within+an+expanded+genetic+code.">Revealing the amino acid composition of proteins within an expanded genetic code.</a> Nucleic Acids Res. 43 (2), e8 (2015).</li><li>Huang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+convenient+method+for+genetic+incorporation+of+multiple+noncanonical+amino+acids+into+one+protein+in+Escherichia+coli.">A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli.</a> Mol Biosyst. 6 (4), 683-686 (2010).</li><li>Venkat, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+thioacetyl-lysine+as+a+nondeacetylatable+analog+of+lysine+acetylation+in+Escherichia+coli.">Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli.</a> FEBS Open. , (2017).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).</li><li>Gregoretti, I. V., Lee, Y. M., Goodson, H. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evolution+of+the+histone+deacetylase+family:+functional+implications+of+phylogenetic+analysis.">Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis.</a> J Mol Biol. 338 (1), 17-31 (2004).</li><li>Weinert, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetyl-phosphate+is+a+critical+determinant+of+lysine+acetylation+in+E.+coli.">Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli.</a> Mol cell. 51 (2), 265-272 (2013).</li></ol>

La incorporación genética de noncanonical aminoácidos (ncAAs) se basa en la supresión de un codón asignado, sobre todo el ámbar stop codón UAG36,37,38,39, por el tRNA cargado de ncAA que contiene el anticodon correspondiente. Como es sabido, el codón UAG es reconocido por el factor de liberación-1 (RF1) en bacterias y puede también ser suprimido por cerca de tRNAs cognado de anfitrion...

(PTMs) las modificaciones post-traduccionales de las proteínas ocurren después del proceso de traducción y surgen de adición covalente de grupos funcionales a los residuos del aminoácido, jugando papeles importantes en casi todos los procesos biológicos, incluyendo gene transcripción, respuesta al estrés, diferenciación celular y metabolismo1,2,3. Hasta la fecha, cerca de 400 distintivo PTMs han sido identificados4. La complejidad del genoma y el proteoma se amplifica en gran medida por la proteína MPa, regular localización y actividad de la proteína, y afectan la interacción con otras moléculas como proteínas, ácidos nucleicos, lípidos y cofactores5.
Acetilación de proteínas ha estado a la vanguardia de los estudios de MPa en las última dos décadas6,7,8,9,10,11,12. Acetilación de la lisina fue descubierta en las histonas hace más de 50 años13,14, ha sido bien analizado y se sabe para existir en más de 80 factores de transcripción, reguladores y varias proteínas15, 16,17. Estudios sobre la acetilación de proteínas no sólo nos proporciona una comprensión más profunda de sus mecanismos reguladores, sino también guiada por tratamientos para un número de enfermedades causadas por acetilación disfuncional18,19, 20 , 21 , 22 , 23. se creía que la acetilación de la lisina ocurre solo en eucariotas, pero estudios recientes han demostrado que la acetilación de proteínas también juega un papel clave en la fisiología bacteriana, incluyendo chemotaxis, resistencia ácida, la activación y estabilización de Islas de patogenicidad y virulencia otra relacionadas con las proteínas24,25,26,27,28,29.
Un método comúnmente utilizado para caracterizar bioquímicamente la acetilación de la lisina está utilizando mutagénesis sitio-dirigida. Glutamina es utilizada como un imitador de acetyllysine debido a su tamaño y polaridad similar. Arginina es utilizada como un imitador de lisina no acetilado, ya que conserva su carga positiva en condiciones fisiológicas pero no puede ser acetilado. Sin embargo, ambos imitadores no son isosteres reales y no siempre producen los resultados esperados30. El enfoque más riguroso es generar homogéneo acetiladas proteínas en residuos de lisina específico, que es difícil o imposible por métodos más clásicos debido a la baja estequiometría de acetilación de la lisina en naturaleza7,11. Este desafío ha sido desentrañando la estrategia de expansión del código genético, que emplea una ingeniería pyrrolysyl-tRNA sintetasa variante de especies Methanosarcinaceae para cargar tRNAPyl con acetyllysine, utiliza el host traslacional maquinaria para suprimir la UAG stop codon en el mRNA y dirige la incorporación de acetyllysine en la posición diseñada de la proteína blanco del31. Recientemente, hemos optimizado este sistema con una mejor EF-Tu-Unión tRNA32 y un actualizado acetyllysyl-tRNA sintetasa33. Además, hemos aplicado este sistema mayor incorporación en estudios de acetilación de la malato deshidrogenasa34 y Tirosil tRNA sintetasa35. Aquí, demostramos el protocolo para la generación de proteínas puramente acetiladas de la clonación molecular para identificación bioquímica mediante el uso de malato deshidrogenasa (MDH), que hemos estudiado como ejemplo demostrativo.

<table border="0" cellpadding="0" cellspacing="0" width="615">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bradford protein assay</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">5000006</td>
			<td style="width:167px;">Protein concentration</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4x Laemmli Sample Buffer</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610747</td>
			<td style="width:167px;">SDS sample buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Coomassie G-250 Stain</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610786</td>
			<td style="width:167px;">SDS-PAGE gel staining</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4-20% SDS-PAGE ready gel</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">4561093</td>
			<td style="width:167px;">Protein determination</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ac-K-100 (HRP Conjugate)</td>
			<td style="width:113px;">Cell Signaling</td>
			<td style="width:119px;">6952</td>
			<td style="width:167px;">Antibody</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">IPTG</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">194</td>
			<td style="width:167px;">Expression inducer</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:216px;">N&#949;-Acetyl-L-lysine</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">5364</td>
			<td style="width:167px;">Noncanonical amino acid</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">PD-10 desalting column</td>
			<td style="width:113px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:167px;">Desalting</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Q5 Site-Directed Mutagenesis Kit</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">E0554</td>
			<td style="width:167px;">Introducing the stop codon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">BL21 (DE3) cells</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">C2527</td>
			<td style="width:167px;">Expressing strain</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">27106</td>
			<td style="width:167px;">Extracting plasmids</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ni-NTA resin</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">30210</td>
			<td style="width:167px;">Affinity purification resin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">nicotinamide</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">N3376</td>
			<td style="width:167px;">Deacetylase inhibitor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">&#946;-Mercaptoethanol</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6250</td>
			<td style="width:167px;">Reducing agent</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">BugBuster Protein Extraction Reagent</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">70584</td>
			<td style="width:167px;">Breaking cells</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Benzonase nuclease</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">E1014</td>
			<td style="width:167px;">DNase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">ECL Western Blotting Substrate</td>
			<td style="width:113px;">ThermoFisher</td>
			<td style="width:119px;">32106</td>
			<td style="width:167px;">Chemiluminescence</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Premixed LB Broth</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97064</td>
			<td style="width:167px;">Cell growth medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bovine serum albumin</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97061-416</td>
			<td style="width:167px;">western blots blocking</td>
		</tr>
	</tbody>
</table>

a facile protocol to generate site-specifically acetylated proteins in escherichia coli

Modificaciones post-traduccionales que ocurren en las posiciones específicas de proteínas han demostrado desempeñar un papel importante en una variedad de procesos celulares. Entre ellos, la acetilación reversible de la lisina es uno de los más ampliamente distribuidos en todos los ámbitos de la vida. Aunque se han realizado numerosos estudios de acetylome basada en espectrometría de masa, más caracterización de estos objetivos de acetilación putativo ha sido limitada. Una razón posible es que es difícil generar proteínas puramente acetiladas en posiciones deseadas por mayoría enfoques bioquímicos clásicos. Para superar este reto, se ha aplicado la técnica de expansión del código genético para utilizar el par de una variante de ingeniería pyrrolysyl-tRNA sintetasa y su cognado tRNA de las especies de Methanosarcinaceae , para dirigir la incorporación cotranslacional de acetyllysine en el sitio específico en la proteína de interés. Después de la primera aplicación en el estudio de la acetilación de histonas, este enfoque ha facilitado estudios de acetilación sobre una variedad de proteínas. En este trabajo, hemos demostrado un protocolo fácil para producir proteínas site-specifically acetiladas utilizando la bacteria Escherichia coli de la modelo como anfitrión. Malato deshidrogenasa fue utilizada como un ejemplo de demostración en este trabajo.

El rendimiento de proteína MDH acetilado fue 15 mg por cultura de 1 L, mientras que la de tipo salvaje MDH fue 31 mg por cultura de 1 L. Proteínas purificadas fueron analizadas por SDS-PAGE, como se muestra en la figura 1. El MDH de tipo salvaje fue utilizado como un control positivo de34. La proteína purificada de células que el sistema de incorporación de acetyllysine (AcK) y el gen mutante mdh , pero sin confirmación ...

Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Expansión del código genético sirve como una poderosa herramienta para el estudio de una amplia gama de procesos biológicos, incluyendo acetilación de proteínas. Aquí demostramos un protocolo fácil aprovechar esta técnica para generar homogéneo acetilado proteínas en sitios específicos en células de Escherichia coli .

Un protocolo fácil de generar proteínas Site-Specifically acetiladas en Escherichia Coli

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Research

JoVE Journal

Immunology and Infection

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

El uso de proteínas fluorescentes para visualizar y cuantificar<em&gt; Chlamydia</em&gt; Vacuola dinámica de crecimiento en las células vivas

The obligate intracellular bacterium Chlamydia elicits a great burden on global public health. C.&#160;trachomatis is the leading bacterial cause of ...

Investigación

Inmunología e Infección

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Modelo no invasiva de neuropatogénico<em&gt; Escherichia coli</em&gt; La infección en Neonatología Rata

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Fenómica fagos: enfoques fisiológicos para caracterizar Novela Virales Proteínas

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

De un solo paso negativo Purificación cromatográfica de<em&gt; Helicobacter pylori</em&gt; La proteína activadora de neutrófilos sobreexpresa en<em&gt; Escherichia coli</em&gt; En modo batch

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

Protocolo para Caracterizar los Cambios Morfológicos de<em&gt; Clostridium difficile</em&gt; En respuesta al tratamiento antibiótico

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Detección de la colonización de Escherichia Coli enterohemorrágica en anfitrión murino no invasiva In Vivo el sistema de bioluminiscencia

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Creación de un denso Transposon inserción biblioteca usando Conjugación bacteriana en cepas enterobacterianas tales como Escherichia Coli o Shigella flexneri

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Sobreexpresión y Purificación de Humanos<em&gt; Cis</em&gt; -preniltransferasa en<em&gt; Escherichia coli</em

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

Un protocolo de aspiración de la ampolla para estudiar células de T humanas recordar respuestas en Vivo

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Utilizando mayor expresión de proteína de fluorescencia verde Escherichia Coli evaluar fagocitosis de macrófagos peritoneales de ratón

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a ...