Name: a facile protocol to generate site-specifically acetylated proteins in escherichia coli
Uploaded: 2017-12-09T14:00:00
Description: Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

Bu eser NIH (AI119813), Arkansas Üniversitesi start-up ve Arkansas Biosciences Enstitüsü'nden Ödülü tarafından desteklenmiştir.

1. site yönettiği Mutagenesis hedef gen
Not: MDH altında T7 organizatörü pCDF-1 vektör CloDF13 kökeni ve 20-4034kopya sayısı ile ifade edilir.
<ol><li>Amber kodonu gen pozisyonda 140 astar tarafından tanıtmak (ileri astar: GGTGTTTATGACEtiketAACAAACTGTTCGGCG ve ters astar: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), site yönettiği mutagenesis kiti öğretim takip.</li>
	<li>Vahşi-türü malat dehidrataz gen içeren şablonu plazmid...

<ol>
	<li>Krishna, R. G., Wold, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-translational+modification+of+proteins.">Post-translational modification of proteins.</a> Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).</li><li>Lothrop, A. P., Torres, M. P., Fuchs, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deciphering+post-translational+modification+codes.">Deciphering post-translational modification codes.</a> FEBS Lett. 587 (8), 1247-1257 (2013).</li><li>Walsh, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Posttranslational modification of proteins : expanding nature's inventory. , (2006).</li><li>Khoury, G. A., Baliban, R. C., Floudas, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteome-wide+post-translational+modification+statistics:+frequency+analysis+and+curation+of+the+swiss-prot+database.">Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database.</a> Sci Rep. 1, (2011).</li><li>Grotenbreg, G., Ploegh, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology:+dressed-up+proteins.">Chemical biology: dressed-up proteins.</a> Nature. 446 (7139), 993-995 (2007).</li><li>Arif, M., Selvi, B. R., Kundu, T. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+the+tale+of+a+modification+from+transcription+regulation+to+metabolism.">Lysine acetylation: the tale of a modification from transcription regulation to metabolism.</a> Chembiochem. 11 (11), 1501-1504 (2010).</li><li>Cohen, T., Yao, T. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AcK-knowledge+reversible+acetylation.">AcK-knowledge reversible acetylation.</a> Science's STKE : signal transduction knowledge environment. (245), pe42 (2004).</li><li>Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+world+of+protein+acetylation.">The world of protein acetylation.</a> Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).</li><li>Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N&#949;-acetylation+control+conserved+in+all+three+life+domains.">N&#949;-acetylation control conserved in all three life domains.</a> Microbe. 5, 340-344 (2010).</li><li>Kouzarides, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation:+a+regulatory+modification+to+rival+phosphorylation?.">Acetylation: a regulatory modification to rival phosphorylation?.</a> The EMBO journal. 19 (6), 1176-1179 (2000).</li><li>Soppa, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+archaea,+bacteria,+and+eukaryotes.">Protein acetylation in archaea, bacteria, and eukaryotes.</a> Archaea. , (2010).</li><li>Verdin, E., Ott, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=50+years+of+protein+acetylation:+from+gene+regulation+to+epigenetics,+metabolism+and+beyond.">50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond.</a> Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).</li><li>Allfrey, V. G., Faulkner, R., Mirsky, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+Methylation+of+Histones+and+Their+Possible+Role+in+the+Regulation+of+Rna+Synthesis.">Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis.</a> P Natl Acad Sci USA. 51, 786-794 (1964).</li><li>Phillips, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+acetyl+groups+of+histones.">The presence of acetyl groups of histones.</a> Biochem j. 87, 258-263 (1963).</li><li>Sterner, D. E., Berger, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+of+histones+and+transcription-related+factors.">Acetylation of histones and transcription-related factors.</a> Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).</li><li>Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+and+deacetylation+of+non-histone+proteins.">Acetylation and deacetylation of non-histone proteins.</a> Gene. 363, 15-23 (2005).</li><li>Close, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+emerging+role+of+lysine+acetylation+of+non-nuclear+proteins.">The emerging role of lysine acetylation of non-nuclear proteins.</a> Cell Mol Life Sci. 67 (8), 1255-1264 (2010).</li><li>Iyer, A., Fairlie, D. P., Brown, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation+in+obesity,+diabetes+and+metabolic+disease.">Lysine acetylation in obesity, diabetes and metabolic disease.</a> Immunol Cell Biol. 90 (1), 39-46 (2012).</li><li>You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+acetylation:+enzymes,+bromodomains+and+links+to+different+diseases.">Lysine acetylation: enzymes, bromodomains and links to different diseases.</a> Essays Biochem. 52, 1-12 (2012).</li><li>Bonnaud, E. M., Suberbielle, E., Malnou, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histone+acetylation+in+neuronal+(dys)function.">Histone acetylation in neuronal (dys)function.</a> Biomol Concepts. 7 (2), 103-116 (2016).</li><li>Fukushima, A., Lopaschuk, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetylation+control+of+cardiac+fatty+acid+beta-oxidation+and+energy+metabolism+in+obesity,+diabetes,+and+heart+failure.">Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure.</a> Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).</li><li>Kaypee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+lysine+acetylation+in+tumorigenesis:+Implications+in+the+development+of+therapeutics.">Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics.</a> Pharmacol Ther. 162, 98-119 (2016).</li><li>Tapias, A., Wang, Z. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lysine+Acetylation+and+Deacetylation+in+Brain+Development+and+Neuropathies.">Lysine Acetylation and Deacetylation in Brain Development and Neuropathies.</a> Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).</li><li>Hu, L. I., Lima, B. P., Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+the+dawning+of+a+new+age.">Bacterial protein acetylation: the dawning of a new age.</a> Molecular microbiology. 77 (1), 15-21 (2010).</li><li>Jones, J. D., O'Connor, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+acetylation+in+prokaryotes.">Protein acetylation in prokaryotes.</a> Proteomics. 11 (15), 3012-3022 (2011).</li><li>Bernal, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+bacterial+physiology+by+lysine+acetylation+of+proteins.">Regulation of bacterial physiology by lysine acetylation of proteins.</a> New biotechnol. 31 (6), 586-595 (2014).</li><li>Hentchel, K. L., Escalante-Semerena, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acylation+of+Biomolecules+in+Prokaryotes:+a+Widespread+Strategy+for+the+Control+of+Biological+Function+and+Metabolic+Stress.">Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress.</a> Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).</li><li>Ouidir, T., Kentache, T., Hardouin, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+lysine+acetylation+in+bacteria:+Current+state+of+the+art.">Protein lysine acetylation in bacteria: Current state of the art.</a> Proteomics. 16 (2), 301-309 (2016).</li><li>Wolfe, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+protein+acetylation:+new+discoveries+unanswered+questions.">Bacterial protein acetylation: new discoveries unanswered questions.</a> Curr Genet. 62 (2), 335-341 (2016).</li><li>Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoacetylation+of+the+histone+acetyltransferase+Rtt109.">Autoacetylation of the histone acetyltransferase Rtt109.</a> J Biol Chem. 286 (28), 24694-24701 (2011).</li><li>Neumann, H., Peak-Chew, S. Y., Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+N&#949;-acetyllysine+in+recombinant+proteins.">Genetically encoding N&#949;-acetyllysine in recombinant proteins.</a> Nat chem biol. 4 (4), 232-234 (2008).</li><li>Fan, C., Xiong, H., Reynolds, N. M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rationally+evolving+tRNAPyl+for+efficient+incorporation+of+noncanonical+amino+acids.">Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids.</a> Nucleic Acids Res. 43 (22), e156 (2015).</li><li>Bryson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+directed+evolution+of+aminoacyl-tRNA+synthetases+to+alter+amino+acid+specificity+and+enhance+activity.">Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity.</a> Nat Chem Biol. , (2017).</li><li>Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studying+the+Lysine+Acetylation+of+Malate+Dehydrogenase.">Studying the Lysine Acetylation of Malate Dehydrogenase.</a> J Mol Biol. 429 (9), 1396-1405 (2017).</li><li>Venkat, S., Gregory, C., Gan, Q., Fan, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biochemical+characterization+of+the+lysine+acetylation+of+tyrosyl-tRNA+synthetase+in+Escherichia+coli.">Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli.</a> Chembiochem. 18 (19), 1928-1934 (2017).</li><li>Liu, C. C., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adding+new+chemistries+to+the+genetic+code.">Adding new chemistries to the genetic code.</a> Annu Rev Biochem. 79, 413-444 (2010).</li><li>Mukai, T., Lajoie, M. J., Englert, M., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rewriting+the+Genetic+Code.">Rewriting the Genetic Code.</a> Annu Rev Microbiol. , (2017).</li><li>O'Donoghue, P., Ling, J., Wang, Y. S., Soll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Upgrading+protein+synthesis+for+synthetic+biology.">Upgrading protein synthesis for synthetic biology.</a> Nat Chem Biol. 9 (10), 594-598 (2013).</li><li>Chin, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+and+reprogramming+the+genetic+code+of+cells+and+animals.">Expanding and reprogramming the genetic code of cells and animals.</a> Annu Rev Biochem. 83, 379-408 (2014).</li><li>O'Donoghue, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Near-cognate+suppression+of+amber,+opal+and+quadruplet+codons+competes+with+aminoacyl-tRNAPyl+for+genetic+code+expansion.">Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion.</a> FEBS Lett. 586 (21), 3931-3937 (2012).</li><li>Aerni, H. R., Shifman, M. A., Rogulina, S., O'Donoghue, P., Rinehart, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Revealing+the+amino+acid+composition+of+proteins+within+an+expanded+genetic+code.">Revealing the amino acid composition of proteins within an expanded genetic code.</a> Nucleic Acids Res. 43 (2), e8 (2015).</li><li>Huang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+convenient+method+for+genetic+incorporation+of+multiple+noncanonical+amino+acids+into+one+protein+in+Escherichia+coli.">A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli.</a> Mol Biosyst. 6 (4), 683-686 (2010).</li><li>Venkat, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetically+encoding+thioacetyl-lysine+as+a+nondeacetylatable+analog+of+lysine+acetylation+in+Escherichia+coli.">Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli.</a> FEBS Open. , (2017).</li><li>Wan, W., Tharp, J. M., Liu, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pyrrolysyl-tRNA+synthetase:+an+ordinary+enzyme+but+an+outstanding+genetic+code+expansion+tool.">Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool.</a> Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).</li><li>Gregoretti, I. V., Lee, Y. M., Goodson, H. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evolution+of+the+histone+deacetylase+family:+functional+implications+of+phylogenetic+analysis.">Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis.</a> J Mol Biol. 338 (1), 17-31 (2004).</li><li>Weinert, B. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acetyl-phosphate+is+a+critical+determinant+of+lysine+acetylation+in+E.+coli.">Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli.</a> Mol cell. 51 (2), 265-272 (2013).</li></ol>

Meşru amino asitler (ncAAs) genetik birleşme ncAA tahsil tRNA tarafından atanan bir kodon, çoğunlukla sarı stop kodonu UAG36,37,38,39, bastırılması dayanmaktadır karşılık gelen antikodon içeren. Bilindiği gibi UAG kodon tarafından yayın faktör-1 (RF1) bakterilerde tanınır ve bu da tarafından soydaş tRNA kurallı amino asitler (cAAs) tarafından tahsil ana bilgisayarlardan ...

Proteinlerin translasyonel modifikasyonlar (PTMs) çeviri işleminden sonra ortaya çıkan ve Fonksiyonel grupların kovalent ilavesi amino asit kalıntıları, gene de dahil olmak üzere hemen hemen tüm biyolojik süreçler içinde önemli roller oynayan ortaya çıkan Transkripsiyon, stres tepkisi, hücresel başkalaşım ve metabolizma1,2,3. Bugüne kadar yaklaşık 400 farklı PTMs saptanan4olmuştur. Onlar protein etkinlik ve yerelleştirme düzenleyen ve proteinler, nükleik asitler, lipidler ve Kofaktörler5gibi diğer molekülleri ile etkileşimi etkileyen genom ve Proteom karışıklık protein PTMs tarafından büyük ölçüde güçlendirilmiş.
Protein asetilasyon son yirmi yılda6,7,8,9,10,11,12PTMs çalışmalarda ön planda olmuştur. Lizin asetilasyon Histon içinde daha 50 yıl önce13,14, iyi incelemiş ve 80'den fazla transkripsiyon faktörleri, düzenleyiciler ve çeşitli proteinler15bulunduğunun bilinmesi was ilk kâşif, 16,17. Protein asetilasyon üzerinde çalışmalar sadece bize onun düzenleyici mekanizmaları daha derin bir anlayış ile sağlanan, ancak da işlevsiz asetilasyon18,19tarafından, neden olduğu hastalıkların bir dizi için Tedaviler güdümlü 20 , 21 , 22 , 23. bu lizin asetilasyon sadece ökaryotlarda olur, ancak son yıllarda yapılan çalışmalarda bu protein asetilasyon de Kemotaksis, asit direnci, harekete geçirmek ve istikrar gibi bakteri fizyolojisi, anahtar rol oynar göstermiştir inanılıyordu patojen Adaları ve diğer virülans proteinler24,25,26,27,28,29ile ilgili.
Biyokimyasal olarak lizin asetilasyon karakterize etmek için yaygın olarak kullanılan bir yöntem sitesi yönetmen mutagenesis kullanıyor. Glutamin benzer büyüklüğü ve polarite nedeniyle acetyllysine bir taklit kullanılır. Pozitif býrakýldýðýnda fizyolojik koşullar altında korur ancak acetylated olamaz beri arginin acetylated lizin taklit kullanılmaktadır. Ancak, her iki taklit eder gerçek isosteres değildir ve her zaman beklenen sonuçları30verir. En titiz yaklaşım olduğu zor veya imkansız en klasik yöntemlerle lizin asetilasyon doğa7,11düşük stoichiometry nedeniyle, belirli lizin artıkları, homojen acetylated proteinler oluşturmaktır. Bu meydan okuma bir mühendislik pyrrolysyl-tRNA sentetaz istihdam genetik kod genişleme stratejisi tarafından sökülmüş tRNA şarj etmek için Methanosarcinaceae türlerden varyantPyl ile acetyllysine, kullanır ev sahibi UAG bastırmak için translasyonel makine mRNA kodon durdurmak ve acetyllysine hedef protein31tasarlanmış pozisyonda birleşme yönlendirir. Son zamanlarda, biz bu sistemi geliştirilmiş bir EF-Tu-bağlama tRNA32 ve yükseltilmiş acetyllysyl-tRNA sentetaz33ile optimize. Ayrıca, Gelişmiş birleşme programında küçük bir sistem asetilasyon çalışmalar malat dehidrogenaz34 ve tyrosyl-tRNA sentetaz35başvurdum. Burada, biz tamamen acetylated Proteinlerin moleküler biyokimyasal kullanıcı kimliğini bir demonstrasyon örnek olarak kapsamlı bir şekilde inceledik malat dehidrogenaz (MDH), kullanarak klonlama üzerinden oluşturma protokolü göstermek.

<table border="0" cellpadding="0" cellspacing="0" width="615">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bradford protein assay</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">5000006</td>
			<td style="width:167px;">Protein concentration</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4x Laemmli Sample Buffer</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610747</td>
			<td style="width:167px;">SDS sample buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Coomassie G-250 Stain</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">1610786</td>
			<td style="width:167px;">SDS-PAGE gel staining</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">4-20% SDS-PAGE ready gel</td>
			<td style="width:113px;">Bio-Rad</td>
			<td style="width:119px;">4561093</td>
			<td style="width:167px;">Protein determination</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ac-K-100 (HRP Conjugate)</td>
			<td style="width:113px;">Cell Signaling</td>
			<td style="width:119px;">6952</td>
			<td style="width:167px;">Antibody</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">IPTG</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">194</td>
			<td style="width:167px;">Expression inducer</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:216px;">N&#949;-Acetyl-L-lysine</td>
			<td style="width:113px;">CHEM-IMPEX</td>
			<td style="width:119px;">5364</td>
			<td style="width:167px;">Noncanonical amino acid</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">PD-10 desalting column</td>
			<td style="width:113px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:167px;">Desalting</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">Q5 Site-Directed Mutagenesis Kit</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">E0554</td>
			<td style="width:167px;">Introducing the stop codon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">BL21 (DE3) cells</td>
			<td style="width:113px;">NEB</td>
			<td style="width:119px;">C2527</td>
			<td style="width:167px;">Expressing strain</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">27106</td>
			<td style="width:167px;">Extracting plasmids</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Ni-NTA resin</td>
			<td style="width:113px;">QIAGEN</td>
			<td style="width:119px;">30210</td>
			<td style="width:167px;">Affinity purification resin</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">nicotinamide</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">N3376</td>
			<td style="width:167px;">Deacetylase inhibitor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">&#946;-Mercaptoethanol</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">M6250</td>
			<td style="width:167px;">Reducing agent</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:216px;">BugBuster Protein Extraction Reagent</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">70584</td>
			<td style="width:167px;">Breaking cells</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Benzonase nuclease</td>
			<td style="width:113px;">Sigma-Aldrich</td>
			<td style="width:119px;">E1014</td>
			<td style="width:167px;">DNase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">ECL Western Blotting Substrate</td>
			<td style="width:113px;">ThermoFisher</td>
			<td style="width:119px;">32106</td>
			<td style="width:167px;">Chemiluminescence</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Premixed LB Broth</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97064</td>
			<td style="width:167px;">Cell growth medium</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:216px;">Bovine serum albumin</td>
			<td style="width:113px;">VWR</td>
			<td style="width:119px;">97061-416</td>
			<td style="width:167px;">western blots blocking</td>
		</tr>
	</tbody>
</table>

a facile protocol to generate site-specifically acetylated proteins in escherichia coli

Proteinlerin belirli konumlarda meydana translasyonel modifikasyonlar hücresel çeşitli önemli rol oynarlar gösterilmiştir. Bunlar arasında tersinir lizin asetilasyon en çok dağıtılmış hayat tüm etki alanlarında biridir. Daha da çok sayıda acetylome kütle spektrometresi tabanlı çalışma gerçekleştirilmiş olsa da, bu sözde asetilasyon hedefler karakterizasyonu sınırlı olmuştur. Olası bir nedeni çoğu klasik biyokimyasal yaklaşım tarafından istenen pozisyonlarda tamamen acetylated proteinleri üretmek zor olmasıdır. Bu zorluğu aşmak için genetik kod genişletme tekniği cotranslational birleşme yönlendirmek için bir mühendislik pyrrolysyl-tRNA sentetaz varyant ve onun soydaş tRNA Methanosarcinaceae türlerden çifti kullanın uygulandı protein ilgi belirli sitesinde acetyllysine. Histon asetilasyon çalışmada ilk uygulama sonra bu yaklaşım asetilasyon çalışmalar proteinler çeşitli kolaylaştırdı. Bu çalışmada, ev sahibi olarak modeli bakteri Escherichia coli kullanarak site-specifically acetylated proteinleri üretmek için facile bir protokol gösterdi. Malat dehidrogenaz gösteri örnek bu eser olarak kullanıldı.

Bu vahşi tipi MDH 31 mg-1 L kültür iken acetylated MDH protein verimini 15 mg-1 L kültür, oldu. Şekil 1' de gösterildiği gibi saf protein SDS-PAGE tarafından analiz edildi. Vahşi-türü MDH olumlu denetim34kullanıldı. Acetyllysine (AcK) birleşme sistem ve mutant mdh gen yataklık hücrelerden ama AcK olmadan büyüme medya, saf protein bir negatif kontrol kullanıldı. Lizin asetilasyon saf protein western Blot ac...

Watch this Scientific Journal Video about A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli at JoVE.com

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Genetik kod genişleme biyolojik süreçler, protein asetilasyon dahil olmak üzere geniş bir çalışma için güçlü bir araç olarak hizmet vermektedir. Burada biz homojen oluşturmak için bu teknik yararlanma facile bir protokol proteinler, Escherichia coli hücreleri belirli sitelerdeki acetylated göstermek.

Escherichia Coli proteinler Site-Specifically oluşturmak için Facile iletişim kuralı Acetylated

Post-translational modifications that occur at specific positions of proteins have been shown to play important roles in a variety of cellular processes. ...

Research

JoVE Journal

Immunology and Infection

A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

Using Fluorescent Proteins to Visualize and Quantitate Chlamydia Vacuole Growth Dynamics in Living Cells

Görselleştirme ve Miktarının Belirlenmesi için floresan proteinleri kullanarak<em&gt; Chlamydia</em&gt; Vakuol Büyüme Dinamikleri Yaşayan Hücrelerde

The obligate intracellular bacterium Chlamydia elicits a great burden on global public health. C.&#160;trachomatis is the leading bacterial cause of ...

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Non-Invasive Model of Neuropathogenic Escherichia coli Infection in the Neonatal Rat

Neuropathogenic olmayan İnvaziv Modeli<em&gt; Escherichia coli</em&gt; Yenidoğan Sıçan Enfeksiyon

Investigation of the interactions between animal host and bacterial pathogen is only meaningful if the infection model employed replicates the principal ...

Phage Phenomics: Physiological Approaches to Characterize Novel Viral Proteins

Faj Phenomics: Fizyolojik Yaklaşımlar Roman Viral Proteinler karakterize etmek

Current investigations into phage-host interactions are dependent on extrapolating knowledge from (meta)genomes. Interestingly, 60 - 95% of all phage ...

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

One-step Negative Chromatographic Purification of Helicobacter pylori Neutrophil-activating Protein Overexpressed in Escherichia coli in Batch Mode

Tek adımlı olumsuz Kromatografik arıtma<em&gt; Helicobacter pylori</em&gt; Nötrofil-aktive protein aşın<em&gt; Escherichia coli</em&gt; Toplu Modunda

Helicobacter pylori neutrophil-activating protein (HP-NAP) is a major virulence factor of Helicobacter pylori (H. pylori). It plays a critical role in H. ...

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

A Protocol to Characterize the Morphological Changes of Clostridium difficile in Response to Antibiotic Treatment

Morfolojik Değişiklikleri Karakterize Eden Bir Protokol<em&gt; Clostridium difficile</em&gt; Antibiyotik Tedavisine Yanıt Vermek

Assessment of antibiotic action with new drug development directed towards anaerobic bacteria is difficult and technically demanding. To gain insight into ...

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Detection of Enterohemorrhagic Escherichia Coli Colonization in Murine Host by Non-invasive In Vivo Bioluminescence System

Non-invaziv Vivo içinde Bioluminescence sistemi tarafından fare konak Enterohemorrhagic Escherichia Coli kolonizasyon algılama

Enterohemorrhagic E. coli (EHEC) O157:H7, which is a foodborne pathogen that causesdiarrhea, hemorrhagic colitis (HS), and hemolytic uremic syndrome ...

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri

Bir yoğun Transposon ekleme kütüphane kullanarak bakteriyel konjugasyon Escherichia Coli Enterobacterial suşları gibi veya Shigella flexneri oluşturulması

Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below ...

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Overexpression and Purification of Human Cis-prenyltransferase in Escherichia coli

Aşırı Ezme ve İnsanın Saflaştırılması<em&gt; Cis</em&gt; -prenıltransferaz in<em&gt; Escherichia coli</em

Prenyltransferases (PT) are a group of enzymes that catalyze chain elongation of allylic diphosphate using isopentenyl diphosphate (IPP) via multiple ...

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

A Suction Blister Protocol to Study Human T-cell Recall Responses In Vivo

İnsan T-hücre hatırlama yanıt Vivo içinde çalışmaya emme Blister iletişim kuralı

Cutaneous antigen-recall models allow for studies of human memory responses in vivo. When combined with skin suction blister (SB) induction, this model ...

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Using Enhanced Green Fluorescence Protein-expressing Escherichia Coli to Assess Mouse Peritoneal Macrophage Phagocytosis

Yeşil floresans Protein-ifade gelişmiş kullanma fare Peritoneal makrofaj fagositoz değerlendirmek için Escherichia Coli

This manuscript describes a simple and reproducible method to perform a phagocytosis assay. The first part of this method involves building a ...