This work was supported through grants from K12CA090628 (SSK), the National Comprehensive Cancer Network (SSK), the Mayo Clinic Center for Individualized Medicine (SSK), the Predolin Foundation (SSK), the Mayo Clinic Office of Translation to Practice (SSK), and the Mayo Clinic Medical Scientist Training Program Robert L. Howell Physician-Scientist Scholarship (RMS).

This protocol follows the guidelines of Mayo Clinic&#39;s Institutional Review Board (IRB) and Institutional Biosafety Committee (IBC).
1. CART19 cell production
<ol>
	<li>T cell isolation, stimulation, and ex-vivo culture
	<ol>
		<li>Carry out all cell culture work in a cell culture hood utilizing appropriate personal protective equipment. Harvest peripheral blood mononuclear cells (PBMCs) from de-identified normal donor blood cones collected during apheresis as these are known to be a viable source of PBMCs.13</li>
		<li>To isolate PBMCs, add 15 mL of a density gradient medium to a 50 mL density gradient separation tube. Dilute the donor blood with an equal volume of phosphate-buffered saline (PBS) containing 2% fetal bovine serum (FBS) to avoid cell trapping.
		<ol>
			<li>Add the diluted donor blood from the cone into the separation tube, careful not to disturb the interface between the blood and the density gradient medium. Centrifuge at 1,200 x g for 10 min at RT.</li>
			<li>Decant the supernatant into a new 50 mL conical, wash with PBS + 2% FBS by bringing up to 40 mL, centrifuge at 300 x g for 8 min at RT, aspirate supernatant, resuspend in 40 mL of buffer, and count cells.</li>
		</ol>
		</li>
		<li>Isolate T cells from PBMCs via a negative selection magnetic bead kit using a fully automated cell separator according to the manufacturer&#39;s protocol.</li>
		<li>To culture the isolated T cells, prepare T cell medium&#160;(TCM) that consists of 10% human AB serum (v/v), 1% penicillin-streptomycin-glutamine (v/v), and serum-free hematopoietic cell medium. Sterilize the medium&#160;by filtering through a 0.45 &#181;m sterile vacuum filter and then with a 0.22 &#181;m sterile vacuum filter.</li>
		<li>On Day 0 (the day of T cell stimulation), wash CD3/CD28 beads prior to stimulation of T cells. To wash, place the required volume of beads (use enough CD3/CD28 beads for a ratio of 3:1 beads:T cells;&#160;note the concentration of beads can be variable) in a sterile 1.5 mL microcentrifuge tube and resuspend in 1 mL of TCM.</li>
		<li>Place in contact with a magnet.</li>
		<li>After 1 min, aspirate the TCM and resuspend in 1 mL of fresh TCM to wash the beads.</li>
		<li>Repeat this procedure for a total of three washes.</li>
		<li>After the third wash, resuspend the beads in 1 mL of TCM.</li>
		<li>Count the T cells.</li>
		<li>Transfer beads to the T cells at a ratio of 3:1 beads:cells.</li>
		<li>Dilute cells to a final concentration of 1 x 106 cells/mL.</li>
		<li>Incubate at 37 &#176;C, 5% CO2 for 24 h.</li>
	</ol>
	</li>
	<li>T cell transfection and transduction
	<ol>
		<li>Carry out lentiviral work using BSL-2+ precautions, including cell culture hoods, personal protective equipment, and disinfection of used materials with bleach before disposal.</li>
		<li>Acquire a CART19 construct in a lentiviral vector. 
		NOTE: The CART19 construct utilized here was designed and then synthesized de novo using a commercially available protein synthesis vendor. The CAR construct was subsequently cloned into a third generation lentivirus under control of an EF-1&#945; promoter. The single chain variable region fragment is derived from the FMC63 clone and recognizes human CD19. The CAR19 construct possesses a second generation 4-1BB costimulatory domain and CD3&#950; stimulation (FMC63-41BBz).12</li>
		<li>Perform lentiviral production as previously described.12
		<ol>
			<li>In brief, to produce lentivirus, utilize 293T cells that have reached 70-90% confluency.</li>
			<li>Allow incubation for 30 min at room temperature of transfection reagents including 15 &#181;g of the lentiviral plasmid of interest, 18&#160;&#181;g of a gag/pol/tat/rev packaging vector, 7 &#181;g of a VSV-G envelope vector, 111 &#181;L of the pre-complexing reagent, 129 &#181;L of the transfection reagent, and 9.0 mL of the transfection medium&#160;before adding to the 293T cells. Then culture the transfected cells at 37 &#176;C, 5% CO2.</li>
			<li>Harvest,&#160;centrifuge (900 x g for 10 min), filter (0.45 &#181;M nylon filter), and concentrate supernatant at 24 and 48 h&#160;by ultracentrifugation at either 13,028 x g for 18 h&#160;or 112,700 x g for 2 h.</li>
			<li>Freeze at -80 &#176;C for future use.</li>
		</ol>
		</li>
		<li>On Day 1, gently resuspend T cells to break up the rosettes of T cells that had been stimulated at 1 x 106/mL on Day 0.</li>
		<li>Under appropriate BSL-2+ precautions for all lentiviral work, add fresh or frozen harvested virus to the stimulated T cells at a multiplicity of infection (MOI) of 3.0.</li>
	</ol>
	</li>
	<li>CAR-T cell expansion
	<ol>
		<li>During the phase of expansion, continue to incubate the transduced T cells at 37 &#176;C, 5% CO2. Count CAR-T cells on days 3 and 5, and add fresh, pre-warmed TCM to the culture to maintain a CAR-T cell concentration of 1 x 106/mL.</li>
		<li>Remove beads from the transduced T cells 6 days after stimulation (Day 6) using a magnet. Harvest, resuspend, and place T cells in 50 mL conical tubes in a magnet for 1 min. Then collect the supernatant (contains the CAR-T cells), and discard the beads.</li>
		<li>Place the collected CAR-T cells back in culture at a concentration of 1 x 106 cells/mL to resume expansion.</li>
		<li>On Day 6, assess surface expression of the CAR by flow cytometry. 
		NOTE: Several methods can be used to detect the surface expression of CAR, such as staining with a goat anti-mouse IgG (H+L) cross-adsorbed secondary antibody or by staining with a CD19 specific peptide, conjugated to a fluorochrome. Here, take an aliquot (about 100,000 T cells) from the culture and wash with flow buffer prepared with Dulbecco&#39;s phosphate-buffered saline, 2% fetal bovine serum, and 1% sodium azide. Stain the cells with the anti-CAR antibody and wash twice. Stain the cells with live/dead stain and CD3 monoclonal antibody (OKT3). Wash the cells and resuspend in flow buffer. Acquire on a cytometer to determine transduction efficiency.</li>
	</ol>
	</li>
	<li>CAR-T cell cryopreservation
	<ol>
		<li>To harvest and cryopreserve CAR-T cells 8 days after stimulation (Day 8 of T cell expansion), harvest the cells from culture.</li>
		<li>Spin down for 5 min at 300 x g.</li>
		<li>Resuspend in freezing medium at 10 million cells per mL per vial in freezing medium consisting of 10% dimethyl sulfoxide and 90% fetal bovine serum.</li>
		<li>Freeze in a freezing container to achieve a rate of cooling of -1 &#176;C/min&#160;in a -80 &#176;C freezer and then transfer to liquid nitrogen after 48 h.</li>
		<li>Prior to their use for in vitro or in vivo experiments, thaw CAR-T cells in warm TCM.</li>
		<li>Wash the cells to dilute and remove the dimethyl sulfoxide and resuspend to a concentration of 2 x 106 cells/mL in warm TCM. Rest overnight at 37 &#176;C, 5% CO2.</li>
	</ol>
	</li>
</ol>
2.&#160;GM-CSF k/o CART19 production
<ol>
	<li>To disrupt GM-CSF, utilize a guide RNA (gRNA) targeting exon 3 of human GM-CSF (CSF2) selected via screening gRNAs previously reported to have high efficiency for the CSF2 gene that encodes for the human cytokine GM-CSF.14 
	NOTE: A commercially synthesized research grade Cas9 third generation lentiviral construct containing this gRNA (under a U6 promoter) was used. The construct contains a puromycin resistance gene. The sequence of the gRNA is GACCTGCCTACAGACCCGCC.12</li>
	<li>To produce lentivirus, utilize 293T cells that have reached 70-90% confluency.</li>
	<li>Allow 15 &#181;g of the lentiviral plasmid of interest, 18 &#181;g of a gag/pol/tat/rev packaging vector, 7 &#181;g of a VSV-G envelope vector, 111 &#181;L of the pre-complexing reagent, 129 &#181;L of the transfection reagent, and 9.0 mL of the transfection medium&#160;to incubate for 30 min&#160;at room temperature.</li>
	<li>Add transfection reagents to the 293T cells. Then culture at 37 &#176;C, 5% CO2.</li>
	<li>Harvest, centrifuge (900 x g for 10 min), filter (0.45 &#181;M nylon filter) and concentrate supernatant at 24 and 48 h&#160;by ultracentrifugation at either 13,028 x g for 18 h&#160;or 112,700 x g for 2 h&#160;and freeze at -80 &#176;C for future use.</li>
	<li>On Day 1, gently resuspend the T cells to break up rosettes.</li>
	<li>In a BSL-2+ approved laboratory, add frozen or freshly harvested virus to the stimulated T cells to generate CAR-T cells. Transduce T cells with both the CAR19 lentivirus and GM-CSF targeting CRISPR lentivirus. Add CAR19 lentivirus at a MOI of 3. Since titration of the CRISPR lentivirus was not feasible, use virus particles generated from a 15 ug plasmid preparation to transduce 10&#160;x 106 T cells.</li>
	<li>See the remaining steps of T cell stimulation, expansion, and cryopreservation as discussed in step 1.</li>
	<li>For lentiCRISPR-edited T cells carrying puromycin resistance, treat cells with puromycin dihydrochloride at a concentration of 1 &#181;g of puromycin per 1 mL on Day 3 and Day 5 .</li>
</ol>
3.&#160;GM-CSF disruption efficiency and functional assessment of GM-CSF k/o CART19
<ol>
	<li>GM-CSF disruption efficiency: tracking of indels by decomposition (TIDE) sequencing and analysis
	<ol>
		<li>To sequence the exon of interest in GM-CSF gene, use the following primers. Use a forward primer sequence for GM-CSF (CSF2) of TGACTACAGAGAGGCACAGA, and a reverse primer sequence of TCACCTCTGACCTCATTAACC.</li>
		<li>Extract DNA from up to 5 million CAR-T cells with a genomic extraction kit. For the PCR reaction, use 25 &#181;L of a Taq mastermix per reaction with a final concentration of each primer in the PCR reaction of&#160;&#181;M, 0.1-0.5 &#181;g of template DNA, and a total volume of the PCR reaction brought up to 50 &#181;L with nuclease free water.</li>
		<li>See the PCR cycling conditions described in Table 1.</li>
		<li>Run PCR samples on a 1-2% agarose gel at 100 V for 30 min&#160;and extract using a gel extraction kit.</li>
		<li>Sequence PCR amplicons. Calculate allele modification frequency by uploading raw data into an appropriate TIDE software.15</li>
	</ol>
	</li>
	<li>GM-CSF production and functional assessment of GM-CSFk/o CART19
	<ol>
		<li>To determine the cytokine production of CAR-T cells, incubate wild type CART19 cells and GM-CSFk/o CART19 with the CD19 expressing acute lymphoblastic leukemia cell line NALM6 at a 1:5 ratio for 4 h&#160;at 37 &#176;C, 5% CO2 in the presence of monensin solution, anti-human CD49d, anti-human CD28, and anti-human CD107a.</li>
		<li>Harvest cells from culture for flow cytometry. Wash the cells with flow cytometry buffer. Stain the cells with a live/dead staining kit. Incubate in the dark at room temperature for 15 min. Fix the cells with a fixation medium and incubate in the dark at room temperature for 15 min.</li>
		<li>After washing, stain the cells intracellularly with permeabilization medium in combination with anti-human IFN&#947; monoclonal antibody, anti-human GM-CSF, anti-human MIP-1&#946;, anti-human IL-2, and anti-human CD3 and incubate in the dark at room temperature for 30 min. Wash and resuspend the samples. Acquire samples on a flow cytometer and analyzed for percentage of intracellular GM-CSF expression.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Kenderian, S. S., Ruella, M., Gill, S., Kalos, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+antigen+receptor+T-cell+therapy+to+target+hematologic+malignancies.">Chimeric antigen receptor T-cell therapy to target hematologic malignancies.</a> Cancer Research. 74 (22), 6383-6389 (2014).</li><li>Lim, W. A., June, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Principles+of+Engineering+Immune+Cells+to+Treat+Cancer.">The Principles of Engineering Immune Cells to Treat Cancer.</a> Cell. 168 (4), 724-740 (2017).</li><li>Neelapu, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Axicabtagene+Ciloleucel+CAR+T-Cell+Therapy+in+Refractory+Large+B-Cell+Lymphoma.">Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma.</a> The New England Journal of Medicine. 377 (26), 2531-2544 (2017).</li><li>Maude, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tisagenlecleucel+in+Children+and+Young+Adults+with+B-Cell+Lymphoblastic+Leukemia.">Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia.</a> The New England Journal of Medicine. 378 (5), 439-448 (2018).</li><li>Schuster, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+Antigen+Receptor+T+Cells+in+Refractory+B-Cell+Lymphomas.">Chimeric Antigen Receptor T Cells in Refractory B-Cell Lymphomas.</a> The New England Journal of Medicine. 377 (26), 2545-2554 (2017).</li><li>Grupp, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+antigen+receptor-modified+T+cells+for+acute+lymphoid+leukemia.">Chimeric antigen receptor-modified T cells for acute lymphoid leukemia.</a> The New England Journal of Medicine. 368 (16), 1509-1518 (2013).</li><li>Porter, D. L., Levine, B. L., Kalos, M., Bagg, A., June, C. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+antigen+receptor-modified+T+cells+in+chronic+lymphoid+leukemia.">Chimeric antigen receptor-modified T cells in chronic lymphoid leukemia.</a> The New England Journal of Medicine. 365 (8), 725-733 (2011).</li><li>Gust, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+Activation+and+Blood-Brain+Barrier+Disruption+in+Neurotoxicity+after+Adoptive+Immunotherapy+with+CD19+CAR-T+Cells.">Endothelial Activation and Blood-Brain Barrier Disruption in Neurotoxicity after Adoptive Immunotherapy with CD19 CAR-T Cells.</a> Cancer Discovery. 7 (12), 1404-1419 (2017).</li><li>Fitzgerald, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytokine+Release+Syndrome+After+Chimeric+Antigen+Receptor+T+Cell+Therapy+for+Acute+Lymphoblastic+Leukemia.">Cytokine Release Syndrome After Chimeric Antigen Receptor T Cell Therapy for Acute Lymphoblastic Leukemia.</a> Critical Care Medicine. 45 (2), e124-e131 (2017).</li><li>Liu, X., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR/Cas9+genome+editing:+Fueling+the+revolution+in+cancer+immunotherapy.">CRISPR/Cas9 genome editing: Fueling the revolution in cancer immunotherapy.</a> Current Research in Translational Medicine. 66 (2), 39-42 (2018).</li><li>Ren, J., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advancing+chimeric+antigen+receptor+T+cell+therapy+with+CRISPR/Cas9.">Advancing chimeric antigen receptor T cell therapy with CRISPR/Cas9.</a> Protein Cell. 8 (9), 634-643 (2017).</li><li>Sterner, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GM-CSF+inhibition+reduces+cytokine+release+syndrome+and+neuroinflammation+but+enhances+CAR-T+cell+function+in+xenografts.">GM-CSF inhibition reduces cytokine release syndrome and neuroinflammation but enhances CAR-T cell function in xenografts.</a> Blood. , (2018).</li><li>Dietz, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+source+of+viable+peripheral+blood+mononuclear+cells+from+leukoreduction+system+chambers.">A novel source of viable peripheral blood mononuclear cells from leukoreduction system chambers.</a> Transfusion. 46 (12), 2083-2089 (2006).</li><li>Sanjana, N. E., Shalem, O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+vectors+and+genome-wide+libraries+for+CRISPR+screening.">Improved vectors and genome-wide libraries for CRISPR screening.</a> Nature Methods. 11 (8), 783-784 (2014).</li><li>Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Easy+quantitative+assessment+of+genome+editing+by+sequence+trace+decomposition.">Easy quantitative assessment of genome editing by sequence trace decomposition.</a> Nucleic Acids Research. 42 (22), e168 (2014).</li></ol>

SSK is an inventor on patents in the field of CAR T-cell therapy that are licensed to Novartis (under an agreement between Mayo Clinic, University of Pennsylvania, and Novartis). These studies were funded in part by a grant from Humanigen (SSK). RMS, MJC, RS, and SSK are inventors on patents related to this work. The laboratory (SSK) receives funding from Tolero, Humanigen, Kite, Lentigen, Morphosys, and Actinium.

In this report, we describe a methodology to utilize CRISPR/Cas9 technology to induce secondary modifications in CAR-T cells. Specifically, this&#160;is demonstrated using lentiviral transduction with a viral vector that contains gRNA targeting the gene of interest and Cas9 to generate GM-CSFk/o CART19 cells. We had previously shown that GM-CSF neutralization ameliorates CRS and NT in a xenograft model.12&#160;As previously described, GM-CSFk/o CAR-T cells allow for the inhib...

Chimeric antigen receptor T (CAR-T) cell therapy exhibits great promise in the treatment of cancer.1,2&#160;Two CAR-T cell therapies targeting CD19 (CART19) were recently approved in the United Stated and in Europe for the use in B cell malignancies after demonstrating striking results in multicenter clinical trials.3,4,5&#160;Barriers to more widespread use of CAR-T cells are limited activity in solid tumors and associated toxicities including cytokine release syndrome (CRS) and neurotoxicity (NT).3,5,6,7,8,9&#160;To enhance the therapeutic index of CAR-T cell therapy, genome engineering tools such as zinc finger nucleases, TALENs, and CRISPR are employed to further modify CAR-T cells in an attempt to generate less toxic or more effective CAR-T cells.10,11
In this article, we describe a method to generate CRISPR/Cas9 edited CAR-T cells. The specific goal of this method is to genetically modify CAR-T cells during CAR-T cell manufacturing via CRISPR/Cas9 to generate less toxic or more effective CAR-T cells. The rationale for developing this methodology is built on lessons learned from clinical experience of CAR-T cell therapy, which indicates an urgent need for novel strategies to increase the therapeutic window of CAR-T cell therapy and to extend the application into other tumors and is supported by the recent advances in synthetic biology allowing multiple modifications of CAR-T cells that have started to enter the clinic. While several genome engineering tools are being developed and applied in different settings, such as zinc finger nucleases, TALENs, and CRISPR, our methodology describes CRISPR/Cas9 modification of CAR-T cells.10,11&#160;CRISPR/Cas9 is an RNA-based bacterial defense mechanism that is designed to eliminate foreign DNA. CRISPR relies on endonucleases to cleave a target sequence identified through a guide RNA (gRNA). CRISPR editing of CAR-T cells offers several advantages over other genome engineering tools. These include precision of the gRNA sequence, simplicity to design a gRNA targeting the gene of interest, high gene editing efficiency, and the ability to target multiple genes since multiple gRNAs can be used at the same time.
Specifically in the methods described here, we used a lentivirus encoding CRISPR guide RNA and Cas9 to disrupt a gene during CAR transduction of T cells. In selecting an appropriate technique to edit CAR-T cells, we suggest the technique described here is an efficient mechanism to generate research grade CAR-T cells, but because the long term effect of permanent integration of Cas9 into the genome is unknown, we propose this methodology to develop proof of concept research grade CAR-T cells but not for producing good manufacturing practice grade CAR-T cells.
In particular, here we describe the generation of granulocyte macrophage colony stimulating factor (GM-CSF) knockout CAR-T cells targeting human CD19. These CAR-T cells were generated by transduction with lentiviral particles encoding a guide RNA specific to GM-CSF (gene name CSF2) and Cas9. We previously found that GM-CSF neutralization ameliorates CRS and NT in a xenograft model.12&#160;GM-CSFk/o CAR-T cells allow for the inhibition of GM-CSF during the manufacturing process, effectively reducing production of GM-CSF while enhancing CAR-T cell anti-tumor activity and survival in vivo compared to wildtype CAR-T cells.12&#160;Thus, here we provide a methodology to generate CRISPR/Cas9 edited CAR-T cells.

<table><tbody><tr><td>CD3 Monoclonal Antibody (OKT3), PE, eBioscience</td><td>Invitrogen</td><td>12-0037-42</td><td></td></tr><tr><td>CD3 Monoclonal Antibody (UCHT1), APC, eBioscience</td><td>Invitrogen</td><td>17-0038-42</td><td></td></tr><tr><td>Choice Taq Blue Mastermix</td><td>Denville Scientific</td><td>C775Y51</td><td></td></tr><tr><td>CTS (Cell Therapy Systems) Dynabeads CD3/CD28</td><td>Gibco</td><td>40203D</td><td></td></tr><tr><td>CytoFLEX System B4-R2-V2</td><td>Beckman Coulter</td><td>C10343</td><td>flow cytometer</td></tr><tr><td>dimethyl sulfoxide</td><td>Millipore Sigma</td><td>D2650-100ML</td><td></td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline</td><td>Gibco</td><td>14190-144&amp;nbsp;</td><td></td></tr><tr><td>Dynabeads MPC-S (Magnetic Particle Concentrator)</td><td>Applied Biosystems</td><td>A13346</td><td></td></tr><tr><td>Easy 50 EasySep Magnet</td><td>STEMCELL Technologies</td><td>18002</td><td></td></tr><tr><td>EasySep Human T Cell Isolation Kit&amp;nbsp;</td><td>STEMCELL Technologies</td><td>17951</td><td>negative selection magnetic beads; 17951RF includes tips and buffer</td></tr><tr><td>Fetal bovine serum</td><td>Millipore Sigma</td><td>F8067</td><td></td></tr><tr><td>FITC Mouse Anti-Human CD107a&amp;nbsp;</td><td>BD Pharmingen</td><td>555800</td><td></td></tr><tr><td>Fixation Medium (Medium A)</td><td>Invitrogen</td><td>GAS001S100</td><td></td></tr><tr><td>GenCRISPR gRNA Construct: Name: CSF2&lt;br/&gt; CRISPR guide RNA 1; Species: Human, Vector:&lt;br/&gt; pLentiCRISPR v2; Resistance: Ampicillin; Copy number:&lt;br/&gt; High; Plasmid preparation: Standard delivery: 4 &amp;mu;g (Free&lt;br/&gt; of charge)</td><td>GenScript</td><td>N/A</td><td>custom order</td></tr><tr><td>Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647</td><td>Invitrogen</td><td>A-21235</td><td></td></tr><tr><td>https://tide.nki.nl.</td><td>Desktop Genetics</td><td></td><td></td></tr><tr><td>Human AB Serum; Male Donors; type AB; US</td><td>Corning</td><td>35-060-CI</td><td></td></tr><tr><td>IFN gamma Monoclonal Antibody (4S.B3), APC-eFluor 780, eBioscience</td><td>Invitrogen</td><td>47-7319-42</td><td></td></tr><tr><td>Lipofectamine 3000 Transfection Reagent</td><td>Invitrogen</td><td>L3000075</td><td></td></tr><tr><td>LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, for 405 nm excitation</td><td>Invitrogen</td><td>L34966</td><td></td></tr><tr><td>Lymphoprep</td><td>STEMCELL Technologies</td><td>07851</td><td></td></tr><tr><td>Monensin Solution, 1000X</td><td>BioLegend</td><td>420701</td><td></td></tr><tr><td>Mouse Anti-Human CD28 Clone CD28.2</td><td>BD Pharmingen</td><td>559770</td><td></td></tr><tr><td>Mouse Anti-Human CD49d Clone 9F10</td><td>BD Pharmingen</td><td>561892</td><td></td></tr><tr><td>Mouse Anti-Human MIP-1&amp;beta; PE-Cy7</td><td>BD Pharmingen</td><td>560687</td><td></td></tr><tr><td>Mr. Frosty Freezing Container</td><td>Thermo Scientific</td><td>5100-0001</td><td></td></tr><tr><td>NALM6, clone G5&amp;nbsp;</td><td>ATCC</td><td>CRL-3273</td><td>acute lymphoblastic leukemia cell line</td></tr><tr><td>Nuclease Free Water</td><td>Promega</td><td>P119C</td><td></td></tr><tr><td>Olympus Vacuum Filter Systems, 500 mL, PES Membrane, 0.22uM, sterile</td><td>Genesee Scientific</td><td>25-227</td><td></td></tr><tr><td>Nalgene Rapid-Flow Sterile Disposable Filter Units with CN Membrane 0.45uM</td><td>Thermo Scientific Nalgene</td><td>450-0045</td><td></td></tr><tr><td>Opti-MEM I Reduced-Serum Medium (1X), Liquid</td><td>Gibco</td><td>31985-070</td><td></td></tr><tr><td>PE-CF594 Mouse Anti-Human IL-2</td><td>BD Horizon</td><td>562384</td><td></td></tr><tr><td>Penicillin-Streptomycin-Glutamine (100X), Liquid</td><td>Gibco</td><td>10378-016</td><td></td></tr><tr><td>Permeabilization Medium (Medium B)</td><td>Invitrogen</td><td>GAS002S100</td><td></td></tr><tr><td>PureLink Genomic DNA Mini Kit</td><td>Invitrogen</td><td>K182001</td><td></td></tr><tr><td>Puromycin Dihydrochloride</td><td>MP Biomedicals, Inc.</td><td>0210055210</td><td></td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>QIAGEN</td><td>28704</td><td></td></tr><tr><td>Rat Anti-Human GM-CSF BV421</td><td>BD Horizon</td><td>562930</td><td></td></tr><tr><td>RoboSep-S</td><td>STEMCELL Technologies</td><td>21000</td><td>Fully Automated Cell Separator</td></tr><tr><td>SepMate-50 (IVD)</td><td>STEMCELL Technologies</td><td>85450</td><td></td></tr><tr><td>Sodium Azide, 5% (w/v)</td><td>Ricca Chemical</td><td>7144.8-16</td><td></td></tr><tr><td>X-VIVO 15 Serum-free Hematopoietic Cell Medium</td><td>Lonza</td><td>04-418Q</td><td></td></tr></tbody></table>

using crispr/cas9 to knock out gm-csf in car-t cells

Chimeric antigen receptor T (CAR-T) cell therapy is a cutting edge and potentially revolutionary new treatment option for cancer. However, there are significant limitations to its widespread use in the treatment of cancer. These limitations include the development of unique toxicities such as cytokine release syndrome (CRS) and neurotoxicity (NT) and limited expansion, effector functions, and anti-tumor activity in solid tumors. One strategy to enhance CAR-T efficacy and/or control toxicities of CAR-T cells is to edit the genome of the CAR-T cells themselves during CAR-T cell manufacturing. Here, we describe the use of CRISPR/Cas9 gene editing in CAR-T cells via transduction with a lentiviral construct containing a guide RNA to granulocyte macrophage colony-stimulating factor (GM-CSF) and Cas9. As an example, we describe CRISPR/Cas9 mediated knockout of GM-CSF. We have shown that these GM-CSFk/o CAR-T cells effectively produce less GM-CSF while maintaining critical T cell function and result in enhanced anti-tumor activity in vivo compared to wild type CAR-T cells.

Figure 1&#160;shows reduction of GM-CSF in GM-CSFk/o CART19 cells. To verify that the genome of the T cells was altered to knockout GM-CSF, TIDE sequencing was used in the GM-CSFk/o CART19 cells (Figure 1A). CAR-T cell surface staining verifies that the T cells successfully express the CAR surface receptor in vitro by gating on live CD3+ cells (Figure 1B). Intracellular staining...

Watch this Scientific Journal Video about Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells at JoVE.com

Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells

Here, we present a protocol to genetically edit CAR-T cells via a CRISPR/Cas9 system.

Chimeric antigen receptor T (CAR-T) cell therapy is a cutting edge and potentially revolutionary new treatment option for cancer. However, there are ...

using-crisprcas9-to-knock-out-gm-csf-in-car-t-cells

Research

JoVE Journal

Cancer Research

11.0K Views.  Mayo Clinic College of Medicine and Science. Here, we present a protocol to genetically edit CAR-T cells via a CRISPR/Cas9 system.

Video: Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Genetics

Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional properties such as proliferation and differentiation, thereby promoting the development of hematologic malignancies. Efficient and precise genetic manipulation of HSPCs is required to model, characterize, and better understand the functional consequences of recurrent somatic mutations. Mutations can have a deleterious effect on a gene and result in loss-of-function (LOF) or, in stark contrast, may enhance function or even lead to novel characteristics of a particular gene, termed gain-of-function (GOF). In contrast to LOF mutations, GOF mutations almost exclusively occur in a heterozygous fashion. Current genome-editing protocols do not allow for the selective targeting of individual alleles, hampering the ability to model heterozygous GOF mutations. Here, we provide a detailed protocol on how to engineer heterozygous GOF hotspot mutations in human HSPCs by combining CRISPR/Cas9-mediated homology-directed repair and recombinant AAV6 technology for efficient DNA donor template transfer. Importantly, this strategy makes use of a dual fluorescent reporter system to allow for the tracking and purification of successfully heterozygously edited HSPCs. This strategy can be employed to precisely investigate how GOF mutations affect HSPC function and their progression toward hematological malignancies.

Novel strategies to faithfully model somatic mutations in hematopoietic stem and progenitor cells (HSPCs) are necessary to better study hematopoietic stem cell biology and hematological malignancies. Here, a protocol to model heterozygous gain-of-function mutations in HSPCs by combining the use of CRISPR/Cas9 and dual rAAV donor transduction is described.

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional ...

Genome-Wide CRISPR Screens in CART Cells to Investigate Therapy Resistance

Performing an In Vitro Genome-Wide CRISPR Knockout Screen in Chimeric Antigen Receptor T Cells

Chimeric antigen receptor T (CART) cell therapy is an innovative form of targeted immunotherapy that has revolutionized the treatment of cancer. However, the durable response remains limited. Recent studies have shown that the epigenetic landscape of preinfusion CART cell products can influence response to therapy, and gene editing has been proposed as a solution. However, more work needs to be done to determine the optimal gene editing strategy. Genome-wide CRISPR screens have become popular tools to both investigate mechanisms of resistance and optimize gene editing strategies. Yet their application to primary cells presents many challenges. Here we describe a method to complete a genome-wide CRISPR knockout screen in CART cells from healthy donors. As a proof-of-concept model, we designed this method to investigate the development of exhaustion in CART cells targeting the CD19 antigen. However, we believe that this approach can be used to address a variety of mechanisms of resistance to therapy in different CAR constructs and tumor models.

The article describes a protocol for the application of an in vitro model for exhaustion to complete a genome-wide CRISPR knockout screen in healthy donor chimeric antigen receptor T cells.

Chimeric antigen receptor T (CART) cell therapy is an innovative form of targeted immunotherapy that has revolutionized the treatment of cancer. However, ...

A Nonviral Approach to Generate Transient Chimeric Antigen Receptor T Cells Using mRNA for Cancer Immunotherapy

Chimeric antigen receptor (CAR) T cell therapy has emerged as a pioneering cancer treatment, achieving unprecedented success in treating certain hematological malignancies such as lymphomas and leukemias. However, as more cancer patients receive CAR-T cell therapies, treatment-associated secondary primary malignancies are increasingly being reported partly due to unexpected CAR transgene insertion, raising serious safety concerns. To address this issue, we describe here a nonviral, non-integrating approach to generate transient CAR-T cells using mRNA. We electroporated T cells with modified mRNA encoding a human epidermal growth factor receptor 2 (HER2)-specific CAR and generated transient HER2-targeted CAR-T cells. The CAR was efficiently expressed on the T cell surface 1 day after electroporation, increased by day 2, and dramatically declined by day 5. The transient CAR-T cells exhibited potent cytotoxicity against HER2-positive SKOV-3 ovarian cancer cells and secreted high levels of IFN-&#978;. This protocol provides a step-by-step guide for developing small-scale transient CAR-T cells without permanent CAR transgene integration, describing detailed procedures for preparation of CAR mRNA, activation and transfection of T cells, assessment of CAR expression, and in vitro analysis of CAR-T cell function. This method is suitable for transient CAR-T cell generation in both preclinical and clinical studies.

This protocol outlines a detailed procedure for generating transient chimeric antigen receptor (CAR) T cells using non-integrating mRNA for cancer immunotherapy and provides reliable methods for evaluating CAR-T cells and their cytotoxic function.

Chimeric antigen receptor (CAR) T cell therapy has emerged as a pioneering cancer treatment, achieving unprecedented success in treating certain ...

Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging in primary NK cells. For example, transgene delivery using lentiviral or retroviral transduction resulted in a limited yield of genetically-engineered NK cells due to substantial procedure-associated NK cell apoptosis. We describe here a DNA-free method for genome editing of human primary and expanded NK cells using Cas9 ribonucleoprotein complexes (Cas9/RNPs). This method allowed efficient knockout of the TGFBR2 and HPRT1 genes in NK cells. RT-PCR data showed a significant decrease in gene expression level, and a cytotoxicity assay of a representative cell product suggested that the RNP-modified NK cells became less sensitive to TGF&#946;. Genetically modified cells could be expanded post-electroporation by stimulation with irradiated mbIL21-expressing feeder cells.

Here, we present a protocol to genetically modify primary or expanded human natural killer (NK) cells using Cas9 Ribonucleoproteins (Cas9/RNPs). By using this protocol, we generated human NK cells deficient for transforming growth factor&#8211;b receptor 2 (TGFBR2) and hypoxanthine phosphoribosyltransferase 1 (HPRT1).

CRISPR/Cas9 technology is accelerating genome engineering in many cell types, but so far, gene delivery and stable gene modification have been challenging ...

Immunology and Infection

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Production of Human CRISPR-Engineered CAR-T Cells

Adoptive cell therapies using chimeric antigen receptor T cells (CAR-T cells) have demonstrated remarkable clinical efficacy in patients with hematological malignancies and are currently being investigated for various solid tumors. CAR-T cells are generated by removing T cells from a patient's blood and engineering them to express a synthetic immune receptor that redirects the T-cells to recognize and eliminate target tumor cells. Gene editing of CAR-T cells has the potential to improve safety of current CAR-T cell therapies and further increase the efficacy of CAR-T cells. Here, we describe methods for the activation, expansion, and characterization of human CRISPR-engineered CD19 directed CAR-T cells. This comprises transduction of the CAR lentiviral vector and use of single guide RNA (sgRNA) and Cas9 endonuclease to target genes of interest in T cells. The methods described in this protocol can be universally applied to other CAR constructs and target genes beyond the ones used for this study. Furthermore, this protocol discusses strategies for gRNA design, lead gRNA selection and target gene knockout validation to reproducibly achieve high-efficiency, multiplex CRISPR-Cas9 engineering of clinical grade human T cells.

Here, we present a protocol for gene editing in primary human T cells using CRISPR Cas Technology to modify CAR-T cells.

Adoptive cell therapies using chimeric antigen receptor T cells (CAR-T cells) have demonstrated remarkable clinical efficacy in patients with ...

Streamlined Protocol for Mouse CAR-T Cell Generation in Syngeneic Models

Efficient Generation of Murine Chimeric Antigen Receptor (CAR)-T Cells

Engineered cell therapies utilizing chimeric antigen receptor (CAR)-T cells have achieved remarkable effectiveness in individuals with hematological malignancies and are presently undergoing development for the treatment of diverse solid tumors. So far, the preliminary evaluation of novel CAR-T cell products has predominantly taken place in xenograft tumor models using immunodeficient mice. This approach is chosen to facilitate the successful engraftment of human CAR-T cells in the experimental setting. However, syngeneic mouse models, in which tumors and CAR-T cells are derived from the same mouse strain, allow evaluation of new CAR technologies in the context of a functional immune system and comprehensive tumor microenvironment (TME). The protocol described here aims to streamline the process of mouse CAR-T cell generation by presenting standardized methods for retroviral transduction and ex vivo T cell culture. The methods described in this protocol can be applied to other CAR constructs beyond the ones used in this study to enable routine evaluation of new CAR technologies in immune-competent systems.

Author Spotlight: Enhancing CAR-T Cell Function in Syngeneic Tumor Models 

This protocol streamlines retroviral vector production and murine T cell transduction, facilitating the efficient generation of mouse CAR-T cells.

Engineered cell therapies utilizing chimeric antigen receptor (CAR)-T cells have achieved remarkable effectiveness in individuals with hematological ...

Bioengineering

Genetically Modifying CAR T Cells Using a CRISPR-Cas9 System

Source: Sterner, R. M. et al., <a href="https://app.jove.com/v/59629">Using CRISPR/Cas9 to Knock Out GM-CSF in CAR-T Cells.</a>&#160;J. Vis. Exp. (2019)
The video outlines a process for creating genetically modified CAR T cells through the CRISPR-Cas9 System. Infecting T cells with CRISPR and CAR lentiviruses results in modifications to the target gene and the synthesis of a chimeric antigen receptor or CAR, ultimately leading to the formation of genetically modified CAR T cells.

1. CART19 cell production

	T-cell isolation, stimulation, and ex-vivo culture
	
		Carry out all cell culture work in a cell culture hood utilizing ...