This work was supported by the NIH grant GM120209 (GS). The authors thank the OSUCCC Genomics Shared Resources Core for their services (CCC Support Grant NCI P30 CA16058).

<ol>
	<li>Karousis, E. D., Nasif, S., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsense-mediated+mRNA+decay:+novel+mechanistic+insights+and+biological+impact.">Nonsense-mediated mRNA decay: novel mechanistic insights and biological impact.</a> Wiley Interdisciplinary Reviews: RNA. 7 (5), 661-682 (2016).</li><li>Ivanov, P. V., Gehring, N. H., Kunz, J. B., Hentze, M. W., Kulozik, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+UPF1,+eRFs,+PABP+and+the+exon+junction+complex+suggest+an+integrated+model+for+mammalian+NMD+pathways.">Interactions between UPF1, eRFs, PABP and the exon junction complex suggest an integrated model for mammalian NMD pathways.</a> The EMBO Journal. 27 (5), 736-747 (2008).</li><li>Papasaikas, P., Valc&#225;rcel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Spliceosome:+The+Ultimate+RNA+Chaperone+and+Sculptor.">The Spliceosome: The Ultimate RNA Chaperone and Sculptor.</a> Trends in Biochemical Sciences. 41 (1), 33-45 (2016).</li><li>Jensen, K. B., Darnell, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CLIP:+Crosslinking+and+ImmunoPrecipitation+of+In+Vivo+RNA+Targets+of+RNA-Binding+Proteins.">CLIP: Crosslinking and ImmunoPrecipitation of In Vivo RNA Targets of RNA-Binding Proteins.</a> Methods in Molecular Biology. 488, 85-98 (2008).</li><li>Garzia, A., Morozov, P., Sajek, M., Meyer, C., Tuschl, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PAR-CLIP+for+Discovering+Target+Sites+of+RNA-Binding+Proteins.">PAR-CLIP for Discovering Target Sites of RNA-Binding Proteins.</a> mRNA Decay: Methods and Protocols. 1720, 55-75 (2018).</li><li>Konig, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iCLIP+-+Transcriptome-wide+Mapping+of+Protein-RNA+Interactions+with+Individual+Nucleotide+Resolution.">iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution.</a> Journal of Visualized Experiments. (50), e2638 (2011).</li><li>Sibley, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Individual+Nucleotide+Resolution+UV+Cross-Linking+and+Immunoprecipitation+(iCLIP)+to+Determine+Protein-RNA+Interactions.">Individual Nucleotide Resolution UV Cross-Linking and Immunoprecipitation (iCLIP) to Determine Protein-RNA Interactions.</a> RNA Detection: Methods and Protocols. 1649, 427-454 (2018).</li><li>Wheeler, E. C., Van Nostrand, E. L., Yeo, G. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+and+challenges+in+the+detection+of+transcriptome&#8208;wide+protein-RNA+interactions.">Advances and challenges in the detection of transcriptome&#8208;wide protein-RNA interactions.</a> Wiley Interdisciplinary Reviews: RNA. 9 (1), (2018).</li><li>Singh, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Cellular+EJC+Interactome+Reveals+Higher-Order+mRNP+Structure+and+an+EJC-SR+Protein+Nexus.">The Cellular EJC Interactome Reveals Higher-Order mRNP Structure and an EJC-SR Protein Nexus.</a> Cell. 151, 750-764 (2012).</li><li>Singh, G., Ricci, E. P., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RIPiT-Seq:+A+high-throughput+approach+for+footprinting+RNA:protein+complexes.">RIPiT-Seq: A high-throughput approach for footprinting RNA:protein complexes.</a> Methods. 65, 320-332 (2014).</li><li>Mabin, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Exon+Junction+Complex+Undergoes+a+Compositional+Switch+that+Alters+mRNP+Structure+and+Nonsense-Mediated+mRNA+Decay+Activity.">The Exon Junction Complex Undergoes a Compositional Switch that Alters mRNP Structure and Nonsense-Mediated mRNA Decay Activity.</a> Cell Reports. 25 (9), 2431-2446 (2018).</li><li>Gehring, N. H., Lamprinaki, S., Kulozik, A. E., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disassembly+of+Exon+Junction+Complexes+by+PYM.">Disassembly of Exon Junction Complexes by PYM.</a> Cell. 137 (3), 536-548 (2009).</li><li>Dostie, J., Dreyfuss, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+Is+Required+to+Remove+Y14+from+mRNAs+in+the+Cytoplasm.">Translation Is Required to Remove Y14 from mRNAs in the Cytoplasm.</a> Current Biology. 12 (13), 1060-1067 (2002).</li><li>Z&#252;nd, D., Gruber, A. R., Zavolan, M., M&#252;hlemann, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation-dependent+displacement+of+UPF1+from+coding+sequences+causes+its+enrichment+in+3'+UTRs.">Translation-dependent displacement of UPF1 from coding sequences causes its enrichment in 3' UTRs.</a> Nature Structural &amp; Molecular Biology. 20 (8), 936-943 (2013).</li><li>Gangras, P., Dayeh, D. M., Mabin, J. W., Nakanishi, K., Singh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+Identification+of+Recombinant+Argonaute-Bound+Small+RNAs+Using+Next-Generation+Sequencing.">Cloning and Identification of Recombinant Argonaute-Bound Small RNAs Using Next-Generation Sequencing.</a> Argonaute Proteins: Methods and Protocols. 1680, 1-28 (2018).</li><li>Heyer, E. E., Ozadam, H., Ricci, E. P., Cenik, C., Moore, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+kit-free+method+for+making+strand-specific+deep+sequencing+libraries+from+RNA+fragments.">An optimized kit-free method for making strand-specific deep sequencing libraries from RNA fragments.</a> Nucleic Acids Research. 43 (1), 2 (2015).</li><li>Cameron, V., Uhlenbeck, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3'-Phosphatase+activity+in+T4+polynucleotide+kinase.">3'-Phosphatase activity in T4 polynucleotide kinase.</a> Biochemistry. 16 (23), 5120-5126 (1977).</li><li>Ricci, E. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Staufen1+senses+overall+transcript+secondary+structure+to+regulate+translation.">Staufen1 senses overall transcript secondary structure to regulate translation.</a> Nature Structural &amp; Molecular Biology. 21 (1), 26-35 (2014).</li><li>Lackner, D. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+generic+strategy+for+CRISPR-Cas9-mediated+gene+tagging.">A generic strategy for CRISPR-Cas9-mediated gene tagging.</a> Nature Communications. 6, 10237 (2015).</li><li>Metkar, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher-Order+Organization+Principles+of+Pre-translational+mRNPs.">Higher-Order Organization Principles of Pre-translational mRNPs.</a> Molecular Cell. 72 (4), 715-726 (2018).</li><li>Giudice, G., S&#225;nchez-Cabo, F., Torroja, C., Lara-Pezzi, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ATtRACT-a+database+of+RNA-binding+proteins+and+associated+motifs.">ATtRACT-a database of RNA-binding proteins and associated motifs.</a> Database: The Journal of Biological Databases and Curation. 2016, (2016).</li><li>Paz, I., Kosti, I., Ares, M., Cline, M., Mandel-Gutfreund, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RBPmap:+a+web+server+for+mapping+binding+sites+of+RNA-binding+proteins.">RBPmap: a web server for mapping binding sites of RNA-binding proteins.</a> Nucleic Acids Research. 42, 361-367 (2014).</li><li>Sundararaman, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resources+for+the+Comprehensive+Discovery+of+Functional+RNA+Elements.">Resources for the Comprehensive Discovery of Functional RNA Elements.</a> Molecular Cell. 61 (6), 903-913 (2016).</li></ol>

The authors have nothing to disclose.

We discuss here some key considerations to successfully perform RIPiT. Foremost, individual IPs must be optimized to achieve highest possible efficiency at each step. The amount of FLAG agarose beads for the input number of cells described here has proven to be robust for a wide range of proteins we have tested. As only a small fraction of partner proteins is co-immunoprecipitated with the FLAG protein, the amount of antibody needed for efficient second IP is usually low (less than 10 &#181;g). Small-scale RIPiT (from on...

Within cells, RNA exists in complex with proteins to form RNA:protein complexes (RNPs). RNPs are assembled around RNA binding proteins (RBPs, those that directly bind RNA) but also comprise of non-RBPs (those that bind RBPs but not RNA), and are often dynamic in nature. RBPs and their cofactors function collectively within RNPs to execute regulatory functions. For example, in the nonsense-mediated mRNA decay (NMD) pathway, the UPF proteins (UPF1, UPF2, and UPF3b) recognize the prematurely terminated ribosome. Each of the UPF proteins can bind to RNA, but it is only when they assemble together that an active NMD complex begins to form. Within this complex, UPF1 is further activated by phosphorylation by a non-RBP SMG1, and such UPF1 activation eventually leads to recruitment of mRNA decay inducing factors1,2. In this example, RBPs require non-RBP cofactors for recruitment and activation of the RNP complex that triggers NMD. Yet another property of RNPs is their compositional heterogeneity. Consider the spliceosome, which exists in distinct E, A, B or C complexes. Different spliceosome complexes have overlapping and distinct proteins3. To study RNP functions, it is important to elucidate which RNAs are bound by an RBP and its associated proteins. Many methods exist to accomplish this, with each approach having its distinct advantages and disadvantages4,5,6,7.
The widely popular methods to identify RBP binding sites &#8212; crosslinking followed by immunoprecipitation (CLIP) and its various variations -&#160;rely on ultraviolet (UV) light to crosslink an RBP to RNA8. However, this is not an effective approach for non-RBPs within RNPs, which do not contact the RNA directly. Here, we describe an alternative approach that is applicable to RBPs and non-RBPs alike, to isolate and identify their RNA binding sites. This approach termed RNA immunoprecipitation in tandem (RIPiT) consists of two immunoprecipitation steps, which help achieve higher specificity as compared to a single purification (Figure 1)9,10. As the individual immunoprecipitation (IP) steps can be carried out at a lower stringency as compared to CLIP, RIPiT does not depend on availability of antibodies that can withstand presence of strong detergents during immunoprecipitation. The most unique advantage of RIPiT is the ability to target two different proteins in two purification steps; this provides a powerful way to enrich a compositionally distinct RNP complex from other similar complexes11.
Small variations to the RIPiT procedure can further enhance RNP enrichment. For instance, some RNA-protein or protein-protein interactions within RNPs are transient and it may be difficult to efficiently purify footprints of such complexes. To stabilize such interactions, RNPs can be crosslinked within cells with formaldehyde prior to cell lysis and RIPiT. For example, we have observed that a weak interaction between the exon junction complex (EJC) core factor, EIF4AIII and the EJC disassembly factor, PYM12&#160;can be stabilized with formaldehyde treatment such that more RNA footprints are enriched (data not shown). Prior to cell harvesting and RIPiT, cells can also be treated with drugs to stabilize or enrich RNPs in a particular state. For example, when studying proteins that are removed from mRNA during translation (e.g., the EJC13, UPF114), treatment with translation inhibitors such as puromycin, cycloheximide or harringtonine can lead to increased occupancy of proteins on RNAs.
The amount of RNA recovered from RIPiT is usually low (0.5-10 pmoles, i.e., 10-250 ng RNA considering an average RNA length of 75 nt). The primary reason for this is that only a small fraction of a given protein is present in complex with other proteins within RNPs (any &#34;free&#34;&#160;protein IP&#39;ed in the first step is lost during the second IP). To generate RNA-Seq libraries from this RNA, we also outline here an adaptation of previously published protocol suitable for such low RNA inputs15,16&#160;(Figure 2), which yields high-throughput sequencing ready samples in 3 days.

<table><tbody><tr><td>Anti-FLAG Affinity Gel</td><td>Sigma</td><td>A2220</td><td></td></tr><tr><td>ATP, [&amp;gamma;-32P]- 3,000 Ci/mmol 10 mCi/mL EasyTide, 250 &amp;micro;Ci</td><td>PerkinElmer</td><td>BLU502A250UC</td><td></td></tr><tr><td>BD Disposable Syringes with Luer-Lok Tips (200)</td><td>Fisher</td><td>14-823-435</td><td></td></tr><tr><td>Betaine 5M</td><td>Sigma</td><td>B0300</td><td></td></tr><tr><td>biotin-dATP</td><td>TriLink</td><td>N-5002</td><td></td></tr><tr><td>biotin-dCTP</td><td>Perkin Elmer</td><td>NEL540001EA</td><td></td></tr><tr><td>Branson Sonifier, Model SSE-1</td><td>Branson</td><td></td><td></td></tr><tr><td>CircLigase I</td><td>VWR</td><td>76081-606</td><td>ssDNA ligase I</td></tr><tr><td>DMEM, High Glucose</td><td>ThermoFisher</td><td>11995-065</td><td></td></tr><tr><td>DNA load buffer NEB</td><td>NEB</td><td></td><td></td></tr><tr><td>Dynabeads Protein A</td><td>LifeTech</td><td>10002D</td><td></td></tr><tr><td>Flp-In-T-REx 293 Cell Line</td><td>ThermoFisher</td><td>R78007</td><td></td></tr><tr><td>GeneRuler Low Range DNA Ladder</td><td>ThermoScientific</td><td>FERSM1203</td><td></td></tr><tr><td>Hygromycin B</td><td>ThermoFisher</td><td>10687010</td><td></td></tr><tr><td>Mini-PROTEAN TBE Gel 10 well</td><td>Bio-Rad</td><td>4565013</td><td></td></tr><tr><td>Mini-PROTEAN TBE-Urea Gel</td><td>Bio-Rad</td><td>4566033</td><td></td></tr><tr><td>miRCAT-33 adapter 5&amp;prime;-TGGAATTCTCGGGTGCCAAGGddC-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>Mirus transIT-X2 transfection reagent</td><td>Mirus</td><td>MIR 6004</td><td></td></tr><tr><td>Mth RNA ligase</td><td>NEB</td><td>E2610S</td><td></td></tr><tr><td>PE1.0 5&amp;prime;-AATGATACGGCGACCACCGAGATCTACACT&lt;br/&gt; CTTTCCCTACACGACGCTCTTCCGATC*T-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>PE2.0 5&amp;prime;-CAAGCAGAAGACGGCATACGAGATCGGTCTC&lt;br/&gt; GGCATTCCTGCTGAACCGCTCTTCCGATC*T-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>Phenol/Chloroform/Isoamyl Alcohol (25:24:1, pH 6.7, 100 mLl)</td><td>Fisher</td><td>BP1752I-100</td><td></td></tr><tr><td>Purple Gel Loading Dye (6x)</td><td>NEB</td><td>NEB #7025</td><td></td></tr><tr><td>Q5 DNA Polymerase</td><td>NEB</td><td>M0491S/L</td><td></td></tr><tr><td>RNase I, &lt;em&gt;E. coli&lt;/em&gt;, 1,000 U</td><td>Eppicenter</td><td>N6901K</td><td></td></tr><tr><td>SPIN-X column</td><td>Corning</td><td>CLS8160-24EA</td><td></td></tr><tr><td>Streptavidin beads</td><td>ThermoFisher</td><td>60210</td><td></td></tr><tr><td>Superscript III (SSIII)</td><td>ThermoScientific</td><td>18080044</td><td>reverse transcriptase enzyme</td></tr><tr><td>SybrGold</td><td>ThermoFisher</td><td>S11494</td><td>gold nucleic acid gel stain</td></tr><tr><td>T4 Polynucleotide Kinase-2500U</td><td>NEB</td><td>M0201L</td><td></td></tr><tr><td>T&lt;sub&gt;4&lt;/sub&gt;RNL2 Tr. K227Q</td><td>NEB</td><td>M0351S</td><td></td></tr><tr><td>Tetracycline</td><td>Sigma</td><td>87128</td><td></td></tr><tr><td>Thermostable 5&amp;acute; App DNA/RNA Ligase</td><td>NEB</td><td>M0319S</td><td></td></tr><tr><td>TruSeq_SE1 5&amp;prime;-pGGCACTANNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE10 5&amp;prime;-pGGTGTTCNNNNNAGATCGGAAG&lt;br/&gt; AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT&lt;br/&gt; CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE11 5&amp;prime;-pGGTAAGTNNNNNAGATCGGAA&lt;br/&gt; GAGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE12 5&amp;prime;-pGGAGATGNNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE2 5&amp;prime;-pGGGTAGCNNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT&lt;br/&gt; CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE35&amp;prime;-pGGTCGATNNNNNAGATCGGAAG&lt;br/&gt; AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCT&lt;br/&gt; CTTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE4 5&amp;prime;-pGGCCTCGNNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE5 5&amp;prime;-pGGTGACANNNNNAGATCGGAAGA&lt;br/&gt; GCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTC&lt;br/&gt; TTCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE6 5&amp;prime;-pGGTAGACNNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC&lt;br/&gt; CGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE7 5&amp;prime;-pGGGCCCTNNNNNAGATCGGAAG&lt;br/&gt; AGCGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCT&lt;br/&gt; TCCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE8 5&amp;prime;-pGGATCGGNNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTT&lt;br/&gt; CCGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>TruSeq_SE9 5&amp;prime;-pGGACTGANNNNNAGATCGGAAGAG&lt;br/&gt; CGTCGTGTAGGGAAAGAGTGT-SPACER 18-CTCGGCATTCCTGCTGAACCGCTCTTC&lt;br/&gt; CGATCTCCTTGGCACCCGAGAATTCCA-3&amp;prime;</td><td>Any</td><td></td><td>this protocol is only compatible with the Illumina sequencing platform</td></tr><tr><td>Typhoon 5 Bimolecular Imager</td><td>GE Healthcare Life Science</td><td>29187191</td><td></td></tr></tbody></table>

identification of footprints of rna:protein complexes via rna immunoprecipitation in tandem followed by sequencing (ripit-seq)

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT employs two purification steps. First, immunoprecipitation of a tagged RNP subunit is followed by mild RNase digestion and subsequent non-denaturing affinity elution. A second immunoprecipitation of another RNP subunit allows for enrichment of a defined complex. Following a denaturing elution of RNAs and proteins, the RNA footprints are converted into high-throughput DNA sequencing libraries. Unlike the more popular ultraviolet (UV) crosslinking followed by immunoprecipitation (CLIP) approach to enrich RBP binding sites, RIPiT is UV-crosslinking independent. Hence RIPiT can be applied to numerous proteins present in the RNA interactome and beyond that are essential to RNA regulation but do not directly contact the RNA or UV-crosslink poorly to RNA. The two purification steps in RIPiT provide an additional advantage of identifying binding sites where a protein of interest acts in partnership with another cofactor. The double purification strategy also serves to enhance signal by limiting background. Here, we provide a step-wise procedure to perform RIPiT and to generate high-throughput sequencing libraries from isolated RNA footprints. We also outline RIPiT&#39;s advantages and applications and discuss some of its limitations.

A successful RIPiT will result in the immunoprecipitation of both proteins of interest and other known interacting proteins, and the absence of non-interacting proteins. As seen in Figure 3A, both Magoh and EIF4AIII were detected in the RIPiT elution, but HNRNPA1 was not (lane 6). In parallel, RNA footprints that have co-purified with the RNP complexes was detected via autoradiography (Figure 3B) or bioanalyzer (<strong class="x...

Watch this Scientific Journal Video about Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq at JoVE.com

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq

Here, we present a protocol to enrich endogenous RNA binding sites or &#34;footprints&#34;&#160;of RNA:protein (RNP) complexes from mammalian cells. This approach involves two immunoprecipitations of RNP subunits and is therefore dubbed RNA immunoprecipitation in tandem (RIPiT).

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT ...

identification-footprints-rnaprotein-complexes-via-rna

Research

JoVE Journal

Genetics

10.4K Views.  The Ohio State University. Here, we present a protocol to enrich endogenous RNA binding sites or "footprints" of RNA:protein (RNP) complexes from mammalian cells. This approach involves two immunoprecipitations of RNP subunits and is therefore dubbed RNA immunoprecipitation in tandem (RIPiT).

Video: Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing RIPiT-Seq

Isolation of Cognate RNA-protein Complexes from Cells Using Oligonucleotide-directed Elution

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. They are composed of position-dependent, cis-acting RNA elements and unique combinations of RNA binding proteins. Defining the composition of a specific RNP is essential to achieving a fundamental understanding of gene regulation. The isolation of a select RNP is akin to finding a needle in a haystack. Here, we demonstrate an approach to isolate RNPs associated at the 5' untranslated region of a select mRNA in asynchronous, transfected cells. This cognate RNP has been demonstrated to be necessary for the translation of select viruses and cellular stress-response genes.
The demonstrated RNA-protein co-precipitation protocol is suitable for the downstream analysis of protein components through proteomic analyses, immunoblots, or suitable biochemical identification assays. This experimental protocol demonstrates that DHX9/RNA helicase A is enriched at the 5' terminus of cognate retroviral RNA and provides preliminary information for the identification of its association with cell stress-associated huR and junD cognate mRNAs.

This manuscript describes an approach to isolate select cognate RNPs formed in eukaryotic cells via a specific oligonucleotide-directed enrichment. We demonstrate the applicability of this approach by isolating a cognate RNP bound to the retroviral 5' untranslated region that is composed of DHX9/RNA helicase A.

Ribonucleoprotein particles direct the biogenesis and post-transcriptional regulation of all mRNAs through distinct combinations of RNA binding proteins. ...

Biochemistry

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription reflect changes in protein synthesis, but many exceptions have been observed. Recently, a technique called ribosome profiling (or Ribo-Seq) has emerged as a powerful method that allows identification, with high accuracy, which regions of mRNA are translated into proteins and quantification of translation at the genome-wide level. Here, we present a generalized protocol for genome-wide quantification of translation using Ribo-Seq in budding yeast. In addition, combining Ribo-Seq data with mRNA abundance measurements allows us to simultaneously quantify translation efficiency of thousands of mRNA transcripts in the same sample and compare changes in these parameters in response to experimental manipulations or in different physiological states. We describe a detailed protocol for generation of ribosome footprints using nuclease digestion, isolation of intact ribosome-footprint complexes via sucrose gradient fractionation, and preparation of DNA libraries for deep sequencing along with appropriate quality controls necessary to ensure accurate analysis of in vivo translation.

Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription ...

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

An Oligonucleotide-based Tandem RNA Isolation Procedure to Recover Eukaryotic mRNA-Protein Complexes

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein complexes is essential to understanding mRNA regulation inferred by interacting proteins or non-coding RNAs. Herein, we describe a tandem RNA isolation procedure (TRIP) that enables the purification of endogenously formed mRNA-protein complexes from cellular extracts. The two-step protocol involves the isolation of polyadenylated mRNAs with antisense oligo(dT) beads and subsequent capture of an mRNA of interest with 3&#39;-biotinylated 2&#39;-O-methylated antisense RNA oligonucleotides, which can then be isolated with streptavidin beads. TRIP was used to recover in vivo crosslinked mRNA-ribonucleoprotein (mRNP) complexes from yeast, nematodes and human cells for further RNA and protein analysis. Thus, TRIP is a versatile approach that can be adapted to all types of polyadenylated RNAs across organisms to study the dynamic re-arrangement of mRNPs imposed by intracellular or environmental cues.

A tandem RNA isolation procedure (TRIP) for recovery of endogenously formed mRNA-protein complexes is described. Specifically, RNA-protein complexes are crosslinked in vivo, polyadenylated RNAs are isolated from extracts with oligo(dT) beads, and particular mRNAs are captured with modified RNA antisense oligonucleotides. Proteins bound to mRNAs are detected by immunoblot analysis.

RNA-binding proteins (RBPs) play key roles in the post-transcriptional control of gene expression. Therefore, biochemical characterization of mRNA-protein ...

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture (CARIC) Strategy

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used strategy for RBP capture exploits the polyadenylation [poly(A)] of target RNAs, which mostly occurs on eukaryotic mature mRNAs, leaving most binding proteins of non-poly(A) RNAs unidentified. Here we describe the detailed procedures of a recently reported method termed click chemistry-assisted RNA-interactome capture (CARIC), which enables the transcriptome-wide capture of both poly(A) and non-poly(A) RBPs by combining the metabolic labeling of RNAs, in vivo UV cross-linking, and bioorthogonal tagging.

Capture and Identification of RNA-binding Proteins by Using Click Chemistry-assisted RNA-interactome Capture CARIC Strategy

A detailed protocol for applying the click chemistry-assisted RNA-interactome capture (CARIC) strategy to identify proteins binding to both coding and noncoding RNAs is presented.

A comprehensive identification of RNA-binding proteins (RBPs) is key to understanding the posttranscriptional regulatory network in cells. A widely used ...

Mapping R-Loops and RNA:DNA Hybrids with S9.6-Based Immunoprecipitation Methods

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological favorability. In recent years, R-loops have been implicated in a variety of adaptive and maladaptive roles and have been linked to genomic instability in the context of human disorders. As a consequence, the accurate mapping of these structures in genomes is of high interest to many investigators. DRIP-seq (DNA:RNA Immunoprecipitation followed by high throughput sequencing) is described here. It is a robust and reproducible technique that permits accurate and semi-quantitative mapping of R-loops. A recent iteration of the method is also described in which fragmentation is accomplished using sonication (sDRIP-seq), which allows strand-specific and high-resolution mapping of R-loops. sDRIP-seq thus addresses some of the common limitations of the DRIP-seq method in terms of resolution and strandedness, making it a method of choice for R-loop mapping.

R-loops constitute a prevalent class of transcription-driven non-B DNA structures that occur in all genomes depending on both DNA sequence and topological ...

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

Biology

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...

iCLIP - Transcriptome-wide Mapping of Protein-RNA Interactions with Individual Nucleotide Resolution

The unique composition and spatial arrangement of RNA-binding proteins (RBPs) on a transcript guide the diverse aspects of post-transcriptional regulation1. Therefore, an essential step towards understanding transcript regulation at the molecular level is to gain positional information on the binding sites of RBPs2.
Protein-RNA interactions can be studied using biochemical methods, but these approaches do not address RNA binding in its native cellular context. Initial attempts to study protein-RNA complexes in their cellular environment employed affinity purification or immunoprecipitation combined with differential display or microarray analysis (RIP-CHIP)3-5. These approaches were prone to identifying indirect or non-physiological interactions6. In order to increase the specificity and positional resolution, a strategy referred to as CLIP (UV cross-linking and immunoprecipitation) was introduced7,8. CLIP combines UV cross-linking of proteins and RNA molecules with rigorous purification schemes including denaturing polyacrylamide gel electrophoresis. In combination with high-throughput sequencing technologies, CLIP has proven as a powerful tool to study protein-RNA interactions on a genome-wide scale (referred to as HITS-CLIP or CLIP-seq)9,10. Recently, PAR-CLIP was introduced that uses photoreactive ribonucleoside analogs for cross-linking11,12.
Despite the high specificity of the obtained data, CLIP experiments often generate cDNA libraries of limited sequence complexity. This is partly due to the restricted amount of co-purified RNA and the two inefficient RNA ligation reactions required for library preparation. In addition, primer extension assays indicated that many cDNAs truncate prematurely at the crosslinked nucleotide13. Such truncated cDNAs are lost during the standard CLIP library preparation protocol. We recently developed iCLIP (individual-nucleotide resolution CLIP), which captures the truncated cDNAs by replacing one of the inefficient intermolecular RNA ligation steps with a more efficient intramolecular cDNA circularization (Figure 1)14. Importantly, sequencing the truncated cDNAs provides insights into the position of the cross-link site at nucleotide resolution. We successfully applied iCLIP to study hnRNP C particle organization on a genome-wide scale and assess its role in splicing regulation14.

The spatial arrangement of RNA-binding proteins on a transcript is a key determinant of post-transcriptional regulation. Therefore, we developed individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) that allows precise genome-wide mapping of the binding sites of an RNA-binding protein.

The unique composition and spatial arrangement of RNA-binding proteins (RBPs) on a transcript guide the diverse aspects of post-transcriptional ...

Method for the Isolation and Identification of mRNAs, microRNAs and Protein Components of Ribonucleoprotein Complexes from Cell Extracts using RIP-Chip

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and readily available form of data collection. In many research and disease models however, steady state levels of target gene mRNA does not always directly correlate with steady state protein levels. Post-transcriptional gene regulation is a likely explanation of the divergence between the two. Driven by the binding of RNA Binding Proteins (RBP), post-transcriptional regulation affects mRNA localization, stability and translation by forming a Ribonucleoprotein (RNP) complex with target mRNAs. Identifying these unknown de novo mRNA targets from cellular extracts in the RNP complex is pivotal to understanding mechanisms and functions of the RBP and their resulting effect on protein output. This protocol outlines a method termed RNP immunoprecipitation-microarray (RIP-Chip), which allows for the identification of specific mRNAs associated in the ribonucleoprotein complex, under changing experimental conditions, along with options to further optimize an experiment for the individual researcher. With this important experimental tool, researchers can explore the intricate mechanisms associated with post-transcriptional gene regulation as well as other ribonucleoprotein interactions.

A step by step protocol to isolating and identifying RNA associated complexes through RIP-Chip.

As a result of the development of high-throughput sequencing and efficient microarray analysis, global gene expression analysis has become an easy and ...