Name: in-nucleus hi-c in drosophila cells
Uploaded: 2021-09-15T15:00:00
Description: Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

وقد دعم هذا العمل برنامج دعم التكنولوجيا والبحوث التابع للبعثة رقم المنحة IN207319 ورقم منحة المجلس الوطني للعلوم والتكنولوجيا (CONACyT-FORDECyT) 303068. أ.إ.ل. هو طالب ماجستير بدعم من المجلس الوطني للعلوم والتكنولوجيا (كوناسي) رقم CVU 968128.

1. التثبيت
<ol><li>ابدأ بخلايا 10 ملايين شنايدر +S2R+) لإعداد 17.5 مل من تعليق الخلية في شنايدر المتوسط الذي يحتوي على 10٪ مصل البقر الجنيني (FBS) في درجة حرارة الغرفة (RT).</li>
	<li>إضافة الفورمالديهايد خالية من الميثانول للحصول على تركيز النهائي من 2٪. مزيج واحتضان لمدة 10 دقيقة في RT، مع الحرص على خلط كل دقي?...

<ol>
	<li>Cremer, T., Cremer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+territories,+nuclear+architecture+and+gene+regulation+in+mammalian+cells.">Chromosome territories, nuclear architecture and gene regulation in mammalian cells.</a> Nature Review Genetics. 2, 292-301 (2001).</li><li>Lieberman-Aiden, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+mapping+of+long-range+interactions+reveals+folding+principles+of+the+human+genome.">Comprehensive mapping of long-range interactions reveals folding principles of the human genome.</a> Science. 326, 289-293 (2009).</li><li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485, 376-380 (2012).</li><li>Sexton, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+folding+and+functional+organization+principles+of+the+Drosophila+genome.">Three-dimensional folding and functional organization principles of the Drosophila genome.</a> Cell. 148 (3), 458-472 (2012).</li><li>Dixon, J. R., Gorkin, D. U., Ren, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+domains:+the+unit+of+chromosome+organization.">Chromatin domains: the unit of chromosome organization.</a> Molecular Cell. 62, 668-680 (2016).</li><li>Bonev, B., Cavalli, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+and+function+of+the+3D+genome.">Organization and function of the 3D genome.</a> Nature Reviews Genetics. 17, 661-678 (2016).</li><li>Lupi&#225;&#241;ez, D. G., Spielmann, M., Mundlos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+TADs:+how+alterations+of+chromatin+domains+result+in+disease.">Breaking TADs: how alterations of chromatin domains result in disease.</a> Trends in Genetics. 32, 225-237 (2016).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Hong, S., Kim, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+characterization+of+chromatin+domain+boundary-associated+genomic+elements.">Computational characterization of chromatin domain boundary-associated genomic elements.</a> Nucleic Acids Research. 45, 10403-10414 (2017).</li><li>Zuin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cohesin+and+CTCF+differentially+affect+chromatin+architecture+and+gene+expression+in+human+cells.">Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).</li><li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer/promoter+function.">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162, 900-910 (2015).</li><li>Lupi&#225;&#241;ez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161, 1012-1025 (2015).</li><li>Van-Steensel, B., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+transcription+in+shaping+the+spatial+organization+of+the+genome.">The role of transcription in shaping the spatial organization of the genome.</a> Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).</li><li>Merkenschlager, M., Nora, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+in+genome+folding+and+transcriptional+gene+regulation.">CTCF and cohesin in genome folding and transcriptional gene regulation.</a> Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).</li><li>Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+regulate+chromatin+loop+stability+with+distinct+dynamics.">CTCF and cohesin regulate chromatin loop stability with distinct dynamics.</a> Elife. 6, 1-10 (2017).</li><li>Van Bortle, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulator+function+and+topological+domain+border+strength+scale+with+architectural+protein+occupancy.">Insulator function and topological domain border strength scale with architectural protein occupancy.</a> Genome Biology. 15, 82 (2014).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ulianov, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+chromatin+and+transcription+play+a+key+role+in+chromosome+partitioning+into+topologically+associating+domains.">Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains.</a> Genome Research. 26, 70-84 (2016).</li><li>Rowley, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+conserved+principles+predict+3D+chromatin+organization.">Evolutionarily conserved principles predict 3D chromatin organization.</a> Molecular Cell. 67, 837-852 (2017).</li><li>Gavrilov, A. A., Golov, A. K., Razin, S. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actual+ligation+frequencies+in+the+chromosome+conformation+capture+procedure.">Actual ligation frequencies in the chromosome conformation capture procedure.</a> PLoS One. 8, 60403 (2013).</li><li>Gavrilov, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disclosure+of+a+structural+milieu+for+the+proximity+ligation+reveals+the+elusive+nature+of+an+active+chromatin+hub.">Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub.</a> Nucleic Acids Research. 41, 3563-3575 (2013).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+Hi-C+reveals+cell-to-cell+variability+in+chromosome+structure.">Single-cell Hi-C reveals cell-to-cell variability in chromosome structure.</a> Nature. 502, 59-64 (2013).</li><li>Rao, S. S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+3D+map+of+the+human+genome+at+kilobase+resolution+reveals+principles+of+chromatin+looping.">A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping.</a> Cell. 159 (7), 1665-1680 (2014).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Hi-C+results+using+in-solution+versus+in-nucleus+ligation.">Comparison of Hi-C results using in-solution versus in-nucleus ligation.</a> Genome Biology. 16, 175 (2015).</li><li>Arzate-Mej&#237;a, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+dissection+of+domain+boundaries+affect+genome+topology+and+gene+transcription+in+Drosophila.">In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila.</a> Nature Communications. 11, 894 (2020).</li><li>Schoenfelder, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter+capture+Hi-C:+high-resolution,+genome-wide+profiling+of+promoter+interactions.">Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions.</a> Journal of Visualized Experiments. (136), e57320 (2018).</li><li>Servant, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiC-Pro:+an+optimized+and+flexible+pipeline+for+Hi-C+processing.">HiC-Pro: an optimized and flexible pipeline for Hi-C processing.</a> Genome Biology. 16, 259 (2015).</li><li>Philip, E., M&#229;ns, M., Sverker, L., Max, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MultiQC:+Summarize+analysis+results+for+multiple+tools+and+samples+in+a+single+report.">MultiQC: Summarize analysis results for multiple tools and samples in a single report.</a> Bioinformatics. 10, 1093 (2016).</li><li>Wingett, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCUP:+pipeline+for+mapping+and+processing+Hi-C+data.">HiCUP: pipeline for mapping and processing Hi-C data.</a> F1000 Research. 4, 1310 (2015).</li><li>Imakaev, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+correction+of+Hi-C+data+reveals+hallmarks+of+chromosome+organization.">Iterative correction of Hi-C data reveals hallmarks of chromosome organization.</a> Nature Methods. 9 (10), 999-1003 (2012).</li><li>Akdemir, K. C., Chin, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCPlotter+integrates+genomic+data+with+interaction+matrices.">HiCPlotter integrates genomic data with interaction matrices.</a> Genome Biolog. 16, 198 (2015).</li><li>Ramirez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ando-Kuri, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+global+and+promoter-centric+3D+genome+organization+temporally+resolved+during+a+circadian+cycle.">The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle.</a> bioRxiv. , (2020).</li><li>Cuellar-Partida, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+priors+for+identifying+active+transcription+factor+binding+sites.">Epigenetic priors for identifying active transcription factor binding sites.</a> Bioinformatics. 28 (1), 56-62 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biology. 9, 137 (2008).</li><li>Ong, C. -. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+regulates+insulator+function+and+intrachromosomal+interactions+in+Drosophila.">Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila.</a> Cell. 155 (1), 148-159 (2013).</li><li>Fres&#225;n, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insulator+protein+CTCF+regulates+Drosophila+steroidogenesis.">The insulator protein CTCF regulates Drosophila steroidogenesis.</a> Biology Open. 4 (7), 852-857 (2015).</li><li>Quinodoz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+promotes+the+formation+of+spatial+compartments+in+the+nucleus.">RNA promotes the formation of spatial compartments in the nucleus.</a> Cell. 174, 744-757 (2018).</li><li>Olivares-Chauvet, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+pairwise+and+multi-way+chromosomal+conformations+using+chromosomal+walks.">Capturing pairwise and multi-way chromosomal conformations using chromosomal walks.</a> Nature. 540 (7632), 296-300 (2016).</li><li>Beagrie, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+multi-enhancer+contacts+captured+by+genome+architecture+mapping.">Complex multi-enhancer contacts captured by genome architecture mapping.</a> Nature. 543, 519-524 (2017).</li><li>Redolfi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DamC+reveals+principles+of+chromatin+folding+in+vivo+without+crosslinking+and+ligation.">DamC reveals principles of chromatin folding in vivo without crosslinking and ligation.</a> Nature Structural and Molecular Biology. 26, 471-480 (2019).</li><li>Maxwell, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiChIP:+efficient+and+sensitive+analysis+of+protein-directed+genome+architecture.">HiChIP: efficient and sensitive analysis of protein-directed genome architecture.</a> Nature Methods. 13, 919-922 (2016).</li><li>Gao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-BERST:+Defining+subnuclear+proteomic+landscapes+at+genomic+elements+with+dCas9-APEX2.">C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2.</a> Nature Methods. 15 (6), 433-436 (2018).</li></ol>

وقد سمحت طريقة Hi-C في النواة المعروضة هنا بالاستكشاف التفصيلي لطبولوجيا الجينوم Drosophila بدقة عالية ، مما يوفر رؤية للتفاعلات الجينومية على نطاقات جينومية مختلفة ، من حلقات الكروماتين بين العناصر التنظيمية مثل المروجين والمحسنات إلى TADs وتحديد المقصورة الكبيرة25. كما تم تطبيق نف...

في eukaryotes ، يتم تقسيم الجينوم إلى كروموسومات تحتل مناطق محددة في الفضاء النووي خلال مرحلة ما بين المراحل1. يمكن تقسيم الكروماتين الذي يشكل الكروموسومات إلى ولايتين رئيسيتين: واحدة من الكروماتين الذي يمكن الوصول إليه والمتساهل نسخيا ، والآخر من الكروماتين المضغوط القمعي النسخي. هذه الدول الكروماتين فصل ونادرا ما تختلط في الفضاء النووي، وتشكيل اثنين من مقصورات متميزة في النواة2. على مقياس قاعدة تحت megabase، حدود مجالات منفصلة من التفاعلات الكروماتين عالية التردد، ودعا TADs، التي علامة المنظمة الكروموسومية3،4،5. في الثدييات، وتحتل حدود TAD من قبل عامل التماسك وCCTC ملزمة (CTCF)6،7،8. المجمع التماسك ينقذ الكروماتين وتوقف في مواقع الربط CTCF التي يتم التخلص منها في اتجاه متقارب في تسلسل الجينوم لتشكيل حلقات الكروماتين مستقرة9،10،13،14. اضطراب وراثي من موقع ربط الحمض النووي CTCF عند الحدود أو الحد من CTCF ووفرة البروتين التماسك النتائج في تفاعلات غير طبيعية بين العناصر التنظيمية، وفقدان تشكيل TAD، والتعبير الجيني إلغاء الضوابطالتنظيمية 9،10،11،13،14.
في Drosophila ، تحتل الحدود بين TADs العديد من APs ، بما في ذلك عامل عنصر الحدود المرتبط 32 kDa (BEAF-32) ، Motif 1 بروتين ملزم (M1BP) ، بروتين سنتروسومي 190 (CP190) ، مثبط للأجنحة المشعرة (SuHW) ، و CTCF ، ويتم إثراء في تعديلات الهستون النشطة وبوليميراز الثاني16،17،18. وقد اقترح أن في Drosophila، TADs تظهر نتيجة للنسخ13،17،19، والدور الدقيق لAPs مستقلة في تشكيل الحدود وخصائص العزل لا يزال قيد التحقيق. وبالتالي، ما إذا كانت المجالات في دروسوفيلا هي نتيجة وحيدة لتجميع مناطق من الدول النسخية المماثلة أو ما إذا كانت الجهات الراعية، بما في ذلك لجنة مكافحة الإرهاب، تساهم في تشكيل الحدود، لا تزال غير مميزة تماما. وقد أمكن استكشاف الاتصالات الجينومية بدقة عالية من خلال تطوير تكنولوجيات التقاط تكوين الكروموسومات إلى جانب تسلسل الجيل التالي. وصف بروتوكول Hi-C لأول مرة مع خطوة الربط التي أجريت "في الحل" 2 فيمحاولة لتجنب منتجات الربط الزائفة بين شظايا الكروماتين. ومع ذلك، أشارت العديد من الدراسات إلى إدراك أن الإشارة المفيدة في البيانات جاءت من منتجات الربط التي تشكلت في نواة مشقوقة جزئيا لم تكن في الحل20،21.
ثم تم تعديل البروتوكول لتنفيذ الربط داخل النواة كجزء من تجربة Hi-C أحادية الخلية22. تم دمج بروتوكول Hi-C في النواة لاحقا في مجموعة الخلايا Hi-C لتحقيق تغطية أكثر اتساقا على النطاق الكامل للمسافات الجينومية وإنتاج بيانات ذات ضوضاء تقنية أقل23و24. ويستند البروتوكول، الموصوف بالتفصيل هنا، على السكان في النواة مرحبا-C بروتوكول23،24، وكان يستخدم للتحقيق في عواقب إزالة وراثيا زخارف الحمض النووي ملزمة لC CTCF و M1BP من حدود المجال في مكان الجين نوتش في Drosophila25. تظهر النتائج أن تغيير الزخارف الملزمة للحمض النووي ل APs عند الحدود له عواقب وخيمة على تكوين نطاق Notch ، وعيوب طوبولوجية أكبر في المناطق المحيطة بموضع Notch ، وإلغاء تحرير التعبير الجيني. وهذا يشير إلى أن العناصر الوراثية عند حدود المجال مهمة للحفاظ على طبولوجيا الجينوم والتعبير الجيني في Drosophila25.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% (vol/vol) paraformaldehyde solution</td>
			<td>Agar Scientific</td>
			<td>R1026</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin-14-dATP</td>
			<td>Invitrogen</td>
			<td>CA1524-016</td>
			<td></td>
		</tr>
		<tr>
			<td>ClaI enzyme</td>
			<td>NEB</td>
			<td>R0197S</td>
			<td></td>
		</tr>
		<tr>
			<td>COVARIS Ultrasonicator</td>
			<td>Covaris</td>
			<td>LE220-M220</td>
			<td></td>
		</tr>
		<tr>
			<td>Cut Smart</td>
			<td>NEB</td>
			<td>B72002S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM) 1x</td>
			<td>Life Technologies</td>
			<td>41965-039</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptabidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS) sterile filtered</td>
			<td>Sigma</td>
			<td>F9665</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow Dna PolI large fragment</td>
			<td>NEB</td>
			<td>M0210L</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow exo(-)</td>
			<td>NEB</td>
			<td>M0210S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Buffer</td>
			<td>NEB</td>
			<td>B020S</td>
			<td></td>
		</tr>
		<tr>
			<td>MboI enzyme</td>
			<td>NEB</td>
			<td>R0147M</td>
			<td></td>
		</tr>
		<tr>
			<td>NP40-Igepal</td>
			<td>SIGMA</td>
			<td>CA-420</td>
			<td>Non-ionic surfactant for addition in lysis buffer</td>
		</tr>
		<tr>
			<td>PE adapter 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-P-GATCGGAAGAGCGGTTCAGCAG 
			GAATGCCGAG-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE adapter 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-ACACTCTTTCCCTACACGACGCT 
			CTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-AATGATACGGCGACCACCGAGAT 
			CTACACTCTTTCCCTACACGACG 
			CTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-CAAGCAGAAGACGGCATACGAG 
			ATCGGTCTCGGCATTCCTGCTGA 
			ACCGCTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol: Chloroform:Isoamyl Alcohol 25:24:1</td>
			<td>SIGMA</td>
			<td>P2069</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 1 (known interaction, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-TCGCGGTAATTTTGCGTTTGA-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 2 (known interactions, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-CCTCCCTGCCAAAACGTTTT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail tablet</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Roche</td>
			<td>3115879001</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit</td>
			<td>ThermoFisher</td>
			<td>Q33327</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse</td>
			<td>Roche</td>
			<td>10109142001</td>
			<td></td>
		</tr>
		<tr>
			<td>SPRI Beads</td>
			<td>Beckman</td>
			<td>B23318</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen</td>
			<td>15224-025</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 polynucleotide kinase (PNK)&#160;</td>
			<td>NEB</td>
			<td>M0201L</td>
			<td></td>
		</tr>
		<tr>
			<td>TaqPhusion</td>
			<td>NEB</td>
			<td>M0530S</td>
			<td>DNA polymerase</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td></td>
			<td></td>
			<td>Non-ionic surfactant for quenching of SDS</td>
		</tr>
	</tbody>
</table>

in-nucleus hi-c in drosophila cells

يتم تنظيم الجينوم في مجالات ربط طوبولوجية (TADs) محددة بحدود تعزل التفاعلات بين المجالات. وفي دروسوفيلا، لا تزال الآليات الكامنة وراء تكوين هذا المرض وحدوده قيد التحقيق. ساعد تطبيق طريقة Hi-C في النواة الموصوفة هنا على تشريح وظيفة مواقع الربط للبروتين المعماري (AP) عند حدود TAD التي تعزل جين Notch. يؤدي التعديل الوراثي لحدود النطاقات التي تسبب فقدان APs إلى دمج TAD ، والعيوب النسخية ، والتعديلات الطوبولوجية طويلة المدى. وقدمت هذه النتائج أدلة تثبت مساهمة العناصر الوراثية في تكوين حدود النطاق والتحكم في التعبير الجيني في دروسوفيلا. هنا، تم وصف طريقة Hi-C في النواة بالتفصيل، والتي توفر نقاط تفتيش مهمة لتقييم جودة التجربة جنبا إلى جنب مع البروتوكول. كما تظهر الأعداد المطلوبة من قراءات التسلسل وأزواج Hi-C الصالحة لتحليل التفاعلات الجينومية على نطاقات جينومية مختلفة. ويمكن أن يكون التحرير الجيني بوساطة CRISPR/Cas9 للعناصر التنظيمية والتنميط عالي الاستبانة للتفاعلات الجينية باستخدام هذا البروتوكول Hi-C في النواة مزيجا قويا للتحقيق في الوظيفة الهيكلية للعناصر الوراثية.

فيما يلي نتائج بروتوكول Hi-C ناجح (راجع ملخص سير عمل بروتوكول Hi-C في الشكل 1A). هناك العديد من نقاط مراقبة الجودة خلال تجربة Hi-C في النواة. تم جمع عينة aliquots قبل (UD) وبعد (D) خطوة تقييد الكروماتين وكذلك بعد الربط (L). تم عكس الوصلات المتقاطعة، وتم تنقية الحمض النووي وتشغيله على هلام ال?...

Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

In-Nucleus Hi-C in Drosophila Cells

يتم تنظيم الجينوم في الفضاء النووي في هياكل مختلفة يمكن الكشف عنها من خلال تقنيات التقاط تكوين الكروموسومات. توفر طريقة Hi-C في النواة مجموعة على مستوى الجينوم من تفاعلات الكروماتين في خطوط خلايا Drosophila ، والتي تولد خرائط اتصال يمكن استكشافها بدقة megabase على مستوى جزء التقييد.

في النواة مرحبا C في خلايا دروسوفيلا

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, ...

تسمح بروتوكولات النواة Hi-C باستكشاف التأكيد الكروموسومي بدقة مختلفة لتوصيف حلقات الكروماتين والمجالات والمقصورة التي تنظم الجينوم. يوفر هذا البروتوكول توصيفا عالي الدقة للتفاعلات الجينومية على نطاقات مختلفة ، مما يؤدي إلى تغطية أكثر اتساقا على النطاق الكامل للمسافات الجينية والبيانات ذات الضوضاء التقنية الأقل. الجمع بين هذا البروتوكول والتحرير الجيني هو استراتيجية قوية لاختبار الوظيفة الهيكلية للعناصر الوراثية.ويمكن أيضا أن يطبق على توصيف الاختلافات الهيكلية التي تؤدي إلى المرض. يمكن تطبيق بروتوكول النواة Hi-C لاستكشاف تنظيم الجينوم لأي جينوم يوكاريوتيك. يقوم القيام بعلاج SDS وTriton بتصنيف أي كتل نووية عن طريق الأنابيب حيث تتداخل المجاميع مع كفاءة التفاعل الأنزيمي ، وتأكد من تنفيذ مقياس ضوابط الجودة المناسب قبل التسلسل.ابدأ بإضافة الفورمالديهايد الخالي من الميثانول إلى مرة واحدة 10 إلى خلايا شنايدر السبعة الخط 2 بالإضافة إلى Drosophila في 17.5 ملليلتر من شنايدر المتوسطة تكملها 10٪ FBS إلى تركيز نهائي من 2٪ احتضان الخلايا لمدة 10 دقائق في درجة حرارة الغرفة مع خلط كل 60 ثانية أو على عجلة دوارة، وإضافة الجليسين إلى تركيز النهائي من 0.125 الضرس مع خلط. بعد خمس دقائق في درجة حرارة الغرفة و 15 دقيقة على الجليد، وجمع الخلايا عن طريق الطرد المركزي وإعادة إنفاق بعناية بيليه في 25 ملليلتر من برنامج تلفزيوني الباردة وجمع الخلايا مع جهاز طرد مركزي آخر. في نهاية الطرد المركزي، إعادة إنفاق الخلايا في ملليلتر واحد من الجليد الباردة تحلل العازلة لعد وضبط الخلايا إلى واحد مرة 10 إلى ست خلايا لكل تركيز ملليلتر.احتضان الخلايا على الجليد لمدة 30 دقيقة، عكس الأنبوب كل دقيقتين لخلط وجمع الخلايا مع جهاز طرد مركزي آخر. Resuspend بيليه في ملليلتر واحد من الجليد الطازج الباردة تحلل العازلة. بعد الطرد المركزي، اغسل اليزلات بمليلتر واحد من المخزن المؤقت للقيود 1.25X.الطرد المركزي مرة أخرى لجمع lysate. Resuspend بيليه في 360 ميكرولتر من العازلة تقييد جديدة و 11 ميكرولتر من 10٪ SDS مع الأنابيب بعناية واحتضان لمدة 45 دقيقة في 37 درجة مئوية و 7 إلى 950 الثورات في الدقيقة الواحدة مع pipetting عرضية. في نهاية الحضانة ، أوقف البيرمابيليشن مع 75 ميكرولتر من السطحي غير الأيونية وأرجع الأنبوب إلى الحاضنة لمدة 45 دقيقة إضافية مع الاهتزاز في 950 ثورة في الدقيقة مع الأنابيب العرضية.بالنسبة لهضم الكروماتين، أضف 200 وحدة من Mbo1 إلى الأنبوب لاحتضان لمدة أربع إلى 16 ساعة عند 37 درجة مئوية مع الدوران. في نهاية الحضانة ، تعطيل الانزيم مع حضانة لمدة 20 دقيقة في 60 درجة مئوية. لملء جزء تقييد يتدلى وتسمية الحمض النووي ينتهي مع البيوتين، إضافة 1.5 ميكرولتر كل من 10 ملليمولار dCTP، dGTP، dTTP، 20 ميكرولتر من 0.4 ملليمولار البيوتين dATP، 17.5 ميكرولتر من ثلاثي منخفض EDTA العازلة، و 10 ميكرولتر من خمس وحدات لكل ميكرولتر من DNAase جزء واحد كبير إلى الأنبوب مع خلط دقيق.احتضان رد الفعل لمدة 75 دقيقة في 37 درجة مئوية مع اهتزاز في 700 ثورة في الدقيقة كل 10 ثوان لمدة 30 ثانية. في نهاية الحضانة، أضف مزيج الربط إلى الكروماتين وضبطه على حجم تفاعل نهائي واحد ملليلتر مع خلط لطيف وشامل واحتضان بين عشية وضحاها في 16 درجة مئوية. لإضعاف عينة البروتينات، أضف 50 ميكرولتر من 10 ملليغرام لكل ملليلتر بروتيناز K إلى الأنبوب لاحتضان لمدة ساعتين عند 37 درجة مئوية.في نهاية الحضانة، قم بزيادة درجة الحرارة إلى 65 درجة مئوية بين عشية وضحاها لعكس الربط المتبادل للعينة. في صباح اليوم التالي، تتحلل الجيش الملكي النيبالي مع 10 ميكرولتر من 10 ملليغرام لكل ملليلتر RNAAse A.After ساعة واحدة في 37 درجة مئوية، إضافة حجم واحد من الكلوروفورم الفينول إلى الأنبوب ومزيج تماما عن طريق عكس للحصول على مرحلة بيضاء متجانسة. بعد التعجيل بالحمض النووي وفقا للبروتوكولات القياسية ، قم بتحديد الحمض النووي باستخدام صبغة فلورية ترتبط بشكل انتقائي بالحمض النووي ومقياس الفلور وفقا لتعليمات الشركة المصنعة.لتنقية الحمض النووي من aliquots غير المهضوم والمهضوم ، قم بتحميل 100 نانوجرام من العينات غير المهضومة والهضمية والمربطة على هلام agarose بنسبة 1.5٪ والبحث عن مسحة تركزت حول 500 زوج أساسي في العينة المهضومة مقابل نطاق وزن جزيئي مرتفع للعينة المربطة. للتحقق من كفاءة وضع العلامات وربط مرحبا جيم عن طريق تضخيم وهضم تفاعل معروف، بعد PCR، هضم المنتجات مع Mbo1، Cla1، أو كليهما، وتشغيل العينات على هلام 1.5 إلى 2٪ جديدة للسماح بتقدير العدد النسبي للتقاطعات ربط 3C ومرحبا C. بعد sonicating العينة للحصول على 200 إلى 500 شظايا الحمض النووي زوج قاعدة، نقل 130 ميكرولتر مع خمسة ميكروغرام من الحمض النووي من كل عينة إلى أنابيب جديدة للطرد المركزي الدقيق تحتوي على 16 ميكرولتر من العازلة ربط 10X، واثنين من ميكرولتر من 10 ملليمولار dATP، وخمسة ميكرولترات من T4 بوليمرات الحمض النووي، وسبعة ميكرولتر من الماء المقطر المزدوج لاحتضان لمدة 30 دقيقة في 20 درجة مئوية.في نهاية الحضانة ، أضف خمسة ميكرولترات من 10 ملليمولار dNTPs ، وأربعة ميكرولترات من حاجز الربط 10X ، وخمسة ميكرولترات من T4 polynucleotide kinase ، وميكرويلتر واحد من بوليمرات الحمض النووي جزء كبير واحد ، و 25 ميكرولتر من الماء المقطر المزدوج إلى الأنابيب لاحتضان ثاني لمدة 30 دقيقة عند 20 درجة مئوية. لتحديد شظايا معظمها في نطاق حجم الزوج قاعدة 250-550، أداء مرحلة صلبة متتالية عكسها واختيار حجم التعبئة مع 0.6X، ثم 0.9X وفقا لتعليمات الشركة المصنعة وeeute الحمض النووي مع 100 ميكرولتر من EDTA تريس منخفضة. لسحب البيوتين لكل مكتبة، اغسل 150 ميكرولتر من الخرز المغناطيسي المرتبط بستريبتافيدين مرتين مع 400 ميكرولتر من العازلة توين 1X وتدوير العينات لمدة ثلاث دقائق على عجلة دوارة.في نهاية الحضانة ، وإعادة إنفاق الخرز في 300 ميكرولتر من 2X لا توين العازلة ومزيج مع 300 ميكرولتر من المواد مرحبا جيم لدوران لمدة 30 دقيقة على عجلة دوارة. في نهاية الحضانة ، اغسل الخرز ب 400 ميكرولتر من 0.5X Tween العازلة لاحتضان لمدة ثلاث دقائق عند 55 درجة مئوية و 750 ثورة في الدقيقة ، تليها غسلتان في 200 ميكرولتر من حاجز تقييد 1X لكل غسلة. بعد الغسيل الثاني ، أعيد إنفاق الخرز في 100 ميكرولتر من مزيج مخلفات dATP لاحتضان لمدة 30 دقيقة عند 37 درجة مئوية.في نهاية الحضانة ، وإعادة إنفاق الخرز في 50 ميكرولتر من العازلة ربط 1X ونقل التعليق إلى أنبوب جديد يحتوي على أربعة microliters قبل مهايئات نهاية متجاورة واثنين من microliters من ليغاني T4. بعد ساعتين في درجة حرارة الغرفة، وإزالة supernatant وغسل الخرز مرتين مع 400 ميكرولتر من العازلة توين، ثم غسل الخرز مرة واحدة مع 200 ميكرولتر من أي العازلة توين ومرة واحدة مع 100 ميكرولتر من العازلة تقييد قبل إعادة تعليق الخرز في 40 ميكرولتر من العازلة تقييد 1X. يتم ملاحظة مسحة من 200 إلى 1000 زوج أساسي عند نجاح التقييد مع Mbo1.إذا نجح الربط ، لوحظ وجود نطاق عالي الوزن الجزيئي في الجزء العلوي من الجل. ويمكن أيضا تأكيد كفاءة الهضم من خلال PCR الكمية. كفاءة الهضم المقبولة هي 80٪ أو أعلى.كما هو موضح، يمكن تقدير تضخيم تفاعل متوسط المدى معروف في منتجات ربط Hi-C عن طريق هضم منتج PCR المسترد في التضخيم. يوصى بكفاءة هضم أكثر من 70٪ لتجنب وجود نسبة كبيرة من القراءات غير المفيدة للمكتبات بعد التسلسل. يجب أن يكون عدد دورات PCR للتضخيم النهائي دورة واحدة أقل من عدد الدورات التي تكون اللطاخة مرئية لها.يشير مستوى هضم المكتبة إلى وفرة أزواج Hi-C الصالحة ويعكس نسبة القراءات المفيدة التي سيتم الحصول عليها من المكتبة. باستخدام أزواج Hi-C الصالحة الفريدة، يمكن إجراء التحليل الأساسي لتوزيع الزوج. كما لوحظ في هذا المثال التمثيلي ، يمكن رؤية الموضع الجيني NOTCH جنبا إلى جنب مع البروتينات المعمارية ، والنطاقين الأول والاثنين ، وتعديلات الهستون على طول الموضع.عند حذف المنطقة التي تحتوي على كل من موقعي ربط الحمض النووي CTCF و M1BP ، يمكن ملاحظة تغيير كبير في اتصالات الكروماتين. بعد تجربة Hi-C، يمكن إجراء عملية للوصول إلى مجموعة محددة من جهات الاتصال، على سبيل المثال، من مناطق المروج. وهذا مفيد بشكل خاص عند تقييم الجينوم الكبير.وكما هو موضح، يمكن استخدام الجمع بين بروتوكول Hi-C والإضافة الجينية لتقييم الوظيفة الهيكلية والتنظيمية للعناصر الجينومية.

Research

JoVE Journal

Genetics

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

في الموقع وصفها من الحمض النووي النسخ المتماثل في ذبابة الفاكهة الكبار المبايض عن طريق ايدو تلطيخ

The mitochondrial genome is inherited exclusively through the maternal line. Understanding of how the mitochondrion and its genome are proliferated and ...

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Quantifying Abdominal Pigmentation in Drosophila melanogaster

قياس التصبغ البطن في<em&gt; ذبابة الفاكهة ميلانوغاستر</em

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

مروج التقاط مرحبا c: عالية الاستبانة، وعلى نطاق الجينوم التنميط التفاعلات المروج

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

Purification of Low-abundant Cells in the Drosophila Visual System

تنقية الخلايا منخفض وفيرة في النظام المرئي المورفولوجية

Recent improvements in the sensitivity of next generation sequencing have facilitated the application of transcriptomic and genomic analyses to small ...

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

في فيفو دراسة وظيفية من المتغيرات البشرية النادرة المرتبطة بالأمراض باستخدام دروسوفيلا

Advances in sequencing technology have made whole-genome and whole-exome datasets more accessible for both clinical diagnosis and cutting-edge human ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

في فيفو إلى الأمام الشاشة الوراثية لتحديد الجينات العصبية الجديدة في دروسوفيلا melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Use of Drosophila S2 Cells for Live Imaging of Cell Division

استخدام خلايا Drosophila S2 للتصوير الحي لقسم الخلايا

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

التحقيق في الدور النسخي لـ RUNX1 كاتم الصوت من قبل كريسبر/كاس9 ريبونوكليوبروتين في خلايا سرطان الدم النقوي الحاد

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

بروتوكول يستند إلى FACS لعزل الحمض النووي الريبي من الخلايا الثانوية للغدد التبعي الذكور Drosophila

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...

Detection of Post-Replicative Gaps Accumulation and Repair in Human Cells Using the DNA Fiber Assay

الكشف عن تراكم الفجوات بعد التكرار وإصلاحها في الخلايا البشرية باستخدام فحص ألياف الحمض النووي

The DNA fiber assay is a simple and robust method for the analysis of replication fork dynamics, based on the immunodetection of nucleotide analogs that ...