Name: in-nucleus hi-c in drosophila cells
Uploaded: 2021-09-15T15:00:00
Description: Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

עבודה זו נתמכה על ידי תוכנית התמיכה הטכנולוגית והמחקרית של UNAM (PAPIIT) במספר מענקים בשנת 207319 ובמועצה הלאומית למדע וטכנולוגיה (CONACyT-FORDECyT) מספר מענק 303068. א.א.ל. הוא סטודנט לתואר שני הנתמך על ידי המועצה הלאומית למדע וטכנולוגיה (CONACyT) מספר CVU 968128.

1. קיבעון
<ol><li>התחל עם 10 מיליון תאי קו 2 פלוס (S2R+) של שניידר כדי להכין 17.5 מ"ל של השעיית תא במדיום שניידר המכיל 10% סרום בקר עוברי (FBS) בטמפרטורת החדר (RT).</li>
	<li>הוסף פורמלדהיד ללא מתנול כדי להשיג ריכוז סופי של 2%. מערבבים ודגרה במשך 10 דקות ב RT, דואג לערבב כל דקה. הערה: פורמלדהיד הוא כימיקל מסוכן. פעל ?...

<ol>
	<li>Cremer, T., Cremer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+territories,+nuclear+architecture+and+gene+regulation+in+mammalian+cells.">Chromosome territories, nuclear architecture and gene regulation in mammalian cells.</a> Nature Review Genetics. 2, 292-301 (2001).</li><li>Lieberman-Aiden, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+mapping+of+long-range+interactions+reveals+folding+principles+of+the+human+genome.">Comprehensive mapping of long-range interactions reveals folding principles of the human genome.</a> Science. 326, 289-293 (2009).</li><li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485, 376-380 (2012).</li><li>Sexton, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+folding+and+functional+organization+principles+of+the+Drosophila+genome.">Three-dimensional folding and functional organization principles of the Drosophila genome.</a> Cell. 148 (3), 458-472 (2012).</li><li>Dixon, J. R., Gorkin, D. U., Ren, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+domains:+the+unit+of+chromosome+organization.">Chromatin domains: the unit of chromosome organization.</a> Molecular Cell. 62, 668-680 (2016).</li><li>Bonev, B., Cavalli, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+and+function+of+the+3D+genome.">Organization and function of the 3D genome.</a> Nature Reviews Genetics. 17, 661-678 (2016).</li><li>Lupi&#225;&#241;ez, D. G., Spielmann, M., Mundlos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+TADs:+how+alterations+of+chromatin+domains+result+in+disease.">Breaking TADs: how alterations of chromatin domains result in disease.</a> Trends in Genetics. 32, 225-237 (2016).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Hong, S., Kim, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+characterization+of+chromatin+domain+boundary-associated+genomic+elements.">Computational characterization of chromatin domain boundary-associated genomic elements.</a> Nucleic Acids Research. 45, 10403-10414 (2017).</li><li>Zuin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cohesin+and+CTCF+differentially+affect+chromatin+architecture+and+gene+expression+in+human+cells.">Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).</li><li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer/promoter+function.">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162, 900-910 (2015).</li><li>Lupi&#225;&#241;ez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161, 1012-1025 (2015).</li><li>Van-Steensel, B., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+transcription+in+shaping+the+spatial+organization+of+the+genome.">The role of transcription in shaping the spatial organization of the genome.</a> Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).</li><li>Merkenschlager, M., Nora, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+in+genome+folding+and+transcriptional+gene+regulation.">CTCF and cohesin in genome folding and transcriptional gene regulation.</a> Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).</li><li>Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+regulate+chromatin+loop+stability+with+distinct+dynamics.">CTCF and cohesin regulate chromatin loop stability with distinct dynamics.</a> Elife. 6, 1-10 (2017).</li><li>Van Bortle, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulator+function+and+topological+domain+border+strength+scale+with+architectural+protein+occupancy.">Insulator function and topological domain border strength scale with architectural protein occupancy.</a> Genome Biology. 15, 82 (2014).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ulianov, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+chromatin+and+transcription+play+a+key+role+in+chromosome+partitioning+into+topologically+associating+domains.">Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains.</a> Genome Research. 26, 70-84 (2016).</li><li>Rowley, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+conserved+principles+predict+3D+chromatin+organization.">Evolutionarily conserved principles predict 3D chromatin organization.</a> Molecular Cell. 67, 837-852 (2017).</li><li>Gavrilov, A. A., Golov, A. K., Razin, S. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actual+ligation+frequencies+in+the+chromosome+conformation+capture+procedure.">Actual ligation frequencies in the chromosome conformation capture procedure.</a> PLoS One. 8, 60403 (2013).</li><li>Gavrilov, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disclosure+of+a+structural+milieu+for+the+proximity+ligation+reveals+the+elusive+nature+of+an+active+chromatin+hub.">Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub.</a> Nucleic Acids Research. 41, 3563-3575 (2013).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+Hi-C+reveals+cell-to-cell+variability+in+chromosome+structure.">Single-cell Hi-C reveals cell-to-cell variability in chromosome structure.</a> Nature. 502, 59-64 (2013).</li><li>Rao, S. S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+3D+map+of+the+human+genome+at+kilobase+resolution+reveals+principles+of+chromatin+looping.">A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping.</a> Cell. 159 (7), 1665-1680 (2014).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Hi-C+results+using+in-solution+versus+in-nucleus+ligation.">Comparison of Hi-C results using in-solution versus in-nucleus ligation.</a> Genome Biology. 16, 175 (2015).</li><li>Arzate-Mej&#237;a, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+dissection+of+domain+boundaries+affect+genome+topology+and+gene+transcription+in+Drosophila.">In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila.</a> Nature Communications. 11, 894 (2020).</li><li>Schoenfelder, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter+capture+Hi-C:+high-resolution,+genome-wide+profiling+of+promoter+interactions.">Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions.</a> Journal of Visualized Experiments. (136), e57320 (2018).</li><li>Servant, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiC-Pro:+an+optimized+and+flexible+pipeline+for+Hi-C+processing.">HiC-Pro: an optimized and flexible pipeline for Hi-C processing.</a> Genome Biology. 16, 259 (2015).</li><li>Philip, E., M&#229;ns, M., Sverker, L., Max, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MultiQC:+Summarize+analysis+results+for+multiple+tools+and+samples+in+a+single+report.">MultiQC: Summarize analysis results for multiple tools and samples in a single report.</a> Bioinformatics. 10, 1093 (2016).</li><li>Wingett, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCUP:+pipeline+for+mapping+and+processing+Hi-C+data.">HiCUP: pipeline for mapping and processing Hi-C data.</a> F1000 Research. 4, 1310 (2015).</li><li>Imakaev, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+correction+of+Hi-C+data+reveals+hallmarks+of+chromosome+organization.">Iterative correction of Hi-C data reveals hallmarks of chromosome organization.</a> Nature Methods. 9 (10), 999-1003 (2012).</li><li>Akdemir, K. C., Chin, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCPlotter+integrates+genomic+data+with+interaction+matrices.">HiCPlotter integrates genomic data with interaction matrices.</a> Genome Biolog. 16, 198 (2015).</li><li>Ramirez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ando-Kuri, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+global+and+promoter-centric+3D+genome+organization+temporally+resolved+during+a+circadian+cycle.">The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle.</a> bioRxiv. , (2020).</li><li>Cuellar-Partida, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+priors+for+identifying+active+transcription+factor+binding+sites.">Epigenetic priors for identifying active transcription factor binding sites.</a> Bioinformatics. 28 (1), 56-62 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biology. 9, 137 (2008).</li><li>Ong, C. -. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+regulates+insulator+function+and+intrachromosomal+interactions+in+Drosophila.">Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila.</a> Cell. 155 (1), 148-159 (2013).</li><li>Fres&#225;n, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insulator+protein+CTCF+regulates+Drosophila+steroidogenesis.">The insulator protein CTCF regulates Drosophila steroidogenesis.</a> Biology Open. 4 (7), 852-857 (2015).</li><li>Quinodoz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+promotes+the+formation+of+spatial+compartments+in+the+nucleus.">RNA promotes the formation of spatial compartments in the nucleus.</a> Cell. 174, 744-757 (2018).</li><li>Olivares-Chauvet, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+pairwise+and+multi-way+chromosomal+conformations+using+chromosomal+walks.">Capturing pairwise and multi-way chromosomal conformations using chromosomal walks.</a> Nature. 540 (7632), 296-300 (2016).</li><li>Beagrie, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+multi-enhancer+contacts+captured+by+genome+architecture+mapping.">Complex multi-enhancer contacts captured by genome architecture mapping.</a> Nature. 543, 519-524 (2017).</li><li>Redolfi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DamC+reveals+principles+of+chromatin+folding+in+vivo+without+crosslinking+and+ligation.">DamC reveals principles of chromatin folding in vivo without crosslinking and ligation.</a> Nature Structural and Molecular Biology. 26, 471-480 (2019).</li><li>Maxwell, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiChIP:+efficient+and+sensitive+analysis+of+protein-directed+genome+architecture.">HiChIP: efficient and sensitive analysis of protein-directed genome architecture.</a> Nature Methods. 13, 919-922 (2016).</li><li>Gao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-BERST:+Defining+subnuclear+proteomic+landscapes+at+genomic+elements+with+dCas9-APEX2.">C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2.</a> Nature Methods. 15 (6), 433-436 (2018).</li></ol>

שיטת Hi-C בגרעין המוצגת כאן אפשרה חקירה מפורטת של טופולוגיית הגנום של Drosophila ברזולוציה גבוהה, ומספקת תצוגה של אינטראקציות גנומיות בקנה מידה גנומי שונים, החל מלולאות כרומטין בין אלמנטים רגולטוריים כגון מקדמים ומשפרים ועד TADs וזיהוי תאים גדולים25. אותה טכנולוגיה יושמה גם ביעילות ע...

באאוקריוטים, הגנום מחולק לכרומוזומים התופסים שטחים ספציפיים במרחב הגרעיני במהלךאינטרפאזה 1. הכרומטין היוצר את הכרומוזומים ניתן לחלק לשני מצבים עיקריים: אחד של כרומטין נגיש כי הוא מתירני תמלול, והשני של כרומטין קומפקטי כי הוא דיכוי תמלול. מצבים כרומטין אלה מפרידים ורק לעתים רחוקות מתערבבים במרחב הגרעיני, ויוצרים שני תאים נפרדים בגרעין2. בסולם תת-בסיס, גבולות גבולות נפרדים תחומים של אינטראקציות כרומטין בתדר גבוה, הנקראות TADs, המסמנות ארגון כרומוזומלי3,4,5. ביונקים, גבולות TAD תפוסים על ידי לכידות וגורם מחייב CCCTC (CTCF)6,7,8. מתחם הלכידות מבלט כרומטין ועוצר באתרי כריכת CTCF הנזרקים בכיוון מתכנס ברצף הגנומי כדי ליצור לולאות כרומטין יציבות9,10,13,14. הפרעה גנטית של אתר כריכת DNA CTCF בגבולות או הפחתה בשפע חלבון CTCF ו cohesin גורמת אינטראקציות חריגות בין אלמנטים רגולטוריים, אובדן היווצרות TAD, הסרת פיקוח ביטויגנים 9,10,11,13,14.
בדרוסופילה, הגבולות בין ה-TADs תפוסים על ידי מספר APs, כולל גורם אלמנטי גבולי 32 kDa (BEAF-32), מוטיב 1 חלבון מחייב (M1BP), חלבון צנטריוזיal 190 (CP190), מדכא של כנף שעירה (SuHW) ו- CTCF, והם מועשרים בשינויי היסטון פעילים ופולימראז II16,17,18. הוצע כי ב Drosophila, TADs מופיעים כתוצאה של תמלול13,17,19, ואת התפקיד המדויק של APs עצמאיים היווצרות גבולות תכונות בידוד עדיין תחת חקירה. לכן, אם תחומים Drosophila הם תוצאה בלעדית של צבירת אזורים של מדינות תמלול דומות או אם APs, כולל CTCF, לתרום היווצרות גבולות נשאר להיות מאופיין במלואו. חקר מגעים גנומיים ברזולוציה גבוהה התאפשר באמצעות פיתוח טכנולוגיות לכידת קונפורמציה כרומוזומית בשילוב עם רצף הדור הבא. פרוטוקול Hi-C תואר לראשונה עם שלב קשירה שבוצע "בפתרון"2 בניסיון להימנע ממוצרי קשירה מזויפים בין שברי כרומטין. עם זאת, מספר מחקרים הצביעו על ההבנה כי האות השימושי בנתונים הגיע ממוצרי קשירה שנוצרו בגרעינים lysed חלקית שלא היו בפתרון20,21.
הפרוטוקול שונה לאחר מכן כדי לבצע את החיבור בתוך הגרעין כחלק מניסוי Hi-C של תא יחיד22. פרוטוקול Hi-C בגרעין שולב לאחר מכן באוכלוסיית התאים Hi-C כדי להניב כיסוי עקבי יותר על פני הטווח המלא של מרחקים גנומיים ולייצר נתונים עם פחות רעש טכני23,24. הפרוטוקול, המתואר בפירוט כאן, מבוסס על האוכלוסייה בגרעין פרוטוקול Hi-C23,24 ושימש כדי לחקור את ההשלכות של הסרה גנטית של מוטיבים מחייבי DNA עבור CTCF ו- M1BP מגבול תחום בלוקוס גן חריץ בדרוסופילה25. התוצאות מראות כי לשינוי מוטיבים מחייבי DNA עבור APs בגבול יש השלכות דרסטיות על היווצרות תחום Notch, פגמים טופולוגיים גדולים יותר באזורים המקיפים את לוקוס חריץ, והסרת הפיקוח על ביטוי הגנים. זה מצביע על כך אלמנטים גנטיים בגבולות התחום חשובים לשמירה על טופולוגיית הגנום וביטוי גנים ב Drosophila25.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% (vol/vol) paraformaldehyde solution</td>
			<td>Agar Scientific</td>
			<td>R1026</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin-14-dATP</td>
			<td>Invitrogen</td>
			<td>CA1524-016</td>
			<td></td>
		</tr>
		<tr>
			<td>ClaI enzyme</td>
			<td>NEB</td>
			<td>R0197S</td>
			<td></td>
		</tr>
		<tr>
			<td>COVARIS Ultrasonicator</td>
			<td>Covaris</td>
			<td>LE220-M220</td>
			<td></td>
		</tr>
		<tr>
			<td>Cut Smart</td>
			<td>NEB</td>
			<td>B72002S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM) 1x</td>
			<td>Life Technologies</td>
			<td>41965-039</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptabidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS) sterile filtered</td>
			<td>Sigma</td>
			<td>F9665</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow Dna PolI large fragment</td>
			<td>NEB</td>
			<td>M0210L</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow exo(-)</td>
			<td>NEB</td>
			<td>M0210S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Buffer</td>
			<td>NEB</td>
			<td>B020S</td>
			<td></td>
		</tr>
		<tr>
			<td>MboI enzyme</td>
			<td>NEB</td>
			<td>R0147M</td>
			<td></td>
		</tr>
		<tr>
			<td>NP40-Igepal</td>
			<td>SIGMA</td>
			<td>CA-420</td>
			<td>Non-ionic surfactant for addition in lysis buffer</td>
		</tr>
		<tr>
			<td>PE adapter 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-P-GATCGGAAGAGCGGTTCAGCAG 
			GAATGCCGAG-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE adapter 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-ACACTCTTTCCCTACACGACGCT 
			CTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-AATGATACGGCGACCACCGAGAT 
			CTACACTCTTTCCCTACACGACG 
			CTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-CAAGCAGAAGACGGCATACGAG 
			ATCGGTCTCGGCATTCCTGCTGA 
			ACCGCTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol: Chloroform:Isoamyl Alcohol 25:24:1</td>
			<td>SIGMA</td>
			<td>P2069</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 1 (known interaction, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-TCGCGGTAATTTTGCGTTTGA-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 2 (known interactions, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-CCTCCCTGCCAAAACGTTTT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail tablet</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Roche</td>
			<td>3115879001</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit</td>
			<td>ThermoFisher</td>
			<td>Q33327</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse</td>
			<td>Roche</td>
			<td>10109142001</td>
			<td></td>
		</tr>
		<tr>
			<td>SPRI Beads</td>
			<td>Beckman</td>
			<td>B23318</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen</td>
			<td>15224-025</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 polynucleotide kinase (PNK)&#160;</td>
			<td>NEB</td>
			<td>M0201L</td>
			<td></td>
		</tr>
		<tr>
			<td>TaqPhusion</td>
			<td>NEB</td>
			<td>M0530S</td>
			<td>DNA polymerase</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td></td>
			<td></td>
			<td>Non-ionic surfactant for quenching of SDS</td>
		</tr>
	</tbody>
</table>

in-nucleus hi-c in drosophila cells

הגנום מאורגן לתחומים המקשרים טופולוגית (TADs) המופרדים על ידי גבולות המבודדים אינטראקציות בין תחומים. בדרוסופילה, המנגנונים שבביד היווצרות TAD וגבולות עדיין נמצאים תחת חקירה. היישום של שיטת Hi-C בגרעין המתוארת כאן עזר לנתח את הפונקציה של חלבון אדריכלי (AP) -מחייב אתרים בגבולות TAD בידוד הגן חריץ. שינוי גנטי של גבולות תחום הגורמים לאובדן APs גורם היתוך TAD, פגמים תמלול, ושינויים טופולוגיים ארוכי טווח. תוצאות אלה סיפקו ראיות הממחישים את תרומתם של אלמנטים גנטיים להיווצרות גבולות תחום ובקרת ביטוי גנים בדרוסופילים. כאן, שיטת Hi-C בגרעין תוארה בפירוט, המספקת מחסומים חשובים להערכת איכות הניסוי יחד עם הפרוטוקול. כמו כן מוצגים המספרים הנדרשים של קריאות רצף וזוגות Hi-C חוקיים לניתוח אינטראקציות גנומיות בקנה מידה גנומי שונה. עריכה גנטית בתיווך CRISPR/Cas9 של אלמנטים רגולטוריים ופרופיל ברזולוציה גבוהה של אינטראקציות גנומיות באמצעות פרוטוקול Hi-C זה בגרעין יכול להיות שילוב רב עוצמה לחקירת התפקוד המבני של אלמנטים גנטיים.

מתואר להלן התוצאות של פרוטוקול Hi-C מוצלח (ראה סיכום של זרימת העבודה של פרוטוקול Hi-C באיור 1A). ישנם מספר מחסומי בקרת איכות במהלך ניסוי Hi-C בגרעין. עליקוטים לדוגמה נאספו לפני (UD) ואחרי (D) שלב הגבלת הכרומטין וכן לאחר קשירה (L). הקישורים התהפכו, והדנ"א טוהר ורץ על ג'ל אגרוז. מריחה של 200-1...

Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

In-Nucleus Hi-C in Drosophila Cells

הגנום מאורגן במרחב הגרעיני למבנים שונים שניתן לגלות באמצעות טכנולוגיות לכידת קונפורמציה כרומוזומית. שיטת Hi-C בגרעין מספקת אוסף רחב של אינטראקציות כרומטין בקווי תאים של Drosophila, אשר מייצר מפות מגע שניתן לחקור ברזולוציית מגה-בסיס ברמת שבר ההגבלה.

In-Nucleus Hi-C בתאי דרוסופילה

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, ...

פרוטוקולי Nucleus Hi-C מאפשרים לחקור אישור כרומוזומלי ברזולוציה שונה לאפיון לולאות כרומטין, תחומים ותא המארגנים את הגנום. פרוטוקול זה מספק פרופיל ברזולוציה גבוהה של אינטראקציות גנומיות בקנה מידה שונה, ומעניק כיסוי עקבי יותר על פני הטווח המלא של מרחקים ונתונים גנומיים עם פחות רעש טכני. שילוב פרוטוקול זה עם עריכה גנטית היא אסטרטגיה רבת עוצמה לבדיקת התפקוד המבני של אלמנטים גנטיים.זה יכול להיות מיושם גם על אפיון של וריאציות מבניות שמובילות למחלות. ניתן ליישם את פרוטוקול Nucleus Hi-C כדי לחקור את ארגון הגנום של כל גנום אאוקריוטי. ביצוע טיפול SDS וטריטון מנטרל את כל הגושים הגרעיניים על ידי צנרת כמו אגרגטים להפריע יעילות התגובה אנזימטית, ולהיות בטוח לבצע את בקרת איכות המתאימה למדוד לפני הרצף.התחל על ידי הוספת פורמלדהיד ללא מתנול פעם אחת 10 לשבעה תאי קו 2 פלוס של שניידר פלוס Drosophila ב 17.5 מיליליטר של בינוני שניידר בתוספת עם 10% FBS לריכוז סופי של 2% לדגור על התאים במשך 10 דקות בטמפרטורת החדר עם ערבוב כל 60 שניות או על גלגל מסתובב, ולהוסיף גליצין לריכוז סופי של 0.125 טוחנת עם ערבוב. לאחר חמש דקות בטמפרטורת החדר ו -15 דקות על קרח, לאסוף את התאים על ידי centrifugation בזהירות resuspend הכדור ב 25 מיליליטר של PBS קר ולאסוף את התאים עם צנטריפוגה אחרת. בסוף הצנטריפוגה, resuspend התאים במיליליטר אחד של חיץ תמוגה קר קרח לספירה ולהתאים את התאים אחד פעמים 10 עד שישה תאים לריכוז מיליליטר.לדגור את התאים על הקרח במשך 30 דקות, הפוך את הצינור כל שתי דקות לערבב ולאסוף את התאים עם צנטריפוגה אחרת. resuspend הכדור במיליליטר אחד של חוצץ תמיסת קרח קר טרי. לאחר צנטריפוגה, לשטוף את lysate עם מיליליטר אחד של 1.25X מאגר הגבלה.צנטריפוגה שוב כדי לאסוף את lysate. resuspend הכדור ב 360 microliters של חוצץ הגבלה טרי ו 11 microliters של 10% SDS עם pipetting זהיר ודגרה במשך 45 דקות ב 37 מעלות צלזיוס ו 7 עד 950 סיבובים לדקה עם צנרת מדי פעם. בסוף הדגירה, לעצור את permeabilization עם 75 microliters של פעילי שטח לא יוני ולהחזיר את הצינור לחממה במשך 45 דקות נוספות עם רועד ב 950 מהפכות לדקה עם pipetting מדי פעם.לעיכול כרומטין, להוסיף 200 יחידות של Mbo1 לצינור עבור דגירה של ארבע עד 16 שעות ב 37 מעלות צלזיוס עם סיבוב. בסוף הדגירה, לנטרל את האנזים עם 20 דקות דגירה ב 60 מעלות צלזיוס. כדי למלא את שבר ההגבלה overhangs ולתייג את ה- DNA מסתיים עם ביוטין, להוסיף 1.5 microliters כל אחד של 10 מילימולר dCTP, dGTP, dTTP, 20 microliters של 0.4 מילימולר ביוטין dATP, 17.5 microliters של חיץ EDTA נמוך tris, ו 10 microliters של חמש יחידות לכל microliter של DNA פולימראז שבר אחד גדול לצינור עם ערבוב זהיר.לדגור על התגובה במשך 75 דקות ב 37 מעלות צלזיוס עם רועד ב 700 סיבובים לדקה כל 10 שניות במשך 30 שניות. בסוף הדגירה, מוסיפים את תערובת הקשירה לכרומטין ומתאימים אותו לנפח תגובה סופי אחד של מיליליטר עם ערבוב עדין ויסודי ודגרה למשך הלילה ב -16 מעלות צלזיוס. כדי לבזות את חלבוני הדגימה, להוסיף 50 מיקרוליטרים של 10 מיליגרם למיליליטר proteinase K לצינור עבור דגירה של שעתיים ב 37 מעלות צלזיוס.בסוף הדגירה, להגדיל את הטמפרטורה ל 65 מעלות צלזיוס לילה כדי להפוך crosslink המדגם. למחרת בבוקר, להשפיל את RNA עם 10 microliters של 10 מיליגרם למיליליטר RNAse A.After שעה אחת ב 37 מעלות צלזיוס, להוסיף נפח אחד של פנול כלורופורם לצינור ולערבב ביסודיות על ידי היפוך כדי להשיג שלב לבן הומוגני. לאחר ההאצה של הדנ"א על פי פרוטוקולים סטנדרטיים, לכמת את ה- DNA באמצעות צבע פלואורוגני שנקשר באופן סלקטיבי ל- DNA ולפלואורומטר בהתאם להוראות היצרן.כדי לטהר את הדנ"א מאליקוטות לא מעוכלות ומעוכלות, העמיסו 100 ננוגרם של דגימות לא מעוכלות, מעוכלות וקשירה על ג'ל של 1.5% אגרוז וחפשו מריחה שבמרכזה כ-500 זוגות בסיסים במדגם המעוכל לעומת רצועת משקל מולקולרית גבוהה לדגימה שנקשרה. כדי לאמת את יעילות הסימון והקשירה של Hi-C על-ידי הגברה ועיכול של אינטראקציה ידועה, לאחר PCR, לעכל את המוצרים עם Mbo1, Cla1 או שניהם, ולהפעיל את הדגימות על ג'ל חדש של 1.5 עד 2% כדי לאפשר הערכה של המספר היחסי של צמתים קשירת 3C ו- Hi-C. לאחר sonicating המדגם כדי להשיג 200 עד 500 שברי DNA זוג בסיס, להעביר 130 microliters עם חמישה מיקרוגרם של DNA מכל דגימה לתוך צינורות microcentrifuge חדש המכיל 16 microliters של 10X חיץ קשירה, שני microliters של 10 מילימולר dATP, חמישה microliters של T4 DNA פולימראז, ושבע microliters של מים מזוקקים כפולים עבור דגירה של 30 דקות ב 20 מעלות צלזיוס.בסוף הדגירה, להוסיף חמישה microliters של 10 מילימולר dNTPs, ארבעה microliters של 10X חיץ קשירה, חמישה microliters של T4 polynucleotide קינאז, microliter אחד של DNA פולימראז שבר אחד גדול, ו 25 microliters של מים מזוקקים כפולים לצינורות עבור דגירה שנייה 30 דקות ב 20 מעלות צלזיוס. כדי לבחור שברים בעיקר בטווח הגודל של זוג הבסיסים 250 עד 550, בצעו את הבחירה ההפוכה של פאזה מוצקה רציפה וגודל הגיוס עם פי 0.6, ואז פי 0.9 בהתאם להוראות היצרן ולחמוק מה- DNA עם 100 מיקרוליטרים של טריס נמוך EDTA. עבור ביוטין משיכה למטה עבור כל ספריה, לשטוף 150 microliters של חרוזים מגנטיים הקשורים סטרפטאבידין פעמיים עם 400 microliters של חוצץ 1X Tween ולסובב את הדגימות במשך שלוש דקות על גלגל מסתובב.בסוף הדגירה, יש להדק את החרוזים ב-300 מיקרוליטרים של פי 2 ללא חיץ טווין ולערבב עם 300 מיקרוליטרים של חומר Hi-C לסיבוב של 30 דקות על גלגל מסתובב. בסוף הדגירה, לשטוף את החרוזים עם 400 microliters של 0.5X Tween חוצץ עבור שלוש דקות דגירה ב 55 מעלות צלזיוס ו 750 סיבובים לדקה, ואחריו שתי שטיפות ב 200 microliters של חוצץ הגבלה 1X לכל לשטוף. לאחר הכביסה השנייה, resuspend החרוזים ב 100 microliters של תערובת זנב dATP עבור דגירה של 30 דקות ב 37 מעלות צלזיוס.בסוף הדגירה, יש לחבר מחדש את החרוזים ב-50 מיקרוליטרים של חיץ קשירה פי 1 והעבירו את המתלים לצינור חדש המכיל ארבעה מיקרוליטרים מראש של מתאמי קצה מזווגים ושני מיקרוליטרים של קשירת T4. לאחר שעתיים בטמפרטורת החדר, הסר את supernatant ולשטוף את החרוזים פעמיים עם 400 microliters של חוצץ Tween, ולאחר מכן לשטוף את החרוזים פעם אחת עם 200 microliters של חיץ Tween ללא חיץ Tween ופעם אחת עם 100 microliters של חוצץ הגבלה לפני השעיית החרוזים ב 40 microliters של חוצץ הגבלה 1X. מריחה של 200 עד 1, 000 זוגות בסיסים נצפתה כאשר הגבלה עם Mbo1 מצליחה.אם קשירה מוצלחת, רצועת משקל מולקולרית גבוהה נצפתה בחלק העליון של הג'ל. יעילות העיכול יכולה גם להיות מאושרת על ידי PCR כמותי. יעילות עיכול מקובלת היא 80% ומעלה.כפי שניתן להמחיש, ניתן להעריך את ההגברה של אינטראקציה ידועה בטווח בינוני במוצרי קשירה Hi-C על ידי עיכול של מוצר PCR התאושש בהגברה. יעילות עיכול של יותר מ -70%מומלץ להימנע משיעור גדול של קריאות לא שימושיות עבור הספריות לאחר הרצף. מספר מחזורי PCR עבור ההגברה הסופית צריך להיות מחזור אחד פחות ממספר המחזורים שעבורם ההכפשה גלויה.רמת העיכול של הספרייה מציינת את השפע של זוגות Hi-C תקפים ומשקפת את שיעור הקריאות השימושיות שיתקבלו מהספרייה. באמצעות זוגות Hi-C חוקיים ייחודיים, ניתן לבצע ניתוח בסיסי של התפלגות הזוג. כפי שניתן לראות בדוגמה מייצגת זו, לוקוס גן NOTCH ניתן לראות יחד עם חלבונים אדריכליים, תחומים אחד ושתיים, ושינויי histone לאורך הלוקוס.עם מחיקת האזור המכיל הן את אתרי כריכת ה- DNA של CTCF והן את אתרי כריכת ה- DNA של M1BP, ניתן לראות שינוי דרמטי באנשי הקשר הכרומטין. לאחר ניסוי Hi-C, ניתן לבצע כדי להגיע קבוצה ספציפית של אנשי קשר, למשל, מאזורי מקדם. זה שימושי במיוחד בעת הערכת גנומים גדולים.כפי שהוכח, שילוב פרוטוקול Hi-C עם תוספת גנטית יכול לשמש להערכת התפקוד המבני והרגולטורי של אלמנטים גנומיים.

Research

JoVE Journal

Genetics

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

באתרו תיוג של דנ&quot;א מיטוכונדריאלי שכפול תסיסנית למבוגרים השחלות ידי edu מכתים

The mitochondrial genome is inherited exclusively through the maternal line. Understanding of how the mitochondrion and its genome are proliferated and ...

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Quantifying Abdominal Pigmentation in Drosophila melanogaster

כימות פיגמנטציה בטן ב<em&gt; תסיסנית מלנוגאסטר</em

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

יזם לכידת שלום-c: ברזולוציה גבוהה, הגנום כולו פרופיל של אינטראקציות יזם

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

Purification of Low-abundant Cells in the Drosophila Visual System

טיהור של התאים נמוך-שפע ב מערכת הראייה דרוזופילה

Recent improvements in the sensitivity of next generation sequencing have facilitated the application of transcriptomic and genomic analyses to small ...

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

במחקר פונקציונלי Vivo של מחלות-הקשורים משתנים אנושיים נדירים באמצעות Drosophila ילה

Advances in sequencing technology have made whole-genome and whole-exome datasets more accessible for both clinical diagnosis and cutting-edge human ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

ב Vivo Forward המסך הגנטי כדי לזהות גנים נוירוגינים הרומן ב Drosophila ילה melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Use of Drosophila S2 Cells for Live Imaging of Cell Division

שימוש ב- Drosophila ילה S2 תאים עבור הדמיה חיה של חטיבת התא

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

חקירת התפקיד הטרנססאני של משתיק הRUNX1 נית על ידי CRISPR/Cas9 Ribonucleoprotein בתאי לוקמיה מיאלואיד חריפה

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

פרוטוקול מבוסס FACS כדי לבודד RNA מן התאים המשניים של דרוזוהילה בלוטות אביזר זכר

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...

Detection of Post-Replicative Gaps Accumulation and Repair in Human Cells Using the DNA Fiber Assay

זיהוי של פערים לאחר שכפול הצטברות ותיקון בתאים אנושיים באמצעות בדיקת סיבי DNA

The DNA fiber assay is a simple and robust method for the analysis of replication fork dynamics, based on the immunodetection of nucleotide analogs that ...