Name: in-nucleus hi-c in drosophila cells
Uploaded: 2021-09-15T15:00:00
Description: Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

이 작품은 UNAM 기술 혁신 및 연구 지원 프로그램 (PAPIIT) 교부금 번호 IN207319 및 과학기술 국가 위원회 (CONACyT-FORDECyT) 교부금 번호 303068 의해 지원되었다. A.E.L. 과학 기술 국가 위원회 (CONACyT) CVU 번호 968128 의해 지원 석사 학생입니다.

1. 고정
<ol><li>1,000만 개의 슈나이더 라인 2 플러스(S2R+) 세포로 시작하여 실온(RT)에서 10%의 태아 소 혈청(FBS)을 함유한 슈나이더 배지에서 세포 현탁액 17.5mL를 준비합니다.</li>
	<li>메탄올이 없는 포름알데히드를 첨가하여 최종 농도를 2%로 얻습니다. RT에서 10분 동안 혼합하고 인큐베이션을 사용하여 매 분마다 섞어 주시합니다. 참고: 포름알데히드는 유해 화학물질입니다. 적절한 건강 및 안전 ?...

<ol>
	<li>Cremer, T., Cremer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+territories,+nuclear+architecture+and+gene+regulation+in+mammalian+cells.">Chromosome territories, nuclear architecture and gene regulation in mammalian cells.</a> Nature Review Genetics. 2, 292-301 (2001).</li><li>Lieberman-Aiden, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+mapping+of+long-range+interactions+reveals+folding+principles+of+the+human+genome.">Comprehensive mapping of long-range interactions reveals folding principles of the human genome.</a> Science. 326, 289-293 (2009).</li><li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485, 376-380 (2012).</li><li>Sexton, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+folding+and+functional+organization+principles+of+the+Drosophila+genome.">Three-dimensional folding and functional organization principles of the Drosophila genome.</a> Cell. 148 (3), 458-472 (2012).</li><li>Dixon, J. R., Gorkin, D. U., Ren, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+domains:+the+unit+of+chromosome+organization.">Chromatin domains: the unit of chromosome organization.</a> Molecular Cell. 62, 668-680 (2016).</li><li>Bonev, B., Cavalli, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+and+function+of+the+3D+genome.">Organization and function of the 3D genome.</a> Nature Reviews Genetics. 17, 661-678 (2016).</li><li>Lupi&#225;&#241;ez, D. G., Spielmann, M., Mundlos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+TADs:+how+alterations+of+chromatin+domains+result+in+disease.">Breaking TADs: how alterations of chromatin domains result in disease.</a> Trends in Genetics. 32, 225-237 (2016).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Hong, S., Kim, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+characterization+of+chromatin+domain+boundary-associated+genomic+elements.">Computational characterization of chromatin domain boundary-associated genomic elements.</a> Nucleic Acids Research. 45, 10403-10414 (2017).</li><li>Zuin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cohesin+and+CTCF+differentially+affect+chromatin+architecture+and+gene+expression+in+human+cells.">Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).</li><li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer/promoter+function.">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162, 900-910 (2015).</li><li>Lupi&#225;&#241;ez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161, 1012-1025 (2015).</li><li>Van-Steensel, B., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+transcription+in+shaping+the+spatial+organization+of+the+genome.">The role of transcription in shaping the spatial organization of the genome.</a> Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).</li><li>Merkenschlager, M., Nora, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+in+genome+folding+and+transcriptional+gene+regulation.">CTCF and cohesin in genome folding and transcriptional gene regulation.</a> Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).</li><li>Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+regulate+chromatin+loop+stability+with+distinct+dynamics.">CTCF and cohesin regulate chromatin loop stability with distinct dynamics.</a> Elife. 6, 1-10 (2017).</li><li>Van Bortle, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulator+function+and+topological+domain+border+strength+scale+with+architectural+protein+occupancy.">Insulator function and topological domain border strength scale with architectural protein occupancy.</a> Genome Biology. 15, 82 (2014).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ulianov, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+chromatin+and+transcription+play+a+key+role+in+chromosome+partitioning+into+topologically+associating+domains.">Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains.</a> Genome Research. 26, 70-84 (2016).</li><li>Rowley, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+conserved+principles+predict+3D+chromatin+organization.">Evolutionarily conserved principles predict 3D chromatin organization.</a> Molecular Cell. 67, 837-852 (2017).</li><li>Gavrilov, A. A., Golov, A. K., Razin, S. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actual+ligation+frequencies+in+the+chromosome+conformation+capture+procedure.">Actual ligation frequencies in the chromosome conformation capture procedure.</a> PLoS One. 8, 60403 (2013).</li><li>Gavrilov, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disclosure+of+a+structural+milieu+for+the+proximity+ligation+reveals+the+elusive+nature+of+an+active+chromatin+hub.">Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub.</a> Nucleic Acids Research. 41, 3563-3575 (2013).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+Hi-C+reveals+cell-to-cell+variability+in+chromosome+structure.">Single-cell Hi-C reveals cell-to-cell variability in chromosome structure.</a> Nature. 502, 59-64 (2013).</li><li>Rao, S. S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+3D+map+of+the+human+genome+at+kilobase+resolution+reveals+principles+of+chromatin+looping.">A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping.</a> Cell. 159 (7), 1665-1680 (2014).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Hi-C+results+using+in-solution+versus+in-nucleus+ligation.">Comparison of Hi-C results using in-solution versus in-nucleus ligation.</a> Genome Biology. 16, 175 (2015).</li><li>Arzate-Mej&#237;a, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+dissection+of+domain+boundaries+affect+genome+topology+and+gene+transcription+in+Drosophila.">In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila.</a> Nature Communications. 11, 894 (2020).</li><li>Schoenfelder, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter+capture+Hi-C:+high-resolution,+genome-wide+profiling+of+promoter+interactions.">Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions.</a> Journal of Visualized Experiments. (136), e57320 (2018).</li><li>Servant, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiC-Pro:+an+optimized+and+flexible+pipeline+for+Hi-C+processing.">HiC-Pro: an optimized and flexible pipeline for Hi-C processing.</a> Genome Biology. 16, 259 (2015).</li><li>Philip, E., M&#229;ns, M., Sverker, L., Max, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MultiQC:+Summarize+analysis+results+for+multiple+tools+and+samples+in+a+single+report.">MultiQC: Summarize analysis results for multiple tools and samples in a single report.</a> Bioinformatics. 10, 1093 (2016).</li><li>Wingett, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCUP:+pipeline+for+mapping+and+processing+Hi-C+data.">HiCUP: pipeline for mapping and processing Hi-C data.</a> F1000 Research. 4, 1310 (2015).</li><li>Imakaev, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+correction+of+Hi-C+data+reveals+hallmarks+of+chromosome+organization.">Iterative correction of Hi-C data reveals hallmarks of chromosome organization.</a> Nature Methods. 9 (10), 999-1003 (2012).</li><li>Akdemir, K. C., Chin, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCPlotter+integrates+genomic+data+with+interaction+matrices.">HiCPlotter integrates genomic data with interaction matrices.</a> Genome Biolog. 16, 198 (2015).</li><li>Ramirez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ando-Kuri, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+global+and+promoter-centric+3D+genome+organization+temporally+resolved+during+a+circadian+cycle.">The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle.</a> bioRxiv. , (2020).</li><li>Cuellar-Partida, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+priors+for+identifying+active+transcription+factor+binding+sites.">Epigenetic priors for identifying active transcription factor binding sites.</a> Bioinformatics. 28 (1), 56-62 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biology. 9, 137 (2008).</li><li>Ong, C. -. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+regulates+insulator+function+and+intrachromosomal+interactions+in+Drosophila.">Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila.</a> Cell. 155 (1), 148-159 (2013).</li><li>Fres&#225;n, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insulator+protein+CTCF+regulates+Drosophila+steroidogenesis.">The insulator protein CTCF regulates Drosophila steroidogenesis.</a> Biology Open. 4 (7), 852-857 (2015).</li><li>Quinodoz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+promotes+the+formation+of+spatial+compartments+in+the+nucleus.">RNA promotes the formation of spatial compartments in the nucleus.</a> Cell. 174, 744-757 (2018).</li><li>Olivares-Chauvet, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+pairwise+and+multi-way+chromosomal+conformations+using+chromosomal+walks.">Capturing pairwise and multi-way chromosomal conformations using chromosomal walks.</a> Nature. 540 (7632), 296-300 (2016).</li><li>Beagrie, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+multi-enhancer+contacts+captured+by+genome+architecture+mapping.">Complex multi-enhancer contacts captured by genome architecture mapping.</a> Nature. 543, 519-524 (2017).</li><li>Redolfi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DamC+reveals+principles+of+chromatin+folding+in+vivo+without+crosslinking+and+ligation.">DamC reveals principles of chromatin folding in vivo without crosslinking and ligation.</a> Nature Structural and Molecular Biology. 26, 471-480 (2019).</li><li>Maxwell, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiChIP:+efficient+and+sensitive+analysis+of+protein-directed+genome+architecture.">HiChIP: efficient and sensitive analysis of protein-directed genome architecture.</a> Nature Methods. 13, 919-922 (2016).</li><li>Gao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-BERST:+Defining+subnuclear+proteomic+landscapes+at+genomic+elements+with+dCas9-APEX2.">C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2.</a> Nature Methods. 15 (6), 433-436 (2018).</li></ol>

여기에 제시된 핵 내 Hi-C 방법은 고해상도로 드로소필라 게놈 토폴로지의 상세한 탐구를 허용하고, 발기인과 증강제 와 같은 조절 요소 간의 크로마틴 루프에서 부터 TAD 및 대형 구획식별(25)에이르기까지 다양한 게놈 비늘에서 게놈 상호 작용의 전망을 제공한다. 동일한 기술은 또한 일부 수정33을가진 포유류 조직에 효율적으로 적용되었습니다. 예를 들어, 단?...

진핵생물에서, 게놈은1단계도중 핵 공간에 있는 특정 영토를 차지하는 염색체로 분할된다. 염색체를 형성하는 염색체는 두 개의 주요 국가로 나눌 수 있습니다: 전사적으로 허용되는 접근 가능한 크로마틴 의 하나, 그리고 전사적으로 억압되는 소형 크로마틴의 다른. 이 크로마틴 상태는 핵2에두 개의 뚜렷한 구획을 형성하여 핵 공간에서 분리하고 거의 혼합되지 않습니다. 서브 메가베이스 척도에서 경계는 염색체조직3,4,5를표시하는 TAD라는 고주파 크로마틴 상호 작용의 도메인을 분리합니다. 포유류에서 TAD 경계는 응집력 및 CCCTC 결합 계수(CTCF)6,7,8에의해 점령된다. 응집력 복합체는 크롬라틴을 압출하고 유전체 서열에서 수렴 방향으로 배치되는 CTCF 결합 부위에서 정지하여 안정적인 크로마틴 루프9,10,13,14를형성한다. CTCF DNA 결합 부위의 유전적 중단은 CTCF 및 응집력 있는 단백질 풍부의 경계 또는 감소로 조절 원소, TAD 형성의 손실 및 유전자 발현 완화9,10, 11,13,14사이의 비정상적인 상호 작용을 초래한다.
드로소필라에서, TAD사이의 경계는 경계 요소 관련 인자 32 kDa(BEAF-32), 모티프 1 결합 단백질(M1BP), 센트로소말 단백질 190(CP190), 털이 날개(SuHW), 및 CTCF를 포함한 여러 EP에 의해 점유되고, 그의 변형 및18,18,폴리머1에서 풍부하게 된다. 드로소필라에서는13,17,19의전사의 결과로 TAD가 나타나고 경계 형성 및 절연 특성에서 독립적 인 AP의 정확한 역할은 아직 조사 중입니다. 따라서, Drosophila의 도메인이 유사한 전사 상태의 영역 집합의 유일한 결과인지 또는 CTCF를 포함한 AP가 경계 형성에 기여하는지 여부는 완전히 특징지어져야 한다. 차세대 시퀀싱과 결합된 염색체 형태 포획 기술의 개발을 통해 고해상도에서 게놈 접촉의 탐사가 가능해졌습니다. Hi-C 프로토콜은 크로마틴 단편 간의 스퓨리어스 결찰 제품을 피하기 위해 "솔루션"2를 수행한 결찰 단계로 처음 설명되었다. 그러나, 여러 연구는 데이터에서 유용한 신호가 용액20,21에없었던 부분적으로 리세드 핵에서 형성된 결찰 제품으로부터 왔다는 것을깨달았다.
그런 다음 프로토콜은 단일 세포 Hi-C실험(22)의일부로 핵 내부의 결찰을 수행하도록 수정하였다. 핵 내 Hi-C 프로토콜은 이후 세포 인구 Hi-C에 통합되어 전체 범위의 게놈 거리에서 보다 일관된 커버리지를 산출하고 덜 기술적노이즈(23,24)로데이터를 생성한다. 여기서 상세히 기술된 프로토콜은, 핵 내의정서(23,24)를 기반으로 하며 드로소필라(Drosophila)의 노치 유전자 궤적에서 도메인 경계에서 CTCF 및 M1BP에대한 DNA 결합 모티브를 유전적으로 제거하는 결과를 조사하는 데 사용되었다. 결과는 경계에 있는 AP를 위한 DNA 결합 모티프를 바꾸는 것은 노치 도메인 형성, 노치 메큐를 둘러싼 지역에 있는 더 큰 토폴로지 결함 및 유전자 발현 변압에 대한 과감한 결과를 가지고 있다는 것을 보여줍니다. 이것은 도메인 경계에 있는 유전 원소가 Drosophila25에있는 게놈 토폴로지 및 유전자 발현의 유지를 위해 중요하다는 것을 표시합니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>16% (vol/vol) paraformaldehyde solution</td>
			<td>Agar Scientific</td>
			<td>R1026</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotin-14-dATP</td>
			<td>Invitrogen</td>
			<td>CA1524-016</td>
			<td></td>
		</tr>
		<tr>
			<td>ClaI enzyme</td>
			<td>NEB</td>
			<td>R0197S</td>
			<td></td>
		</tr>
		<tr>
			<td>COVARIS Ultrasonicator</td>
			<td>Covaris</td>
			<td>LE220-M220</td>
			<td></td>
		</tr>
		<tr>
			<td>Cut Smart</td>
			<td>NEB</td>
			<td>B72002S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium (DMEM) 1x</td>
			<td>Life Technologies</td>
			<td>41965-039</td>
			<td></td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptabidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal bovine serum (FBS) sterile filtered</td>
			<td>Sigma</td>
			<td>F9665</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow Dna PolI large fragment</td>
			<td>NEB</td>
			<td>M0210L</td>
			<td></td>
		</tr>
		<tr>
			<td>Klenow exo(-)</td>
			<td>NEB</td>
			<td>M0210S</td>
			<td></td>
		</tr>
		<tr>
			<td>Ligation Buffer</td>
			<td>NEB</td>
			<td>B020S</td>
			<td></td>
		</tr>
		<tr>
			<td>MboI enzyme</td>
			<td>NEB</td>
			<td>R0147M</td>
			<td></td>
		</tr>
		<tr>
			<td>NP40-Igepal</td>
			<td>SIGMA</td>
			<td>CA-420</td>
			<td>Non-ionic surfactant for addition in lysis buffer</td>
		</tr>
		<tr>
			<td>PE adapter 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-P-GATCGGAAGAGCGGTTCAGCAG 
			GAATGCCGAG-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE adapter 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-ACACTCTTTCCCTACACGACGCT 
			CTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 1.0</td>
			<td>Illumina</td>
			<td>5&#39;-AATGATACGGCGACCACCGAGAT 
			CTACACTCTTTCCCTACACGACG 
			CTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>PE PCR primer 2.0</td>
			<td>Illumina</td>
			<td>5&#39;-CAAGCAGAAGACGGCATACGAG 
			ATCGGTCTCGGCATTCCTGCTGA 
			ACCGCTCTTCCGATCT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Phenol: Chloroform:Isoamyl Alcohol 25:24:1</td>
			<td>SIGMA</td>
			<td>P2069</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 1 (known interaction, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-TCGCGGTAATTTTGCGTTTGA-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer 2 (known interactions, Figure 2A)</td>
			<td>Sigma</td>
			<td>5&#39;-CCTCCCTGCCAAAACGTTTT-3&#39;</td>
			<td></td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail tablet</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Roche</td>
			<td>3115879001</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit</td>
			<td>ThermoFisher</td>
			<td>Q33327</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse</td>
			<td>Roche</td>
			<td>10109142001</td>
			<td></td>
		</tr>
		<tr>
			<td>SPRI Beads</td>
			<td>Beckman</td>
			<td>B23318</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen</td>
			<td>15224-025</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA polymerase</td>
			<td>NEB</td>
			<td>M0203S</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 polynucleotide kinase (PNK)&#160;</td>
			<td>NEB</td>
			<td>M0201L</td>
			<td></td>
		</tr>
		<tr>
			<td>TaqPhusion</td>
			<td>NEB</td>
			<td>M0530S</td>
			<td>DNA polymerase</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td></td>
			<td></td>
			<td>Non-ionic surfactant for quenching of SDS</td>
		</tr>
	</tbody>
</table>

in-nucleus hi-c in drosophila cells

게놈은 도메인 간의 상호 작용을 격리하는 경계에 의해 구분되는 토폴로지적으로 연관된 도메인(TADs)으로 구성됩니다. Drosophila에서 TAD 형성과 경계의 기본 메커니즘은 여전히 조사 중입니다. 여기에 설명된 핵 내 Hi-C 방법의 적용은 노치 유전자를 분리하는 TAD 경계에서 건축 단백질(AP)결합 부위의 기능을 해부하는 데 도움이 되었다. AP의 손실을 일으키는 도메인 경계의 유전자 변형은 TAD 융합, 전사 결함 및 장거리 토폴로지 변경을 초래합니다. 이 결과는 Drosophila에 있는 도메인 경계 형성 및 유전자 발현 통제에 유전 요소의 기여를 보여주는 증거를 제공했습니다. 여기서, 핵 내 Hi-C 방법은 프로토콜과 함께 실험의 품질을 평가하기 위한 중요한 체크포인트를 제공하는 상세하게 기술되었다. 또한 다른 게놈 비늘에서 게놈 상호 작용을 분석하기 위해 시퀀싱 판독 및 유효한 Hi-C 쌍의 필요한 숫자가 도시되어 있습니다. CRISPR/Cas9 매개 유전자 편집 은 규제 요소의 유전자 편집 및 이 핵 내 Hi-C 프로토콜을 사용하여 게놈 상호 작용의 고해상도 프로파일링은 유전 적 요소의 구조적 기능의 조사를위한 강력한 조합이 될 수 있습니다.

다음은 성공적인 Hi-C 프로토콜의 결과입니다(그림 1A의Hi-C 프로토콜 워크플로우 요약 참조). 핵 하이-C 실험 중에는 여러 가지 품질 관리 검사점이 있습니다. 샘플 알리쿼트는 (UD) 및 후 (D) 크로마틴 제한 단계뿐만 아니라 결찰 후(L)를 수집하였다. 크로스링크는 반전되었고, DNA는 정제되어 아가로즈 젤로 실행되었다. Mbo에 대한 제한이 성공했을 때 200-1000 bp의 얼룩이 관찰되었?...

Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

In-Nucleus Hi-C in Drosophila Cells

게놈은 핵 공간에서 염색체 형성 포획 기술을 통해 드러나게 할 수 있는 다른 구조물로 조직됩니다. 핵 내 Hi-C 방법은 드로소필라 세포주에서 크로마티닌 상호작용의 게놈 전체 컬렉션을 제공하며, 이는 제한 단편 수준에서 메가베이스 해상도로 탐색할 수 있는 접촉 맵을 생성합니다.

드로소필라 세포의 인핵 하이-C

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, ...

핵 Hi-C 프로토콜은 게놈을 구성하는 크로마틴 루프, 도메인 및 구획의 특성화를 위한 다른 해상도에서 염색체 확인의 탐구를 허용합니다. 이 프로토콜은 다양한 비늘에서 게놈 상호 작용의 고해상도 프로파일링을 제공하여 전체 범위의 게놈 거리및 데이터 범위에 걸쳐 기술적 소음이 적은 보다 일관된 커버리지를 제공합니다. 이 프로토콜을 유전자 편집과 결합하는 것은 유전 적 요소의 구조적 기능을 테스트하기위한 강력한 전략입니다.그것은 또한 질병으로 이끌어 내는 구조적인 변이의 특성화에 적용될 수 있습니다. 핵 Hi-C 프로토콜은 어떤 진핵 게놈의 게놈 조직을 탐구하기 위하여 적용될 수 있습니다. SDS 및 Triton 처리를 수행하면 응집체가 효소 반응 효율을 방해하고 시퀀싱 전에 적절한 품질 제어 측정을 수행하므로 파이펫팅으로 핵 덩어리가 분해됩니다.7회 슈나이더의 라인 2 Plus 드로소필라 세포에 메탄올 프리 포름알데히드를 10회 10회에 추가하여 슈나이더 배지의 17.5 밀리리터에 10%의 FBS를 보충하여 60초마다 혼합하거나 회전하는 휠에 10분 동안 세포를 배양하고, 글리신을 최종 12.02의 마지막 농도로 혼합하여 10분간 첨가합니다. 실온에서 5분, 얼음에서 15분 후에, 원심분리로 세포를 수집하고 차가운 PBS의 25밀리리터에서 펠릿을 조심스럽게 재보습하고 또 다른 원심분리로 세포를 수집합니다. 원심분리의 끝에서, 계산을 위한 얼음 냉용 리시스 버퍼의 1 밀리리터에서 세포를 재보중단하고 밀리리터 농도당 6개의 세포로 10번으로 세포를 조정한다.30 분 동안 얼음에 세포를 배양하고, 튜브를 2 분마다 반전하여 다른 원심 분리와 세포를 혼합하고 수집합니다. 신선한 얼음 차가운 리시스 버퍼의 1 밀리리터에 펠릿을 다시 놓습니다. 원심 분리 후 1.25X 제한 버퍼1밀리리터로 리세이트세척을 세척합니다.다시 원심 분리기는 lysate를 수집합니다. 360 마이크로리터의 신선한 제한 버퍼와 11 마이크로리터의 펠릿을 37°C에서 45분 동안 조심스럽게 배관하고 배양하여 가끔 파이프팅으로 분당 7~950회전을 반복합니다. 인큐베이션의 끝에서, 비 이온 계면활성제의 75 마이크로 리터와 투과화를 중지하고 가끔 파이펫으로 분당 950 회전에서 흔들림과 추가 45 분 동안 인큐베이터에 튜브를 반환합니다.크로마틴 소화의 경우, 200단위의 Mbo1을 튜브에 넣고 회전시 섭씨 37도에서 4~16시간 배양에 넣습니다. 인큐베이션이 끝나면 60°C에서 20분 배양으로 효소를 비활성화합니다. 제한 조각 오버행을 채우고 DNA끝을 비오틴으로 표시하려면, 각각 10 밀리머 dCTP, dGTP, dTTP, 0.4 밀리머 비오틴 dATP의 20 마이크로리터, 17.5 마이크로리터 낮은 EDTA 버퍼, DNA 폴리머의 마이크로리터 당 5 단위의 10 마이크로 리터를 추가하십시오.30초 동안 10초마다 분당 700회전에서 흔들림으로 섭씨 37도에서 75분간 반응을 배양합니다. 인큐베이션의 끝에서, 크로마틴에 결찰 믹스를 추가하고 철저한 부드러운 혼합과 16섭씨에서 하룻밤 동안 배양1 밀리리터 최종 반응 볼륨으로 조정합니다. 시료 단백질을 저하시키려면 밀리리터 단백질Ase K당 10밀리그램의 50마이크로리터를 튜브에 넣고 섭씨 37도에서 2시간 배양에 넣습니다.인큐베이션이 끝나면 밤새 온도를 섭씨 65도로 늘려 시료를 교차 연결합니다. 다음 날 아침, 밀리리터 RNA A.37도에서 1시간 후, 10마이크로리터의 10마이크로리터로 RNA를 분해하고, 1부피의 페놀 클로로폼을 튜브에 추가하고 반전을 통해 균질한 백색 상을 얻습니다. 표준 프로토콜에 따라 DNA를 침전시킨 후 제조업체의 지침에 따라 DNA와 불소계에 선택적으로 결합되는 불소염염을 사용하여 DNA를 정량화합니다.소화되지 않고 소화된 알리쿼트에서 DNA를 정화하려면 소화되지 않은 100나노그램의 소화되지 않은, 소화 및 계각 샘플을 1.5% 아가로즈 젤에 적재하고 소화된 시료에 500개의 베이스 쌍을 중심으로 한 얼룩을 찾아내고, 리게게드 된 시료에 대한 고분자 중량 대역에 대한 고분자 량 대역을 찾아보세요. 알려진 상호 작용의 증폭 및 소화에 의한 Hi-C 마킹 및 결찰 효율을 확인하기 위해, PCR 후, Mbo1, Cla1 또는 둘 다로 제품을 소화하고, 3C 및 Hi-C ligation 접합의 상대적 수의 추정을 허용하기 위해 새로운 1.5 ~ 2%젤에서 샘플을 실행한다. 200 ~ 500개의 염자 DNA 단편을 얻기 위해 시료를 초음파 처리한 후, 각 샘플에서 5마이크로그램의 DNA를 가진 130마이크로리터를 10X 결찰 버퍼 16마이크로리터, 10밀리머 dATP의 마이크로리터 2개, T4 DNA 폴리머라제 5개 소리터, 20도에서 20분 간 이중 증류수 7마이크로리터를 포함하는 새로운 마이크로센심심분리기 튜브로 이송합니다.인큐베이션의 끝에서는 10밀리머 dNTPs 5개, 10X 결찰 버퍼의 마이크로리터 4개, T4 폴리뉴클레오티드 키나아제 5개, DNA 폴리머라제 1개 마이크로리터 1개, 이중 증류수 25마이크로리터를 20분 동안 튜브에 25마이크로리터를 첨가한다. 주로 250 ~550베이스 쌍 크기 범위에서 단편을 선택하려면 제조업체의 지침에 따라 0.6X로 순차적인 고체 위상 가역 및 동원 크기 선택을 수행한 다음 100 마이크로리터의 TRIs 낮은 EDTA로 DNA를 엘ute하십시오. 각 라이브러리의 비오틴 풀다운의 경우, 스트렙타비딘과 연결된 마그네틱 비즈 150마이크로리터를 1X Tween 버퍼 400마이크로리터로 두 번 세척하고 회전 휠에서 3분 동안 샘플을 회전시로 회전시합니다.인큐베이션이 끝나면 2X 노 트위엔 버퍼의 300 마이크로리터로 구슬을 재연하고 300 마이크로리터의 Hi-C 재료와 혼합하여 회전 휠에서 30분 회전합니다. 인큐베이션이 끝나면 구슬을 0.5X Tween 버퍼 400마이크로리터로 세척하여 분당 섭씨 55도, 분당 750회전으로 3분간 배양하고, 세척당 1X 제한 완충제 200마이크로리터에 2개의 세척을 넣습니다. 두 번째 세척 후, 37섭씨에서 30분 동안 dATP 테일링 믹스 100마이크로리터로 구슬을 재차판으로 재보선다.인큐베이션의 끝에서, 1X 결찰 버퍼의 50 마이크로리터에서 구슬을 재연하고 4개의 마이크로리터 를 포함하는 새로운 튜브로 서스펜션을 이전하고 T4 리게아제의 2개의 마이크로리터를 사전 아닐로 한 쌍끝 어댑터로 옮긴다. 실온에서 2시간 후, 상체를 제거하고 400마이크로리터의 Tween 버퍼로 구슬을 두 번 세척한 다음, 트위엔 버퍼가 없는 200 마이크로리터로 한 번, 1X 제한 버퍼의 40 마이크로리터로 구슬을 다시 일시 중단합니다. Mbo1에 대한 제한이 성공할 때 200 ~ 1, 000 베이스 쌍의 얼룩이 관찰됩니다.결찰이 성공하면 겔 의 상부에서 높은 분자량 밴드가 관찰됩니다. 소화 효율은 또한 정량적인 PCR에 의해 확인될 수 있습니다. 허용 가능한 소화 효율은 80% 이상입니다.그림과 같이, Hi-C 결찰 제품에서 알려진 중거리 상호작용의 증폭은 증폭에서 회수된 PCR 제품의 소화에 의해 추정될 수 있다. 시퀀싱 후 라이브러리에 대해 유용하지 않은 읽기의 큰 비율을 사용하지 않도록 70 % 이상의 소화 효율을 권장합니다. 최종 증폭을 위한 PCR 사이클의 수는 얼룩이 보이는 사이클 수보다 한 주기 적어야 합니다.라이브러리의 소화 수준은 유효한 Hi-C 쌍의 풍부를 나타내며 라이브러리에서 얻을 수 있는 유용한 읽기의 비율을 반영합니다. 고유한 유효한 Hi-C 쌍을 사용하여 쌍 분포의 기본 분석을 수행할 수 있습니다. 이 대표적인 예에서 관찰된 바와 같이, NOTCH 유전자 궤적은 건축 단백질, 1 및 2개의 도메인 및 궤적을 따라 히스톤 수정과 함께 볼 수 있다.CTCF와 M1BP DNA 결합 부위를 모두 포함하는 영역의 삭제 시 크로마틴 접점의 극적인 변화를 관찰할 수 있다. Hi-C 실험 후, 프로모터 영역과 같은 특정 접접촉 집합에 도달하기 위해 수행될 수 있다. 이것은 큰 게놈을 평가할 때 특히 유용합니다.입증된 바와 같이, Hi-C 프로토콜과 유전적 첨가를 결합하면 유전체 원소의 구조적 및 조절 기능을 평가하는 데 사용될 수 있다.

Research

JoVE Journal

Genetics

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

In Situ Labeling of Mitochondrial DNA Replication in Drosophila Adult Ovaries by EdU Staining

에듀 염색에 의한 초파리 성인 난소에서 미토콘드리아 DNA 복제의 제자리 라벨에

The mitochondrial genome is inherited exclusively through the maternal line. Understanding of how the mitochondrion and its genome are proliferated and ...

연구

유전학

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Quantifying Abdominal Pigmentation in Drosophila melanogaster

복부 색소 침착 정량화<em&gt; Drosophila melanogaster</em

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions

발기인 캡처 안녕-c: 고해상도, 게놈 넓은 발기인 상호 작용의 프로 파일링

The three-dimensional organization of the genome is linked to its function. For example, regulatory elements such as transcriptional enhancers control the ...

Purification of Low-abundant Cells in the Drosophila Visual System

Drosophila 시각 시스템에서 낮은 풍부한 셀의 정화

Recent improvements in the sensitivity of next generation sequencing have facilitated the application of transcriptomic and genomic analyses to small ...

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

In Vivo Functional Study of Disease-associated Rare Human Variants Using Drosophila

Drosophila를 사용하여 질병 관련 희소한 인간 이체의 생체 내 기능적인 연구

Advances in sequencing technology have made whole-genome and whole-exome datasets more accessible for both clinical diagnosis and cutting-edge human ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

소독멜라노가스터에서 새로운 신경보호 유전자를 식별하기 위한 생체 전방 유전자 스크린

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Use of Drosophila S2 Cells for Live Imaging of Cell Division

Drosophila S2 cells are an important tool in studying mitosis in tissue culture, providing molecular insights into this fundamental cellular process in a ...

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

급성 골수성 백혈병 세포에서 CRISPR/Cas9 리보뉴클레오단백질에 의한 RUNX1 내성 소음기의 전사 적 역할 조사

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

A FACS-based Protocol to Isolate RNA from the Secondary Cells of Drosophila Male Accessory Glands

체미애 남성 액세서리 땀샘의 이차 세포에서 RNA를 분리하는 FACS 기반 프로토콜

To understand the function of an organ, it is often useful to understand the role of its constituent cell populations. Unfortunately, the rarity of ...

Detection of Post-Replicative Gaps Accumulation and Repair in Human Cells Using the DNA Fiber Assay

DNA 섬유 분석을 이용한 인간 세포에서의 복제 후 갭 축적 및 복구 검출

The DNA fiber assay is a simple and robust method for the analysis of replication fork dynamics, based on the immunodetection of nucleotide analogs that ...