Use of LeishGEdit CRISPR-Cas9 Technology for Genetic Manipulation of Protozoan Parasite Leishmania

Summary

The establishment of a robust CRISPR-Cas9 methodology for genetic manipulation of Leishmania has accelerated the understanding of key biological processes of this parasite. Here, we describe in detail all the steps to generate knockout or in situ fluorescent-tagged parasites of virtually any gene of interest using LeishGEdit methodology.

Abstract

The cell biology of a parasitic protozoan as well as the impact of the infection in host cells can be addressed using genome modification techniques. The development of robust methods eases the burden to obtain gene mutants and contributes to answer specific biological questions. Here we describe the LeishGEdit CRISPR-Cas9 high-throughput method that allows for Leishmania in situ gene tagging and deletion in a short span of time (7-10 days). Briefly, a transgenic cell line expressing SpCas9 and T7 RNA polymerase serves as the background for electroporation of DNA fragments generated by PCR: (1) a fragment containing a T7 promoter and the gene specific guide RNA expressed with a Cas9 scaffold; and (2) a homologous recombination (HR) fragment to introduce a resistance marker and/or a fluorescent tag/epitope to the desired genome location. Our protocol will cover (1) primer design, (2) DNA fragment production and confirmation, (3) transfection, and (4) cell line confirmation methods. We hope the article will allow for easy reproduction of the protocol for genome manipulation by CRISPR-Cas9 and make the method largely available to the parasitology community, enabling advances in the understanding of the biology of Leishmania and other protozoan pathogens of medical and veterinary importance.

Introduction

The leishmaniases are a group of neglected tropical diseases present in nearly 100 countries, caused by more than 20 species of parasites from the genus Leishmania. The disease can manifest as a self-healing cutaneous lesion, mucocutaneous lesion, or visceral disease, which if not treated can be fatal. According to the World Health Organization (WHO), around 1 million of new cases of cutaneous leishmaniasis and 50,000-100,000 cases of visceral leishmaniasis are reported annually, resulting in 20,000-30,000 deaths per year¹. During its life cycle Leishmania shifts between an invertebrate and a vertebrate host, forcing the parasite to adapt to different environmental conditions to survive and establish the infection². The mechanisms used by Leishmania to adapt to these conditions are still poorly understood and the application of methodologies that allow the genetic manipulation of the parasite can contribute to the understanding of the cellular pathways involved in these mechanisms. Indeed, this might also contribute to the identification of drug targets to the development of new and needed treatments for leishmaniasis.

The postgenomic era had significantly increased the understanding of Leishmania biology coupled to the development of genetic manipulation tools. For several years, attempts to genetically manipulate Leishmania were restricted to the use of homologous recombination-based gene replacement³. This significantly limited the success in obtaining gene deletion mutants, due to the need of at least two rounds of transfection and the compensatory effects in the parasite over time, reflected in the few examples of genes subjected to loss of function studies until recently⁴. Also, attempts to generate Leishmania null mutant parasites frequently resulted in the amplification of the gene of interest (GOI), even after several rounds of transfection⁵; chromosome copy number variation is a common compensatory adaptation mechanism that occurs in Leishmania in response to environmental changes^6,7. Fortunately, with the advent of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology this scenario has rapidly changed and these numbers have increased to more than 500 genes so far investigated^{8,9,10,11,12,13}.

Here we describe the CRISPR-Cas9 method recently developed by Eva Gluenz's group, called LeishGEdit, that was applied successfully in Old World and New World Leishmania species^14,15. The method is based on the transfection of a cell line expressing Streptococcus pyogenes Cas9 (SpCas9) nuclease and T7 RNA polymerase constitutively. The L. major ß-tubulin sequence was used for SpCas9 integration, and is compatible with most species of Leishmania, but depending on the conservation between the homologous loci of ß-tubulin this would need to be adapted. Alternatively, pTB007 can be transfected as a stable circular episome, as recently demonstrated in L. braziliensis¹⁶; the selection of transfectants can be performed using hygromycin B. The suitable antibiotic concentration will largely depend on the Leishmania species and specific strains and must be determined through titration curves prior to the experiments. It is important to mention that L. mexicana was used as the reference specie for all steps described in this protocol. The genetic modification is performed by electroporation of two DNA fragments generated by PCR; one corresponding to the cassette for expression of the guide RNA (sgRNA) from a T7 RNA polymerase promoter that determines the exact region where Cas9 will insert the double strand break on the DNA molecule (specific for the targeted gene); and the repair template, amplified from plasmids containing the marker gene for selection. This approach has been applied to in situ gene tagging and deletion of hundreds of genes of Leishmania mexicana, Leishmania braziliensis, Leishmania donovani, Leishmania major, Leishmania infantum^{7, 9,10,11, 16} and Trypanosoma brucei¹⁴; from DNA production/transfection, selection and validation, mutants (gene knockout and in situ tagging) can be produced in approximately 20 days¹⁴.

One of the many advantages of LeishGEdit toolbox is the availability of a bank of plasmids to be used as templates to generate the transfection DNA fragments by PCR, herein named repair template, for homologous recombination (HR) of tags at the 5' or 3'-end of the GOI or to delete genes or locus of Leishmania's genome. There are different plasmids for several experimental setups (e.g.: fluorescent tags, bioluminescent proteins, biotin ligase for proximity labelling assays, etc) and a number of resistance markers. The system also makes available a primer design script that can be accessed online (http://www.leishgedit.net/Home.html), which design primers compatible with the plasmid series (pPLOT and pT). Previously, it was shown that at least 100 nucleotides (nt) were required to allow for homologous recombination in wildtype Leishmania¹⁷. Using CRISPR-Cas9, repair templates containing target-specific 30 nt homology flanks are enough to promote homologous recombination allowing for addition of those regions into oligonucleotides, followed by common primer binding sites of pPLOT and pT, such that a single set of primers enables generation of gene deletion and fluorescent mutants, for example. In order to facilitate homologous recombination, Cas9 requires single guide RNAs for precise introduction of double strand breaks (DSB) into the genome. In LeishGEdit the system uses Leishmania heterologous expression of T7 RNA Polymerase and requires transfection of a PCR product produced using a forward primer containing the T7 promoter, the DSB target sequence without the PAM region, and a complementary SpCas9 scaffold, to be annealed with a universal reverse primer containing the entire SpCas9 recognition site of the final sgRNA (for sequence, please consult the materials section). Transcription from the T7 promoter begins with the GG adjacent to the target sequence, thereby extending the sgRNA by 2nt.

The LeishGEdit primer design tool provides six primer sequences for each given GOI:

(1) A primer with 30 nt for recombination upstream the GOI (upstream forward primer);

(2) A primer with 30 nt for recombination immediately downstream the GOI start codon (upstream reverse primer);

(3) A primer containing a sgRNA for DSB insertion at the 5' UTR of the GOI (5' sgRNA primer);

(4) A primer with 30 nt for recombination downstream the GOI (downstream forward primer);

(5) A primer with 30 nt for recombination immediately upstream the GOI stop codon (downstream reverse primer);

(6) A primer containing a sgRNA for DSB insertion at the 3' UTR of the GOI (3' sgRNA primer)

Although different CRISPR-Cas9 methods have been used for genetic manipulation of Leishmania parasites, varying from constitutive to transient expression of Cas9 and sgRNA; in vitro sgRNA transcription; transfection of recombinant Cas9-sgRNA complex (reviewed in¹⁸), the LeishGEdit methodology introduced here has been proven to be the most effective^8,13,14,15. One great advantage of this method is that there is no need for molecular cloning, PCR purifications or in vitro transcription steps prior to transfection, which allows generation of mutant parasites in a short span of time. Indeed, a collection of plasmids bearing different selection marker genes and/or "tags" (fluorescent or not), are available as templates to obtain the specific DNA fragments (repair cassettes) for gene deletion or in situ gene tagging. More information about this plasmid collection can be found at LeishGEdit online platform (http://www.leishgedit.net).

Since the establishment of LeishGEdit, two main improvements have been developed: (1) the possibility to introduce a barcode in the locus of the GOI for further phenotypic analyses using a large cohort of mutants, instead of performing individual experiments^8,9,10,13; and (2) the design of an inducible system combining the CRISPR-Cas9 and DiCre recombinase advantages that allow the study of essential genes^18,19,20. Though we have performed these methodologies in our laboratory, we will not describe them here and for more information, please consult references^18,21.

Thus, thanks to the LeishGEdit methodology, gene replacement in Leishmania has rapidly progressed from being cumbersome and time consuming to relatively straightforward, contributing to the understanding of key biological processes for this parasite. In this article, we provide a step-by-step protocol to facilitate its proper implementation and use for genetic manipulation of the parasite^{9,11,12,13,16,22,23}.

Protocol

1. Primer design for knockout and in situ tagging

1. To design GOI specific primers, enter the Tritrypdb (https://tritrypdb.org/tritrypdb/app) gene ID at the LeishGEdit website (www.leishgedit.net). First, select the option Primer Design and choose the strategy (N-terminal tagging; C-terminal tagging; Knockout; or Tagging and knockout) and the plasmid system (pT and pPLOT plasmids). See below the combination of primers necessary to generate the choice of mutants:
   1. For tagging (whether at the N- or C-terminus), use 3 primers:
      A 5'sgRNA primer or 3'sgRNA primer (for generating the DSB in 5' or 3' UTR, respectively);
      An upstream forward primer and upstream reverse primer (for generating the protein tag in frame with the corresponding gene in the N terminus);
      A downstream forward primer and downstream reverse primer (for generating the protein tag in frame with the corresponding gene in the C terminus).
   2. For gene disruption/deletion, use 4 primers:
      A 5'sgRNA primer and 3'sgRNA primer (for generating the DSB in 5' and 3' UTR of the gene/locus, respectively);
      An upstream forward primer (with a 30 nt homology arm located upstream to the 5' DSB)
      A downstream reverse primer (with a 30 nt homology arm located downstream to the 3' DSB)

2. Transfection DNA preparation

1. For transfection, generate the products for both the repair and the single guide RNA (sgRNA) templates by PCR. During PCR preparation, keep all reagents on ice.
   1. For amplification of the 5' and 3' sgRNA templates, prepare the following reaction: 2 µM of Reverse primer; 2 µM of Forward primer; 250 µM of dNTPs Mix; 3.5 mM of MgCl₂; 5 U of High-fidelity DNA Polymerase; and H₂O Milli-Q sufficient for 20 µL of reaction.
      1. Use the following thermocycler - PCR reaction conditions: 98 °C for 30 s; 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 15 s; then 72 °C for 10 min.
   2. For amplification of the HR fragment use the conditions below: 2 µM of Reverse primer; 2 µM of Forward primer; 125 µM of dNTPs Mix; 2 mM of MgCl₂; 30 ng of plasmid (template); 5 U of High-fidelity DNA Polymerase; and H₂O Milli-Q sufficient for 40 µL of reaction.
      1. Use the following thermocycler - PCR reaction conditions: 98 °C for 30 s; 35 cycles of 98 °C for 10 s, 60 °C for 30 s, 72 °C for 2 min 15 s; then 72 °C for 10 min.
   3. After PCR reactions, confirm the correct amplification of DNA fragments by running part of the samples (2 µL) on agarose gels; 0.8% for repair templates and 1.5% for sgRNAs cassettes, to check the presence of the expected product. PCR product purification prior transfection is recommended, but not mandatory.

3. Transfection and cell cloning

1. Cell culture and transfection
   1. Prepare Leishmania Cas9 T7Pol promastigote cell culture to be transfected. Cells must be in mid-logarithmic phase of proliferation (approx. 5.0-8.0 x 10⁶ cells/mL), usually a 48-72 h culture diluted 1:50 or 1:100 (depending on the Leishmania species) from a healthy and dense culture. Add the appropriate concentration of hygromycin for each parasite species to maintain Leishmania Cas9 T7Pol mutants. For L. mexicana we recommend 50 µg/mL of hygromycin. Cell culture media appropriate to Leishmania must be used, as M199 or HOMEM supplemented with 10% or 20% of heat inactivated fetal calf serum (HI-FCS), depending on the Leishmania species.
   2. Count parasites to obtain 2.0 x10⁷ cells per electroporation, including enough for a negative control (cells transfected with sterile water).
   3. Centrifuge cells at 1,000 x g for 10 min and wash it once with 1 mL of room temperature 1x PBS pH 7.4.
   4. Resuspend cells in filter-sterilized transfection buffer (66.7 mM Na₂HPO₄, 23.3 mM NaH₂PO₄, 5 mM KCl, 50 mM HEPES pH 7.3 supplemented with 150 µM CaCl₂)²⁴. Calculate the volume required as 150 µL or 200 µL per transfection for in situ tagging and gene KO, respectively. The DNA resuspended in sterile water or buffer must be considered in the final volume.
   5. Transfer cells into 0.2 mm gap electroporation cuvettes containing DNA prepared in step 2. Heat-sterilize repair templates and sgRNA cassettes (95 °C for 10 min followed by chilling in ice). Remember to prepare a cuvette with sterile water for the negative control.
   6. Place the cuvette in the electroporation device. There are protocols available for Leishmania electroporation using different devices^15,25.
   7. Immediately transfer 500 µL of pre-warmed culture media to electroporation cuvettes under sterile conditions, and then to 25 cm² non-vented flasks containing 5 mL of appropriate culture media supplemented with 20% of HI-FCS.
   8. Leave flasks on their sides to recover overnight at 26 °C.
2. Antibiotic selection and cloning
   1. For tagging and double marker KO add the appropriate concentration of antibiotic(s) to the electroporated cultures for selection of transfectants. For L. mexicana, we recommend 10 µg/mL of blasticidin, 75 µg/mL of puromycin and 50 µg/mL of G418.
   2. For single marker KO dilute the recovered culture 1:5 by adding 20 mL of culture media supplemented with 20% HI-FCS and appropriate concentration of selection antibiotic to the flasks. Reserve 2.5 mL in a 50 mL tube for further dilution.
   3. Dilute the reserved 2.5 mL culture (1:5) by adding 22.5 mL of culture media supplemented with 20% HI-FCS and appropriate concentration of selection antibiotic for a final dilution of 1:50. Reserve 2.5 mL of the 1:50 dilution and repeat step 3.2.3 for a final dilution of 1:500.
   4. Distribute the dilutions (1:5; 1:50; and 1:500) into three 96 well flat clear bottom plates by dispensing the culture in sterile reagent reservoirs and transferring 200 µL/well using a multichannel micropipette.
   5. Seal the plates with parafilm tape to avoid evaporation and pool the remains of the diluted cultures into a flask to be treated as a population to control for cell growth and recovery. This culture will not be used for further analysis, but can be diluted for 1 cell/well and plated after recovery in case no clones grow in the 1:5, 1:50 and 1:500 dilution plates.
   6. Incubate cultures at 26 °C, with flasks on their sides and plates in a wet-chamber to avoid wells to dry during selection. Populations (in situ tagging and double marker KO) must recover within 5-10 days, which may vary depending on the Leishmania species.
   7. After recovery (7-10 days), split population (1:10) into fresh culture media and resistance antibiotics before further analysis.
   8. After 10-15 days clones can be detected in positive wells (observed by changes in cell culture media color and opacity) and cell growth can be attested by checking wells under the microscope. Aspirate the 200 µL and add to 5 mL culture media with resistance antibiotics. Always try to select clones from more diluted plates where clones can be seen, and check at least 5 clones for each intended mutant (details on Part 4 of this protocol).
      ​NOTE: For null mutants, absence of recovery on population and cloning plates is an indication of gene essentiality. Transfections must be repeated to eliminate the possibility of technical failure.

4. Cell line confirmation

1. Confirmation of knockout cell lines
   NOTE: The first step to confirm the knockout cell lines is to obtain total genomic DNA of the clones selected previously. For that, there are several approaches that can be used. We recommend using a commercial genomic DNA extraction kit (please refer to the manufacturer instruction). Alternatively, use a standard DNA extraction protocol, as described below. Remember to prepare the parental cell line genomic DNA as well.
   1. Harvest the cells (~1x10⁸ total) by centrifugation at 3,500 x g for 10 min.
   2. Wash the pellet with 1x PBS.
   3. Add 300 µL of TELT buffer (50 mM Tris-HCl, pH 8.0; 62.5 mM EDTA pH 8.0; 2.5 mM LiCl; 4% Triton X-100). Lyse the cells by pipetting up and down a number of times.
   4. Add 300 µL of phenol/chloroform/isoamyl alcohol (25:24:1) and vortex vigorously for at least 30 s.
   5. Centrifuge the mixture at 13,000 x g for 15 min.
   6. Recover the aqueous phase and add 500 µL of 100% ethanol. Mix well and incubate at room temperature for 5 min.
   7. Centrifuge at 13,000 x g for 5 min.
   8. Discard the supernatant and wash the pellet with 1 mL of 70% ethanol.
   9. Centrifuge at 13,000 x g for 5 min. Discard the supernatant.
   10. Air dry the DNA at room temperature for 5-10 min.
   11. Dissolve the DNA in TE (10 mM Tris-HCl, pH 8.0; 1 mM EDTA pH 8.0) or water.
2. Confirmation of in situ tagged cells
   NOTE: There are a variety of fluorescent and non-fluorescent tags that can be used for in situ tagging and the methods used to confirm these cells will vary depending on the tag. For fluorescent tagged cells, a fast and easy way to confirm mutants is to perform flow cytometry, while the best way to confirm non-fluorescent tag is by Western blotting.
   1. Flow cytometry confirmation
      1. Harvest cells (parental and fluorescent tagged) by centrifugation at 3,000 x g for 5 min.
      2. Wash the pellet with 1x PBS and resuspend at a density of 10⁵-10⁶ cells/mL with 1x PBS. The cell density is important to keep the narrow bores of the flow cytometer and its tubing from clogging up.
      3. Set the equipment to collect 20,000 events inside the gate determined using the parental non-fluorescent cell line based on the forward scatter and side scatter of the population.
      4. Run samples using the desired laser, which will vary depending on the fluorescent protein being expressed in tandem with the GOI.
      5. Analyze the data comparing parental and fluorescent tagged cells to determine the percentage of positive cells (Figure 3A).
      6. To increase the positive cells, depending on the population, perform cell sorting for enrichment.
   2. Western blotting confirmation
      NOTE: Western blotting assays will be mandatory to in situ tagging with non-fluorescent tags for cell line confirmation, and very important to confirm if the expression of protein fused to fluorescent tags generate the expected size. It is important to mention that all LeishGEdit plasmids for in situ tagging with fluorescent tags also have a c-myc epitope, easing the confirmation of these cells by Western blotting with anti-c-myc antibody.
      1. Harvest parasites (parental and tagged) by centrifugation at 3,000 x g for 5 min. For confirmatory Western blotting assays 1x10⁷ cells are enough to obtain good results.
      2. Wash the pellet with 1x PBS and resuspend the cells with Sample Buffer (1x Laemmli buffer), and pipette up and down to lysis the parasites and obtain total protein extracts. For specific preparations, the use of a lysis buffer containing protease inhibitors may be required.
      3. Boil samples at 95 °C for 5 min and load in an SDS-PAGE gel. Bis-acrylamide concentration of the resolving gel will be determined based on the size of the proteins to be analyzed.
      4. After running the samples in SDS-PAGE gel, transfer the proteins to nitrocellulose or PVDF membranes. Use standard washing and incubation conditions with primary anti-c-myc tag antibody at suggested dilution of 1:2,500 and secondary antibody Goat Anti-Mouse (suggested 1:10,000). Secondary antibodies conjugated to peroxidase (HRP) can also be used. Our laboratory uses TBSt (Tris-buffered saline with 0.05% Tween-20) for washing steps and TBSt with 3% skimmed milk for blocking and dilution of the antibodies.
      5. Probe membranes with loading control primary antibodies, usually a highly constitutively expressed protein as tubulin, actin or aldolase. Fluorescent quantitative systems will allow for concomitant incubation of both primary antibodies, as long as they were produced in distinct animals, as mouse and rabbit, for example. Perform detection by incubating membranes with correspondent secondary antibodies conjugated with red and green fluorophores. For HRP-conjugated secondary antibodies, strip membranes and repeat Western blotting for loading control detection.
      6. Analyze the results using an available imaging system. It is expected to detect positive signals for samples from tagged cells and negative signals for parental cells (Figure 3B).
3. Fluorescence assays using in situ fluorescent tagged cells
   NOTE: Another approach to confirm as well as analyze the localization of the in situ tagged protein is by fluorescence microscopy. There are two ways to do that: direct fluorescence microscopy or immunofluorescence using the anti-c-myc tag antibody. We prefer the former method in our initial analyses, as detailed below.
   1. Collect 1x10⁷ cells (parental and fluorescent tagged) at mid-log phase by centrifugation at 2,000 x g for 3 min.
   2. Wash the pellet twice with 1x PBS and resuspend in 500 µL of 1x PBS.
   3. Fix the cells with paraformaldehyde 4% at room temperature for 15 min.
   4. Wash three times with 1x PBS and resuspend cells in 500 µL of 1x PBS.
   5. Spread cells on poly-L-lysine coated slides and incubate for 10 min.
   6. Wash three times with 1x PBS and incubate with a DNA intercalant as Hoechst 33342 (10 µg/mL) or DAPI (5 µg/mL). Incubate for 15 min.
   7. Wash three times with 1x PBS and mount the slides with PPD solution (Glycerol 90%+10% Tris HCl 30 mM, pH 8.0)
   8. Analyze slides in an epifluorescence microscope.

Results

The first step to generate knockout or in situ tagged cell lines of the GOI is to design the primers that will allow the preparation of the DNA fragments to be transfected for T7 RNAPol-based expression of sgRNAs in vivo, and the repair templates containing the desired tag and/or the selectable marker gene, to enable in situ tagging or gene deletion (Figure 1A), respectively. Figure 1B shows th...

Discussion

Leishmaniasis is a global health problem affecting millions of people every year, but despite the availability of the genome sequence of several Leishmania species has been available for years, genetic manipulation of this parasite was restricted to time-consuming and low efficient methods. The emergence of CRISPR-Cas9 technology changed this scenario and is contributing substantially to the better understanding of Leishmania biology, and potentially allow the development of new treatments for leis...

Materials

Name	Company	Catalog Number	Comments
Part I - Primer design for knockout and in situ tagging
pPLOT and pT plasmids			(www.leishgedit.net)
Primers	ThermoScientific		PCR primer design (www.leishgedit.net)
Universal sgRNA reverse primer (G00)	ThermoScientific		5' AAAAGCACCGACTCGG TGCCACTTTTTCAAGTTGA TAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCT AAAAC 3'
Part II - Transfection DNA preparation
1 kb Plus DNA Ladder	ThermoScientific	Cat: 10787018	Molecular weight standards for gel electrophoresis of DNA
Agarose	ThermoScientific	Cat: 16500500	Agarose gels
Ethidium bromide	Sigma Aldrich	Cat: E8751	Agarose gel
Disodium Salt dihydrate (EDTA)	Honeywell	Cat: 34549	TAE Buffer
dNTPs	ThermoScientific	Cat: 10297018	PCR mix
Glacial acetic acid	Anidrol	Cat: A-8684	TAE Buffer
Horizontal Electrophoresis Systems	Bio-Rad	Mini-Sub cell GT	Gel electrophoresis
Magnesium Chloride Anhydrous	Merck	Cat: 7786-30-3	PCR mix
PCR tubes	Sarstedt	Cat: 72.737002	Plastic material
pH meter	Oakton	75233	Calibrate pH solution
Platinum Taq Polymerase High Fidelity	ThermoScientific	Cat: 11304011	For amplification of DNA using PCR
Potassium chloride	Sigma Aldrich	Cat: 31248	Buffer 10x
Thermocycler	Bio-Rad	#1861096	PCR amplification
Tris Base	Fisher Bioreagents	Cat: BP152-1	Buffer 10x
Part III - Transfection and cloning
70% Ethanol	Honeywell	Cat: 02860	Sterilize
96 well cell culture plate	Greiner bio-one	Cat: 655180	Cell culture
Adenine	Interlab	Cat: 321-30-2	Cell culture medium supplement
Amaxa Nucleofector IIb	Lonza	AAB-1001	Cell transfection
Biotin	Sigma Aldrich	58-85-5	Cell culture medium supplement
Blasticidin S hydrochloride	Invivogen	Cat: ant-bl-1	Antibiotics for selection
Bottle Top Filter 0.22 μmm	Kasvi	Cat: K16-1500	Culture medium filter
Cell culture flask - 25 cm2	Sarstedt	Cat: 833910	Plastic material
Centrifuge	Thermo Electron Corporation	75004333	Centrifugation
Conical tubes 50 mL	Corning	Cat: 352070	Plastic material
Conical tubes 15 mL	Corning	Cat: 430766	Plastic material
di-Sodium Hydrogen Phosphate	AppliChem	Cat: 131678.1210	Transfection buffer
Electroporation Cuvettes 0.2 cm gap	Bio-Rad	Cat: 1652086	Transfection
Fetal Bovine Serum (FBS)	ThermoScientific	12657029	Cell culture medium supplement
Glass Pasteur pipets	Corning	Cat: 13-678-4A	Glass material
Geneticin (G418)	Invivogen	Cat: ant-gn-5	Antibiotics for selection
HEPES	Fisher Bioreagents	Cat: BP310-500	Transfection buffer
Hygromycin B	Invivogen	Cat: 10687010	Antibiotics for selection
Incubator	Tecnal	TE-371	Cells maintenance
Inverted microscope	Labomed	TCM 400	Microscope
Medium 199	ThermoScientific	Cat: 31-100-019	Cell culture medium
Microcentrifuge	Eppendorf	5417C	Centrifugation
Microtube 1.5 mL	Sarstedt	Cat: 72.690001	Plastic material
Multichannel Pipette (p200)	HTL Lab Solutions	6283	Pipette reagents
Muse Cell Analyzer	Merck Millipore	0500-3115	Cell counter
Penicillin G	Interlab	Cat: 69-57-1	Cell culture medium supplement
Puromycin dihydrochloride	Invivogen	Cat: ant-pr-5b	Antibiotics for selection
Serological pipette 10 mL	Sarstedt	Cat: 861254001	Plastic material
Serological pipette 5 mL	Sarstedt	Cat: 861253001	Plastic material
Single Channel Pipette (p1000)	HTL Lab Solutions	LMP-1000	Pipette reagents
Single Channel Pipette (p200)	HTL Lab Solutions	LMP-200	Pipette reagents
Single Channel Pipette (p10)	HTL Lab Solutions	LMP-10	Pipette reagents
Single Channel Pipette (p2)	HTL Lab Solutions	LMP-2	Pipette reagents
Sodium bicarbonate	Fisher Bioreagents	Cat: 144-55-8	Cell culture medium supplement
Sodium Phosphate Monobasic	USB Corporation Cleveland	Cat: 20233	Transfection buffer
Streptomycin sulfate salt	Gibco	Cat: 11860-038	Cell culture medium supplement
Syringe Filter 0.2 μmm	ForlabExpress	Cat: K18-230	Filter transfection buffer
Syringe 10 mL	Interlab	Cat: 990173	Plastic material
Part IV - Cell line confirmation and phenotyping
Accuri C6	BD Biosciences	-	Flow cytometer
Ammonium persulfate (APS)	Sigma-Aldrich	Cat: A3678	Casting polyacrylamide gel
Confocal fluorescence microscope	Leica	TCS SP5 II Tandem Scanner	Microscopy
Coverslip	Glasstecnica	Lot: 44888/08	Glass material
Digital Shaker	Labnet	S2030-1000-B	Agitation
Goat Anti-Mouse 800CW antibody	LI-COR Biosciences	Cat: 926-32210	Western blot antidoby
Goat Anti-Rabbit 680RD antibody	LI-COR Biosciences	Cat: 926-68071	Western blot antidoby
Hoechst 33342	Invitrogen	Cat.: H3570	Fluorescence antidoby
Imaris software	Imaris	Version: 6.0	Data analysis
LiCl	Sigma-Aldrich	L4408	TELT solution preparation
Microscope slides	Tekdon Incorporated	Cat: 258-041-120	Glass material
Monoclonal c-Myc epitope antibody	EMD Millipore	Cat: 05-724	Western blot antidoby
Nitrocellulose membrane	Bio-Rad	#1620115	Protein Blotting
Non-fat milk	Molico	-	Blocking solution for Western Blot
Odyssey Fc Imaging System	LI-COR Biosciences	Model number 2800	Antibodies detection
Paraformaldehyde (PFA)	Sigma Aldrich	Cat: P6148	Fixation for fluorescence
PBS 1X	house made	house made	Neutral Buffer
Poly-L-lysine	Sigma Aldrich	Cat: P8920	Adhesion for fluorescence
Polyacrylamide	Invitrogen	Cat: 15512023	Casting denaturing polyacrylamide gel
Polyclonal Aldolase antibody	house made	house made	Western blot antidoby
Protein Ladder	LI-COR Biosciences	928-60000	Ladder
Sample Buffer	Sigma-Aldrich	S3401-1VL	Lysis solution
Sodium dodecyl sulfate (SDS)	Sigma-Aldrich	Cat: L3771	Casting polyacrylamide gel
TEMED	Life Technologies	Cat: 15524-010	Casting polyacrylamide gel
Triton X-100	Sigma-Aldrich	X-100	TELT solution preparation
Wet blotting system	Bio-Rad	1703930	Gel transfer cell