Megan Stanifer and Steeve Boulant were supported by research grants from the Deutsche Forschungsgemeinschaft (DFG): (Project number 240245660, 278001972, 415089553, and 272983813 to Steeve Boulant and 416072091 to Megan Stanifer), the state of Baden-Wuerttemberg and the Bundesministerium f&#252;r Bildung und Forschung BMBF 01KI20239B to MS and 01KI20198A and&#160;(NUM-COVID 19, Organo-Strat 01KX2021) to SB. Schematics were created in BioRender.

<ol>
	<li>Kretzschmar, K., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoids:+Modeling+development+and+the+stem+cell+niche+in+a+dish.">Organoids: Modeling development and the stem cell niche in a dish.</a> Developmental Cell. 38, 590-600 (2016).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141, 1762-1772 (2011).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459, 262-265 (2009).</li><li>Tekes, G., Ehmann, R., Boulant, S., Stanifer, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+feline+ileum-+and+colon-derived+organoids+and+their+potential+use+to+support+feline+coronavirus+infection.">Development of feline ileum- and colon-derived organoids and their potential use to support feline coronavirus infection.</a> Cells. 9, (2020).</li><li>Derricott, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Developing+a+3D+intestinal+epithelium+model+for+livestock+species.">Developing a 3D intestinal epithelium model for livestock species.</a> Cell and Tissue Research. 375, 409-424 (2019).</li><li>Zhou, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infection+of+bat+and+human+intestinal+organoids+by+SARS-CoV-2.">Infection of bat and human intestinal organoids by SARS-CoV-2.</a> Nature Medicine. 26, 1077-1083 (2020).</li><li>Sato, T., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growing+self-organizing+mini-guts+from+a+single+intestinal+stem+cell:+mechanism+and+applications.">Growing self-organizing mini-guts from a single intestinal stem cell: mechanism and applications.</a> Science. 340, 1190-1194 (2013).</li><li>Spence, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+differentiation+of+human+pluripotent+stem+cells+into+intestinal+tissue+in+vitro.">Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro.</a> Nature. 470, 105-109 (2011).</li><li>de Graaf, M., van Beek, J., Koopmans, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+transmission+and+evolution+in+a+changing+world.">Human norovirus transmission and evolution in a changing world.</a> Nature Reviews Microbiology. 14, 421-433 (2016).</li><li>Leshem, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-world+effectiveness+of+pentavalent+rotavirus+vaccine+among+bedouin+and+jewish+children+in+southern+Israel.">Real-world effectiveness of pentavalent rotavirus vaccine among bedouin and jewish children in southern Israel.</a> Clinical Infectious Diseases : An Official Publication of the Infectious Diseases Society Of America. 62, 155-160 (2016).</li><li>Karst, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+influence+of+commensal+bacteria+on+infection+with+enteric+viruses.">The influence of commensal bacteria on infection with enteric viruses.</a> Nature Reviews Microbiology. 14, 197-204 (2016).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell-derived+human+enteroids.">Replication of human noroviruses in stem cell-derived human enteroids.</a> Science. 353, 1387-1393 (2016).</li><li>de Wit, E., van Doremalen, N., Falzarano, D., Munster, V. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SARS+and+MERS:+recent+insights+into+emerging+coronaviruses.">SARS and MERS: recent insights into emerging coronaviruses.</a> Nature Reviews Microbiology. 14, 523-534 (2016).</li><li>Scaldaferri, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thrilling+journey+of+SARS-CoV-2+into+the+intestine:+From+pathogenesis+to+future+clinical+implications.">The thrilling journey of SARS-CoV-2 into the intestine: From pathogenesis to future clinical implications.</a> Inflammatory Bowel Diseases. 26, 1306-1314 (2020).</li><li>Kipkorir, V., Cheruiyot, I., Ngure, B., Misiani, M., Munguti, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+SARS-CoV-2+RNA+detection+in+anal/rectal+swabs+and+stool+specimens+in+COVID-19+patients+after+negative+conversion+in+nasopharyngeal+RT-PCR+test.">Prolonged SARS-CoV-2 RNA detection in anal/rectal swabs and stool specimens in COVID-19 patients after negative conversion in nasopharyngeal RT-PCR test.</a> Journal of Medical Virology. 92, 2328-2331 (2020).</li><li>Lamers, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SARS-CoV-2+productively+infects+human+gut+enterocytes.">SARS-CoV-2 productively infects human gut enterocytes.</a> Science. 369, 50-54 (2020).</li><li>Stanifer, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+role+of+type+III+interferon+in+controlling+SARS-CoV-2+Infection+in+human+intestinal+epithelial+cells.">Critical role of type III interferon in controlling SARS-CoV-2 Infection in human intestinal epithelial cells.</a> Cell Reports. 32, 107863 (2020).</li><li>Triana, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+transcriptomics+reveals+immune+response+of+intestinal+cell+types+to+viral+infection.">Single-cell transcriptomics reveals immune response of intestinal cell types to viral infection.</a> bioRxiv. , (2020).</li><li>Triana, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+analyses+reveal+SARS-CoV-2+interference+with+intrinsic+immune+response+in+the+human+gut.">Single-cell analyses reveal SARS-CoV-2 interference with intrinsic immune response in the human gut.</a> Molecular Systems Biology. 17, 10232 (2021).</li><li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=mRNA-Seq+whole-transcriptome+analysis+of+a+single+cell.">mRNA-Seq whole-transcriptome analysis of a single cell.</a> Nature Methods. 6, 377-382 (2009).</li><li>Hwang, B., Lee, J. H., Bang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+RNA+sequencing+technologies+and+bioinformatics+pipelines.">Single-cell RNA sequencing technologies and bioinformatics pipelines.</a> Experimental &amp; Molecular Medicine. 50, 1-14 (2018).</li><li>Garc&#237;a-Rodr&#237;guez, I., Sridhar, A., Pajkrt, D., Wolthers, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Put+some+guts+into+it:+Intestinal+organoid+models+to+study+viral+infection.">Put some guts into it: Intestinal organoid models to study viral infection.</a> Viruses. 12, 1288 (2020).</li><li>Stanifer, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Asymmetric+distribution+of+TLR3+leads+to+a+polarized+immune+response+in+human+intestinal+epithelial+cells.">Asymmetric distribution of TLR3 leads to a polarized immune response in human intestinal epithelial cells.</a> Nature Microbiology. 5, 181-191 (2020).</li><li>Lees, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+human+induced+pluripotent+stem+cell-derived+intestinal+organoids+to+study+and+modify+epithelial+cell+protection+against+salmonella+and+other+pathogens.">Using human induced pluripotent stem cell-derived intestinal organoids to study and modify epithelial cell protection against salmonella and other pathogens.</a> Journal of Visualized Experiments: JoVE. (147), e59478 (2019).</li><li>Mahe, M. M., Sundaram, N., Watson, C. L., Shroyer, N. F., Helmrath, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+human+epithelial+enteroids+and+colonoids+from+whole+tissue+and+biopsy.">Establishment of human epithelial enteroids and colonoids from whole tissue and biopsy.</a> Journal of Visualized Experiments: JoVE. (97), e52483 (2015).</li><li>Fujii, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Intestinal+organoids+maintain+self-renewal+capacity+and+cellular+diversity+in+niche-inspired+culture+condition.">Human Intestinal organoids maintain self-renewal capacity and cellular diversity in niche-inspired culture condition.</a> Cell Stem Cell. 23 (6), 787-793 (2018).</li><li>Bartfeld, S., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoids+as+model+for+infectious+diseases:+Culture+of+human+and+murine+stomach+organoids+and+microinjection+of+Helicobacter+Pylori.">Organoids as model for infectious diseases: Culture of human and murine stomach organoids and microinjection of Helicobacter Pylori.</a> Journal of Visualized Experiments: JoVE. (105), e53359 (2015).</li><li>Hernandez, P. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon-lambda+and+interleukin+22+act+synergistically+for+the+induction+of+interferon-stimulated+genes+and+control+of+rotavirus+infection.">Interferon-lambda and interleukin 22 act synergistically for the induction of interferon-stimulated genes and control of rotavirus infection.</a> Nature Immunology. 16, 698-707 (2015).</li></ol>

The authors declare no competing financial interests.

Enteric pathogens most often initiate their lifecycle by infecting intestinal epithelial cells from their apical side facing the lumen of the gut. While organoids are well recognized to be a good model to reproduce the cellular complexity and organization of the intestinal epithelium, their organization as three-dimensional, closed structures make their apical membrane inaccessible to the pathogen. This protocol described methods for infecting intestinal organoids from their apical side, their basolateral side, or both with BLS-3 pathogens. These protocols can easily be adapted to study any enteric pathogen under BSL-2 or BLS-3 containment or any other organoid model by following a few critical steps that are highlighted below. The method described above is for the isolation and preparation of single-cell droplets in accordance with the regulations in Germany. As a disclaimer, this protocol does not describe the biosafety handling measures (standard operating procedures) that need to be taken while working under BSL-3 conditions. It is also important to insist that the regulations may vary in other countries and that the local authorities must be contacted to make sure that all local regulations are respected.
One of the critical steps in seeding organoids in two dimensions for apical infection is controlling that cells will similarly differentiate compared to when grown as classical three-dimensional organoids. Depending on the enteric pathogen, tropism could be restricted to very rare cells or to cells that need to be highly differentiated. In this case, using a two-dimensional organoid that did not fully differentiate could result in the misconclusion that this enteric pathogen cannot infect intestinal organoids. It is suggested, if possible, to perform infections using the three configurations of this protocol: 2D organoid for apical infection only (section 2), cracked open 3D organoids for apical and basolateral infection (section 3), and full 3D organoids for basolateral infection only (section 3). This approach will help to discern the entry route of the pathogen (apical vs. basolateral) and will also control that a similar level of differentiation has been achieved. An alternative for 2D apical infection is microinjection, which will use a 3D organoid but deliver the pathogen directly into the apical side (see Bartfeld et al.27 for details). This method requires a skilled injector to ensure that the pathogen is properly placed, and the organoids remain intact. Microinjection is commonly used in BSL-2 containment and may not be suitable for BSL-3 containment.
An additional important consideration when performing infection experiments in 2D seeded organoids is the final cell density. As mentioned in step 2.3, 100-150 organoids will be seeded in one well of a 48-well plate or one well of an 8-well glass-bottom chamber slide. Depending on the organoid line and on the person handling the organoids, the size of these organoids can be significantly different. This could result in very different cell densities in the 48-well plate or 8-well glass-bottom chamber slide. Depending on the enteric virus, some viruses prefer more sparse cells, while others will also be able to infect confluent cells. The molecular origin of such differences in infectivity for different cell confluences is not clear; therefore, pilot experiments aiming at finding the best cell density for the enteric pathogen of choice should be performed prior to performing further downstream characterization.
Often FACS sorting is performed prior to performing the single-cell droplet emulsion. This step is often used to separate dead from live cells and single cells from doublets. When working with BSL-3 pathogens, it requires that the facility is equipped with an appropriate FACS sorter, which is not often the case. Further, not all cells in an organoid have the same size, and it is often hard to discriminate between a doublet or a larger cell, thereby causing a risk of negatively selecting against a specific cell type. Also, there is still discussion in the field whether the time needed for sorting between 5,000-10,000 for each sample could result in a significant modification of the transcript profile of the individual cells. While cell fixation methods compatible with single-cell sequencing (e.g., methanol and RNAassist) have been described, it was observed that this leads to a decrease in the quality of sequencing18. Finally, it is suspected that sorting cells using cell death markers can also lead to a bias. Given the directional proliferation and differentiation of the cells through the crypt-villi axis, the most differentiated cells, which are going to be shed and released, are located at the tip of the villi. These cells are often positive for different markers of cell death pathways (e.g., apoptosis, necrosis, and necroptosis); however, when looking at rotavirus infection of mouse intestine, the tip of the villi is the most infected area28. Thus, filtering out cells that may look positive for death markers would result in a negative selection of the infected cells that may represent the physiological infection. Currently, there is no good solution for sorting and fixing organoids prior to single-cell sequencing. Using live, unsorted cells is recommended as further studies are needed to find suitable alternative protocols.
Single-cell sequencing has revolutionized how cellular responses can be evaluated. This technique allows for the identification of cell lineage-specific responses both in basal conditions and under pathogen infections. This method has opened doors in many fields that were previously limited by bulk readouts. While this method is very powerful, it has its limitations. A key limitation is the extensive bioinformatic analysis that is required downstream of the sequencing. This is especially key when analyzing tissues and assigning cell types where there is currently no annotation. Having a skilled bioinformatician is required to support all single-cell studies.
This protocol describes how to seed and handle human intestinal organoids, infect them with enteric pathogens, and perform scRNAseq. Adapting this approach to other organs is now possible, as organoid model systems have been developed for most organs. Lung and liver organoids are similarly organized compared to intestinal organoids, and as such, using an analogous approach could be transposed to these organoids. The critical control will be to validate that when grown in two dimensions or cracked open, these organoids achieve similar differentiation as their 3D organoid counterparts. The specific features and genes that define a differentiated status are specific for each organ model. Other organoid models such as kidney and vascular organoids, large dense structures, will need additional methods to serially dissociate these structures into single cells.

Studying the cell type-specific tropism and cell type-specific immune response to human enteric viruses has been historically challenging due to the lack of primary human cellular models. This limitation has now been partially eradicated with the development of organoids1. In the case of the gastrointestinal tract, gastric and intestinal organoid models have been developed for humans and several other species (e.g., murine, bovine, feline, bat)2,3,4,5,6. Intestinal organoids reproduce the structural architecture of the human intestinal epithelium and contain crypt and villi-like structures, functional intestinal lineages and have even been used to identify previously unknown cell lineages. Two different approaches can be used to grow intestinal organoids. First, intestinal stems cells containing crypts are isolated from tissue resections or biopsies and grown under specific culture conditions (e.g., Wnt3A, R-spondin, Noggin, and EGF) to expand, and then differentiate the stem cells to most intestinal cell lineages (e.g., enterocytes, Paneth cells, Goblet cells, enteroendocrine cells)7. This method allows for the isolation of organoids from all sections of the gastrointestinal tract (e.g., stomach, duodenum, jejunum, ileum, and colon). The second method relies on human-induced pluripotent or embryonic stem cells, which are then differentiated in a stepwise process into intestinal epithelial cells8. These induced stem-cell-based organoids are often described as being more embryonic in nature as compared to patient-derived organoids. While all these organoid models have been critical to unraveling developmental cues needed to form the intestinal tract, their use in infectious disease research is still in its infancy.
Enteric virus is a broad term covering all viruses, which infect through the gastrointestinal tract, such as picornaviruses (e.g., EV-71), reoviruses (e.g., rotavirus), and caliciviruses (e.g., norovirus)9. Enteric viruses initiate their infectious life cycle through the ingestion of contaminated food and water, which leaves people in developing countries at high risk due to the discharge of untreated waste into the environment and lack of medical care after the onset of infection10. Depending on the type of pathogen, the infection can lead to gastroenteritis, vomiting, and/or watery diarrhea due to leakage of the intestinal lining. Human noroviruses are a highly prevalent and highly infectious enteric pathogen, that lead to over 600 million infections and 15 million hospitalizations worldwide11. Organoids have been key to norovirus research as they support the infection and replication of human norovirus, which was previously unable to be cultured in standard cell culture models12.
Over the past two decades, coronaviruses have emerged as key human pathogens13. This family includes the highly pathogenic MERS, SARS-CoV-1, and SARS-CoV-2, which require strict safety level containments when performing research on these viruses. Interestingly, while all three of these pathogens are mostly recognized for their induced respiratory symptoms and distress, it is now evident that these viruses do not solely infect the respiratory tract but also other organs. An important pathology induced in SARS-CoV-2 infected patients besides the respiratory distress is the presence of gastrointestinal symptoms14. A fraction of SARS-CoV-2 infected patients displays such symptoms, ranging from very mild to severe diarrhea. Additionally, SARS-CoV-2 genomes can be detected in stool and gastrointestinal tract biopsies of infected patients15. Importantly the presence of gastrointestinal symptoms is not limited to SARS-CoV-2 as they were also observed in MERS and SARS-CoV-1 infected patients. To understand how SARS-CoV-2 induces gastrointestinal distress and precisely identify the tropism of SARS-CoV-2 in the gastrointestinal tract, human intestinal organoids have been a key tool and are now exploited to unravel cell type-specific responses to this pathogen16,17.
Transcriptional profiling of a cell population (bulk RNA sequencing) has been standard practice when evaluating pathogen infections of both immortalized cell lines as well as with organoids. While this allows us to determine global changes in response to pathogens (e.g., upregulation of cytokines), bulk RNAseq does not allow us to determine why specific cells in a population are more prone to infection than others. Single-cell RNA sequencing (scRNAseq) has become a powerful tool to unravel cell lineage-specific transcriptional programs and can be used to determine how these programs support or repress virus infection18,19. The first description of scRNAseq was in 2009 and was used to evaluate the transcription profiles of the different cells found in a mouse blastomere20. These technologies have now been expanded and can be implemented through several different platforms. Early versions of this technology applied fluorescence-activated cell sorter (FACS) to separate individual cells for sequencing, which was often limited to 96- or 384-well plates, thereby giving 300 individual cells to analyze per sample21. These methods have now been advanced by the single-cell sequencing platforms, which use a microfluidic device to encapsulate single cells into individual droplets with barcode containing beads. This technology allows for up to 10,000 cells to be captured per sample condition.
Combining organoids technology with scRNAseq allows us to study how enteric pathogens impact the gastrointestinal tract in a cell type-specific manner. However, several technical and biosafety considerations need to be taken. First and foremost, classical organoids culture methods (3-dimensional (3D) organoids, embedded in an extracellular matrix (ECM)) expose the basolateral side of the epithelial cells to the outside of the organoid. As enteric pathogens initiate their infection through ingestion of contaminated food/water, the infection most often initiates from the apical side of the cells, which is not accessible in these 3D intestinal organoids. Therefore, organoids need to be prepared to make the apical side accessible for pathogen infection either through 2D seeding, thereby directly exposing the apical side of the cells, or through microinjection22,23. Second, to perform scRNAseq of infected biological samples, it is important to consider their infectious nature. While methods to fix cells and inactivate pathogens prior to single-cell isolation for subsequent RNAseq have been proposed, these methods often lead to a decrease in sequencing quality18. The protocol below will describe several approaches to infect intestinal organoids with enteric viruses considering the infection side (apical vs. basolateral infection) (Figure 1). Additionally, the protocol will include a workflow to dissociate and isolate single cells from organoids infected with highly pathogenic viruses for scRNAseq. The protocol will highlight the key steps that need to be implemented when working under biosafety level-3 (BSL-3) containment conditions to avoid the generation of aerosols and potential contamination.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>&#160;Recombinant mouse noggin</td>
			<td>Peprotech</td>
			<td>Cat#250-38</td>
			<td></td>
		</tr>
		<tr>
			<td>[Leu15]-Gastrin I</td>
			<td>Sigma-Aldrich</td>
			<td>Cat# G9145</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat#25300054</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well non-cell culture treated plate</td>
			<td>Corning</td>
			<td>Cat#3738</td>
			<td></td>
		</tr>
		<tr>
			<td>8-well glass bottom chamber slide</td>
			<td>iBIDI</td>
			<td>Cart#80827</td>
			<td></td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>Tocris</td>
			<td>Cat#2939</td>
			<td></td>
		</tr>
		<tr>
			<td>Advanced DMEM/F12</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat# 12634010</td>
			<td></td>
		</tr>
		<tr>
			<td>B27</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat#17504-044</td>
			<td></td>
		</tr>
		<tr>
			<td>Chromium Controller &#38; Next GEM Accessory Kit</td>
			<td>10X Genomics</td>
			<td>Cat#1000202</td>
			<td>Used in the preparation of single cell solution and preparation of Gel beads-in-emulsion (GEM)</td>
		</tr>
		<tr>
			<td>Chromium Next GEM Chip G Single Cell Kit</td>
			<td>10X Genomics</td>
			<td>Cat #1000127</td>
			<td>Used in the preparation of single cell solution and preparation of Gel beads-in-emulsion (GEM)</td>
		</tr>
		<tr>
			<td>Chromium Next GEM Single Cell 3&#8242; Kit v3.1</td>
			<td>10X Genomics</td>
			<td>Cat#1000268</td>
			<td>Used in the preparation of single cell solution and preparation of Gel beads-in-emulsion (GEM)</td>
		</tr>
		<tr>
			<td>Collagen from human placenta</td>
			<td>Sigma Aldrich</td>
			<td>Cat#C5533-5MG</td>
			<td></td>
		</tr>
		<tr>
			<td>CYP34A forward</td>
			<td>Eurofins</td>
			<td>GATGGCTCTCATCCCAGACTT</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>CYP3A4 reverse</td>
			<td>Eurofins</td>
			<td>AGTCCATGTGAATGGGTTCC</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat#11320074</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma Aldrich</td>
			<td>Car#E9884</td>
			<td></td>
		</tr>
		<tr>
			<td>Fast Read 102 counting slides</td>
			<td>Biosigma</td>
			<td>Cat# BVS100</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovein Serum (FBS)</td>
			<td>Capricorn</td>
			<td>Cat#FBS-12A</td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMAX</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat# 35050061</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat3 15630080</td>
			<td></td>
		</tr>
		<tr>
			<td>L-WRN cells</td>
			<td>ATCC</td>
			<td>CRL-3276</td>
			<td>This cell line is used to make the conditioned media containg Wnt 3A, R-Spondin and Noggin. The protocol for the production of the conditioned media can be found on the manufacterures site.</td>
		</tr>
		<tr>
			<td>MatriGel. GFR, LDEV free</td>
			<td>Corning</td>
			<td>Cat#354230</td>
			<td></td>
		</tr>
		<tr>
			<td>MUC-2 forward</td>
			<td>Eurofins</td>
			<td>TGTAGGCATCGCTCTTCTCA</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>MUC-2 reverse</td>
			<td>Eurofins</td>
			<td>GACACCATCTACCTCACCCG</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>N-acetyl-cysteine</td>
			<td>Sigma Aldrich</td>
			<td>Cat# A9165</td>
			<td></td>
		</tr>
		<tr>
			<td>OLMF4 forward</td>
			<td>Eurofins</td>
			<td>ACCTTTCCCGTGGACAGAGT</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>OLMF4 reverse</td>
			<td>Eurofins</td>
			<td>TGGACATATTCCCTCACTTTGGA</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat#15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant human FGF basic</td>
			<td>Peprotech</td>
			<td>Cat#100-18B</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant human IGF-1</td>
			<td>BioLegend</td>
			<td>Cat#590904</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant mouse EGF</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat# PMG8043</td>
			<td></td>
		</tr>
		<tr>
			<td>SI forward</td>
			<td>Eurofins</td>
			<td>AATCCTTTTGGCATCCAGATT</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>SI reverse</td>
			<td>Eurofins</td>
			<td>GCAGCCAAGAATCCCAAT</td>
			<td>Primers used to check for differentiation</td>
		</tr>
		<tr>
			<td>TrypLE Express</td>
			<td>Thermo Fischer Scientific</td>
			<td>Cat#12605036</td>
			<td></td>
		</tr>
		<tr>
			<td>Y-27632</td>
			<td>Caymann Chemicals</td>
			<td>Cat#10005583</td>
			<td></td>
		</tr>
	</tbody>
</table>

adapting gastrointestinal organoids for pathogen infection and single cell sequencing under biosafety level 3 (bsl-3) conditions

Human intestinal organoids constitute the best cellular model to study pathogen infections of the gastrointestinal tract. These organoids can be derived from all sections of the GI tract (gastric, jejunum, duodenum, ileum, colon, rectum) and, upon differentiation, contain most of the cell types that are naturally found in each individual section. For example, intestinal organoids contain nutrient-absorbing enterocytes, secretory cells (Goblet, Paneth, and enteroendocrine), stem cells, as well as all lineage-specific differentiation intermediates (e.g.,&#160;early or immature cell types). The greatest advantage in using gastrointestinal tract-derived organoids to study infectious diseases is the possibility of precisely identifying which cell type is targeted by the enteric pathogen and to address whether the different sections of the gastrointestinal tract and their specific cell types similarly respond to pathogen challenges. Over the past years, gastrointestinal models, as well as organoids from other tissues, have been employed to study viral tropism and the mechanisms of pathogenesis. However, utilizing all the advantages of using organoids when employing highly pathogenic viruses represents a technical challenge and requires strict biosafety considerations. Additionally, as organoids are often grown in three dimensions, the basolateral side of the cells is facing the outside of the organoid while their apical side is facing the inside (lumen) of the organoids. This organization poses a challenge for enteric pathogens as many enteric infections initiate from the apical/luminal side of the cells following ingestion. The following manuscript will provide a comprehensive protocol to prepare human intestinal organoids for infection with enteric pathogens by considering the infection side (apical vs. basolateral) to perform single-cell RNA sequencing to characterize cell-type-specific host/pathogen interactions. This method details the preparation of the organoids as well as the considerations needed to perform this work under biosafety level 3 (BSL-3) containment conditions.

Preparation of organoids for single-cell sequencing 
Single-cell sequencing results are highly dependent on using good quality cells. To ensure that organoids are of good quality, they should be properly maintained and observed on a daily basis to determine when they are ready to be split (Figure 2). The timing of splitting organoids is donor-dependent; some donors grow more quickly and need to be split every 5 days, while others are slower and need to be split every 10 days. On average, organoids are split one time per week when the centers become dark (Figure 2B). If organoids are allowed to become too large and accumulate too many dead cells in the center, the organoid will die.
Organoids are maintained in a media that contains high amounts of Wnt3A. This supports the stem cell niche and promotes the organoids to continue to grow and proliferate. Under these growth conditions, the organoids contain high amounts of stem cells and transit-amplifying cells and a lower amount of differentiated cell populations such as mature enterocytes, Goblet cells, and enteroendocrine cells. However, to mimic the cellular complexity found within the human intestine, it is important to push cell differentiation and produce more of these cells. This is accomplished by changing the media conditions and removing Wnt3A, and reducing R-Spondin and Noggin (Table 1). Normally, cellular differentiation toward enterocytes, Goblet cells, and enteroendocrine cells requires 4 days of differentiation media (Figure 3). It is key to obtain a good differentiation; otherwise, evaluating pathogen tropism and cell type-specific responses will become difficult.
Confirmation of BSL-3 pathogen inactivation 
Full inactivation must be confirmed with the pathogen of choice and validated that it is safe to remove the cDNA from the BSL-3.&#160;For SARS-CoV-2, full inactivation of the virus was validated by taking 100 &#956;L of SARS-CoV-2 and incubating it in a PCR machine for 5 min at 85 &#176;C. The virus was then added back to na&#239;ve Vero cells, and virus infection was compared to non-heat treated virus by immunofluorescence and plaque assays at 24 h, 48 h, and 72 h post-infection to ensure that all particles were no longer infectious. These results were sent to the local regulatory agency, and upon their approval the single-cell experiment and cDNA processing was performed.
Single-cell sequencing results 
To evaluate how SARS-CoV-2 infects human colon and ileum organoids, single-cell sequencing was performed. Organoids were prepared as described above and infected in a 2D format to allow for apical infection by SARS-CoV-2. Infected cells were harvested at 12 h and 24 h post-infection and were processed for single-cell sequencing as described above. Analysis of the single-cell sequencing data allowed us to determine that only a subpopulation (immature enterocyte 2) of human intestinal epithelial cells supported the infection of SARS-CoV-2 (Figure 4). Additionally, as not all cells in a population were infected, both infected cells and non-infected bystander cells were analyzed (Figure 5). These results showed that SARS-CoV-2 induced a pro-inflammatory signal cascade in infected cells while non-infected bystander cells showed an interferon-mediated immune response. Additionally, scRNA-Seq showed that infected cells were unable to sense interferons due to virus-mediated blockage of the pathway (Figure 5). It was not possible to obtain this information when using bulk RNA sequencing.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62857/62857fig01.jpg" /> 
Figure 1: Schematic depicting the three different methods to prepare human intestinal organoids for infection with enteric pathogens. Apical infection can be achieved through seeding intestinal organoids in 2D. An apical and basolateral infection can be performed by disrupting the 3D organoid. Finally, a basolateral only infection can be performed by infecting intact 3D intestinal organoids. Each of these methods can be used to generate samples for single cell sequencing. <a href="https://www.jove.com/files/ftp_upload/62857/62857fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62857/62857fig02.jpg" /> 
Figure 2: Organoid maintenance schematic and representative brightfield images. (A) Schematic for maintenance and passaging of human intestinal organoids. (B). Representative brightfield images of days 1, 3, 5, and 7 post-splitting. By day 7 the organoids become large and dark due to the accumulation of dead cells and are ready to be split. Scale bar indicates 25 &#956;m. <a href="https://www.jove.com/files/ftp_upload/62857/62857fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62857/62857fig03.jpg" /> 
Figure 3: Representative qPCR of human intestinal organoids 4 days post-switching to differentiation media. Intestinal organoids were maintained in growth media or switched to differentiation media for 4 days. RNA was harvested and qPCR was performed for markers of stem cells (OLFM4), Paneth cells (LYZ), Goblet cells (MUC2), and enterocytes (SI). N = 5. <a href="https://www.jove.com/files/ftp_upload/62857/62857fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62857/62857fig04.jpg" /> 
Figure 4: Identification of the cell population infected by SARS-CoV-2. Human colon and ileum derived organoids were infected with SARS-CoV-2. After 12 and 24 h post-infection cells were harvested and subjected to single-cell RNA sequencing to identify which cell populations supported SARS-CoV-2 infection. Virus infection was found to increase over time and mainly infect immature enterocyte 2. This figure has been modified from Triana et al.19. <a href="https://www.jove.com/files/ftp_upload/62857/62857fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/62857/62857fig05.jpg" /> 
Figure 5: Determination of intrinsic innate immune response. Human colon derived organoids were infected with SARS-CoV-2. After 12 and 24 h post-infection cells were harvested and subjected to single cell RNA sequencing to determine the intrinsic innate immune response in both virally infected and non-infected bystander cells. SARS-CoV-2 infected cells displayed a strong pro-inflammatory response while non-infected bystander cells displayed an interferon-mediated response. Figure modified from Triana et al.19. <a href="https://www.jove.com/files/ftp_upload/62857/62857fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">Growth Media</td>
		</tr>
		<tr>
			<td>Compound</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>Ad DMEM/F12</td>
			<td>GlutaMAX (1X)</td>
		</tr>
		<tr>
			<td>+GlutaMAX</td>
			<td>HEPES 1 mM</td>
		</tr>
		<tr>
			<td>+HEPES</td>
			<td>Pen 10 U/mL</td>
		</tr>
		<tr>
			<td>+P/S</td>
			<td>Strep 10 &#181;g/mL</td>
		</tr>
		<tr>
			<td>L-WRN</td>
			<td>50% by volume</td>
		</tr>
		<tr>
			<td>B27</td>
			<td>01:50</td>
		</tr>
		<tr>
			<td>N-acetyl-cysteine</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td>EGF</td>
			<td>50 ng/mL</td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>500 nM</td>
		</tr>
		<tr>
			<td>IGF-1</td>
			<td>100 ng/mL</td>
		</tr>
		<tr>
			<td>FGF basic</td>
			<td>50 ng/mL</td>
		</tr>
		<tr>
			<td>Gastrin</td>
			<td>10 mM</td>
		</tr>
		<tr>
			<td colspan="2">Differentiation Media</td>
		</tr>
		<tr>
			<td>Compound</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>Ad DMEM/F12</td>
			<td>GlutaMAX (1x)</td>
		</tr>
		<tr>
			<td>+GlutaMAX</td>
			<td>HEPES 1 mM</td>
		</tr>
		<tr>
			<td>+HEPES</td>
			<td>Pen 10 U/mL</td>
		</tr>
		<tr>
			<td>+P/S</td>
			<td>Strep 10 &#181;g/mL</td>
		</tr>
		<tr>
			<td>B27</td>
			<td>01:50</td>
		</tr>
		<tr>
			<td>N-acetyl-cysteine</td>
			<td>1 mM</td>
		</tr>
		<tr>
			<td>R-spondin</td>
			<td>5% by volume</td>
		</tr>
		<tr>
			<td>Noggin</td>
			<td>50 ng/mL</td>
		</tr>
		<tr>
			<td>EGF</td>
			<td>50 ng/mL</td>
		</tr>
		<tr>
			<td>Gastrin</td>
			<td>10 mM</td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>500 nM</td>
		</tr>
	</tbody>
</table>
Table 1: Media composition for growth and differentiation media.

Watch this Scientific Journal Video about Adapting Gastrointestinal Organoids for Pathogen Infection and Single Cell Sequencing under Biosafety Level 3 BSL-3 Conditions at JoVE.com

Adapting Gastrointestinal Organoids for Pathogen Infection and Single Cell Sequencing under Biosafety Level 3 BSL-3 Conditions

This protocol describes how to infect human intestinal organoids from either their apical or basolateral side to characterize host/pathogen interactions at the single-cell level using single-cell RNA sequencing (scRNAseq) technology.

Adapting Gastrointestinal Organoids for Pathogen Infection and Single Cell Sequencing under Biosafety Level 3 (BSL-3) Conditions

Human intestinal organoids constitute the best cellular model to study pathogen infections of the gastrointestinal tract. These organoids can be derived ...

adapting-gastrointestinal-organoids-for-pathogen-infection-single

Research

JoVE Journal

Immunology and Infection

2.9K Views.  Heidelberg University Hospital. This protocol describes how to infect human intestinal organoids from either their apical or basolateral side to characterize host/pathogen interactions at the single-cell level using single-cell RNA sequencing (scRNAseq) technology.

Video: Adapting Gastrointestinal Organoids for Pathogen Infection and Single Cell Sequencing under Biosafety Level 3 BSL-3 Conditions

Competitive Homing Assays to Study Gut-tropic T Cell Migration

In order to exert their function lymphocytes need to leave the blood and migrate into different tissues in the body. Lymphocyte adhesion to endothelial cells and tissue extravasation is a multistep process controlled by different adhesion molecules (homing receptors) expressed on lymphocytes and their respective ligands (addressins) displayed on endothelial cells 1 2. Even though the function of these adhesion receptors can be partially studied ex vivo, the ultimate test for their physiological relevance is to assess their role during in vivo lymphocyte adhesion and migration. Two complementary strategies have been used for this purpose: intravital microscopy (IVM) and homing experiments. Although IVM has been essential to define the precise contribution of specific adhesion receptors during the adhesion cascade in real time and in different tissues, IVM is time consuming and labor intensive, it often requires the development of sophisticated surgical techniques, it needs prior isolation of homogeneous cell populations and it permits the analysis of only one tissue/organ at any given time. By contrast, competitive homing experiments allow the direct and simultaneous comparison in the migration of two (or even more) cell subsets in the same mouse and they also permit the analysis of many tissues and of a high number of cells in the same experiment.
Here we describe the classical competitive homing protocol used to determine the advantage/disadvantage of a given cell type to home to specific tissues as compared to a control cell population. We chose to illustrate the migratory properties of gut-tropic versus non gut-tropic T cells, because the intestinal mucosa is the largest body surface in contact with the external environment and it is also the extra-lymphoid tissue with the best-defined migratory requirements. Moreover, recent work has determined that the vitamin A metabolite all-trans retinoic acid (RA) is the main molecular mechanism responsible for inducing gut-specific adhesion receptors (integrin a4b7and chemokine receptor CCR9) on lymphocytes. Thus, we can readily generate large numbers of gut-tropic and non gut-tropic lymphocytes ex vivoby activating T cells in the presence or absence of RA, respectively, which can be finally used in the competitive homing experiments described here.

Competitive homing experiments allow to directly assessing the migratory properties of two different cell populations in a single mouse. Here we illustrate this procedure by comparing the migration of ex vivo-generated gut-tropic versus non-gut tropic T cells.

In order to exert their function lymphocytes need to leave the blood and migrate into different tissues in the body. Lymphocyte adhesion to endothelial ...

Single-cell Analysis of Bacillus subtilis Biofilms Using Fluorescence Microscopy and Flow Cytometry

Biofilm formation is a general attribute to almost all bacteria 1-6. When bacteria form biofilms, cells are encased in extracellular matrix that is mostly constituted by proteins and exopolysaccharides, among other factors 7-10. The microbial community encased within the biofilm often shows the differentiation of distinct subpopulation of specialized cells 11-17. These subpopulations coexist and often show spatial and temporal organization within the biofilm 18-21.
Biofilm formation in the model organism Bacillus subtilis requires the differentiation of distinct subpopulations of specialized cells. Among them, the subpopulation of matrix producers, responsible to produce and secrete the extracellular matrix of the biofilm is essential for biofilm formation 11,19. Hence, differentiation of matrix producers is a hallmark of biofilm formation in B. subtilis.
We have used fluorescent reporters to visualize and quantify the subpopulation of matrix producers in biofilms of B. subtilis 15,19,22-24. Concretely, we have observed that the subpopulation of matrix producers differentiates in response to the presence of self-produced extracellular signal surfactin 25. Interestingly, surfactin is produced by a subpopulation of specialized cells different from the subpopulation of matrix producers 15.
We have detailed in this report the technical approach necessary to visualize and quantify the subpopulation of matrix producers and surfactin producers within the biofilms of B. subtilis. To do this, fluorescent reporters of genes required for matrix production and surfactin production are inserted into the chromosome of B. subtilis. Reporters are expressed only in a subpopulation of specialized cells. Then, the subpopulations can be monitored using fluorescence microscopy and flow cytometry (See Fig 1).
The fact that different subpopulations of specialized cells coexist within multicellular communities of bacteria gives us a different perspective about the regulation of gene expression in prokaryotes. This protocol addresses this phenomenon experimentally and it can be easily adapted to any other working model, to elucidate the molecular mechanisms underlying phenotypic heterogeneity within a microbial community.

Single-cell Analysis of Bacillus subtilis Biofilms Using Fluorescence Microscopy and Flow Cytometry

Microbial biofilms are generally constituted by distinct subpopulations of specialized cells. Single-cell analysis of these subpopulations requires the use of fluorescent reporters. Here we describe a protocol to visualize and monitor several subpopulationswithin B. subtilis biofilms using fluorescence microscopy and flow cytometry.

Biofilm formation is a general attribute to almost all bacteria 1-6. When bacteria form biofilms, cells are encased in extracellular matrix that is mostly ...

A Flow Adhesion Assay to Study Leucocyte Recruitment to Human Hepatic Sinusoidal Endothelium Under Conditions of Shear Stress

Leucocyte infiltration into human liver tissue is a common process in all adult inflammatory liver diseases. Chronic infiltration can drive the development of fibrosis and progression to cirrhosis. Understanding the molecular mechanisms that mediate leucocyte recruitment to the liver could identify important therapeutic targets for liver disease. The key interaction during leucocyte recruitment is that of inflammatory cells with endothelium under conditions of shear stress. Recruitment to the liver occurs within the low shear channels of the hepatic sinusoids which are lined by hepatic sinusoidal endothelial cells (HSEC). The conditions within the hepatic sinusoids can be recapitulated by perfusing leucocytes through channels lined by human HSEC monolayers at specific flow rates. In these conditions leucocytes undergo a brief tethering step followed by activation and firm adhesion, followed by a crawling step and subsequent transmigration across the endothelial layer. Using phase contrast microscopy, each step of this &#39;adhesion cascade&#39; can be visualized and recorded followed by offline analysis. Endothelial cells or leucocytes can be pretreated with inhibitors to determine the role of specific molecules during this process.

Leucocyte recruitment to the liver occurs within the specialized channels of the hepatic sinusoids which are lined by unique hepatic sinusoidal endothelial cells. Phase contrast microscopy of leucocyte recruitment across human hepatic sinusoidal endothelium under conditions of physiological shear stress can facilitate the elucidation of the molecular mechanisms which underlie this process.

Leucocyte infiltration into human liver tissue is a common process in all adult inflammatory liver diseases. Chronic infiltration can drive the ...

Safety Precautions and Operating Procedures in an (A)BSL-4 Laboratory: 1. Biosafety Level 4 Suit Laboratory Suite Entry and Exit Procedures

Biosafety level 4 (BSL-4) suit laboratories are specifically designed to study high-consequence pathogens for which neither infection prophylaxes nor treatment options exist. The hallmarks of these laboratories are: custom-designed airtight doors, dedicated supply and exhaust airflow systems, a negative-pressure environment, and mandatory use of positive-pressure (&#8220;space&#8221;) suits. The risk for laboratory specialists working with highly pathogenic agents is minimized through rigorous training and adherence to stringent safety protocols and standard operating procedures. Researchers perform the majority of their work in BSL-2 laboratories and switch to BSL-4 suit laboratories when work with a high-consequence pathogen is required. Collaborators and scientists considering BSL-4 projects should be aware of the challenges associated with BSL-4 research both in terms of experimental technical limitations in BSL-4 laboratory space and the increased duration of such experiments. Tasks such as entering and exiting the BSL-4 suit laboratories are considerably more complex and time-consuming compared to BSL-2 and BSL-3 laboratories. The focus of this particular article is to address basic biosafety concerns and describe the entrance and exit procedures for the BSL-4 laboratory at the NIH/NIAID Integrated Research Facility at Fort Detrick. Such procedures include checking external systems that support the BSL-4 laboratory, and inspecting and donning positive-pressure suits, entering the laboratory, moving through air pressure-resistant doors, and connecting to air-supply hoses. We will also discuss moving within and exiting the BSL-4 suit laboratories, including using the chemical shower and removing and storing positive-pressure suits.

Safety Precautions and Operating Procedures in an ABSL-4 Laboratory: 1. Biosafety Level 4 Suit Laboratory Suite Entry and Exit Procedures

Although researchers are generally knowledgeable about procedures and safety precautions required for biosafety level 1 or 2 (BSL-1/2) experiments, they may not be familiar with experimental procedures in BSL-4 suit laboratories. This article provides a detailed visual demonstration of BSL-4 suit laboratory systems check, laboratory entry, movement, and exit procedures.

Biosafety level 4 (BSL-4) suit laboratories are specifically designed to study high-consequence pathogens for which neither infection prophylaxes nor ...

Modeling The Lifecycle Of Ebola Virus Under Biosafety Level 2 Conditions With Virus-like Particles Containing Tetracistronic Minigenomes

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or specific treatments for the disease caused by these viruses, and work with infectious Ebola viruses is restricted to biosafety level 4 laboratories, significantly limiting the research on these viruses. Lifecycle modeling systems model the virus lifecycle under biosafety level 2 conditions; however, until recently such systems have been limited to either individual aspects of the virus lifecycle, or a single infectious cycle. Tetracistronic minigenomes, which consist of Ebola virus non-coding regions, a reporter gene, and three Ebola virus genes involved in morphogenesis, budding, and entry (VP40, GP1,2, and VP24), can be used to produce replication and transcription-competent virus-like particles (trVLPs) containing these minigenomes. These trVLPs can continuously infect cells expressing the Ebola virus proteins responsible for genome replication and transcription, allowing us to safely model multiple infectious cycles under biosafety level 2 conditions. Importantly, the viral components of this systems are solely derived from Ebola virus and not from other viruses (as is, for example, the case in systems using pseudotyped viruses), and VP40, GP1,2 and VP24 are not overexpressed in this system, making it ideally suited for studying morphogenesis, budding and entry, although other aspects of the virus lifecycle such as genome replication and transcription can also be modeled with this system. Therefore, the tetracistronic trVLP assay represents the most comprehensive lifecycle modeling system available for Ebola viruses, and has tremendous potential for use in investigating the biology of Ebola viruses in future. Here, we provide detailed information on the use of this system, as well as on expected results.

Work with infectious Ebola viruses is restricted to biosafety level 4 laboratories. Tetracistronic minigenome-containing replication and transcription-competent virus like particles (trVLPs) represent a lifecycle modeling system that allows us to safely model multiple infectious cycles under biosafety level 2 conditions, relying exclusively on Ebola virus components.

Ebola viruses cause severe hemorrhagic fevers in humans and non-human primates, with case fatality rates as high as 90%. There are no approved vaccines or ...

In Vitro and In Vivo Model to Study Bacterial Adhesion to the Vessel Wall Under Flow Conditions

In order to cause endovascular infections and infective endocarditis, bacteria need to be able to adhere to the vessel wall while being exposed to the shear stress of flowing blood.
To identify the bacterial and host factors that contribute to vascular adhesion of microorganisms, appropriate models that study these interactions under physiological shear conditions are needed. Here, we describe an in vitro flow chamber model that allows to investigate bacterial adhesion to different components of the extracellular matrix or to endothelial cells, and an intravital microscopy model that was developed to directly visualize the initial adhesion of bacteria to the splanchnic circulation in vivo. These methods can be used to identify the bacterial and host factors required for the adhesion of bacteria under flow. We illustrate the relevance of shear stress and the role of von Willebrand factor for the adhesion of Staphylococcus aureus using both the in vitro and in vivo model.

In Vitro and In Vivo Model to Study Bacterial Adhesion to the Vessel Wall Under Flow Conditions

To study the interaction of bacteria with the blood vessels under shear stress, a flow chamber and an in vivo mesenteric intravital microscopy model are described that allow to dissect the bacterial and host factors contributing to vascular adhesion.

In order to cause endovascular infections and infective endocarditis, bacteria need to be able to adhere to the vessel wall while being exposed to the ...

Organoids as Model for Infectious Diseases: Culture of Human and Murine Stomach Organoids and Microinjection of Helicobacter Pylori

Recently infection biologists have employed stem cell derived cultures to answer the need for new and better models to study host-pathogen interactions. Three cellular sources have been used: Embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) or adult stem cells. Here, culture of mouse and human gastric organoids derived from adult stem cells is described and used for infection with the gastric pathogen Helicobacter pylori. Human gastric glands are isolated from resection material, seeded in a basement matrix and embedded in medium containing growth factors epidermal growth factor (EGF), R-spondin, Noggin, Wnt, fibroblast growth factor (FGF) 10, gastrin and transforming growth factor (TGF) beta inhibitor. In these conditions, gastric glands grow into 3-dimensional organoids containing 4 lineages of the stomach. The organoids expand indefinitely and can be frozen and thawed similarly as cell lines. For infection studies, bacteria are microinjected into the lumen of the organoids. Infected organoids are processed for imaging. The described methods can be adapted to other organoids and infections with other bacteria, viruses or parasites. This allows the study of infection-induced changes in primary cells.

Stem cell derived cultures harbor tremendous potential to model infectious diseases. Here, the culture of mouse and human gastric organoids derived from adult stem cells is described. The organoids are microinjected with the gastric pathogen Helicobacter pylori.

Recently infection biologists have employed stem cell derived cultures to answer the need for new and better models to study host-pathogen interactions. ...

Quantification of Efferocytosis by Single-cell Fluorescence Microscopy

Studying the regulation of efferocytosis requires methods that are able to accurately quantify the uptake of apoptotic cells and to probe the signaling and cellular processes that control efferocytosis. This quantification can be difficult to perform as apoptotic cells are often efferocytosed piecemeal, thus necessitating methods which can accurately delineate between the efferocytosed portion of an apoptotic target versus residual unengulfed cellular fragments. The approach outlined herein utilizes dual-labeling approaches to accurately quantify the dynamics of efferocytosis and efferocytic capacity of efferocytes such as macrophages. The cytosol of the apoptotic cell is labeled with a cell-tracking dye to enable monitoring of all apoptotic cell-derived materials, while surface biotinylation of the apoptotic cell allows for differentiation between internalized and non-internalized apoptotic cell fractions. The efferocytic capacity of efferocytes is determined by taking fluorescent images of live or fixed cells and quantifying the amount of bound versus internalized targets, as differentiated by streptavidin staining. This approach offers several advantages over methods such as flow cytometry, namely the accurate delineation of non-efferocytosed versus efferocytosed apoptotic cell fractions, the ability to measure efferocytic dynamics by live-cell microscopy, and the capacity to perform studies of cellular signaling in cells expressing fluorescently-labeled transgenes. Combined, the methods outlined in this protocol serve as the basis for a flexible experimental approach that can be used to accurately quantify efferocytic activity and interrogate cellular signaling pathways active during efferocytosis.

Efferocytosis, the phagocytic removal of apoptotic cells, is required to maintain homeostasis and is facilitated by receptors and signaling pathways that allow for the recognition, engulfment, and internalization of apoptotic cells. Herein, we present a fluorescence microscopy protocol for the quantification of efferocytosis and the activity of efferocytic signaling pathways.

Studying the regulation of efferocytosis requires methods that are able to accurately quantify the uptake of apoptotic cells and to probe the signaling ...

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Evaluation of Host-Pathogen Responses and Vaccine Efficacy in Mice

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a striking increase in life expectancy around the globe. Nonetheless, determining vaccine efficacy remains a challenge. Emerging evidence suggests that the current acellular vaccine (aPV) for Bordetella pertussis (B. pertussis) induces suboptimal immunity. Therefore, a major challenge is designing a next-generation vaccine that induces protective immunity without the adverse side effects of a whole-cell vaccine (wPV). Here we describe a protocol that we used to test the efficacy of a promising, novel adjuvant that skews immune responses to a protective Th1/Th17 phenotype and promotes a better clearance of a B. pertussis challenge from the murine respiratory tract. This article describes the protocol for mouse immunization, bacterial inoculation, tissue harvesting, and analysis of immune responses. Using this method, within our model, we have successfully elucidated crucial mechanisms elicited by a promising, next-generation acellular pertussis vaccine. This method can be applied to any infectious disease model in order to determine vaccine efficacy.

Here we present an elegant protocol for in vivo evaluation of vaccine effectiveness and host immune responses. This protocol can be adapted for vaccine models that study viral, bacterial, or parasitic pathogens.

Vaccines are a 20th century medical marvel. They have dramatically reduced the morbidity and mortality caused by infectious diseases and contributed to a ...