وأيد هذا العمل من المنح المقدمة من مؤسسة أبحاث الصمم إلى S YC وجبهة الخلاص الوطني في (IOS 0930096) لKFB. KFB : المعاهد الوطنية للصحة / 2 NINDCD RO1 DC04184 ، <a href="https://commons.era.nih.gov/commons/genericStatus.do?actionRole=nonPI&amp;applID=7854446&amp;uhf-token=Ugf7JvudZTCbTUW9jSAR1snMUgg%3D">3R01DC004184 - 08W1</a> NSF ، DBI 0832862 ، 0930096 NSF IOS

1. لصنع أقطاب Electroporation <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> قطع أسلاك قطرها 75 ميكرومتر التنغستن (AM سيستمز Carlsborg ، WA) بطول مناسب (حوالي 3-5 سم) </li><li style=";text-align:right;direction:rtl"> وضع سلك التنغستن من خلال كابل موصل MOLEX (النحاس ختمها دبوس) </li><li style=";text-align:right;direction:rtl"> أسلاك التنجستين التفاف وMOLEX موصل كابل مع الأنابيب يتقلص (SPC تكنولوجيا في شيكاغو ، IL) وتطبيق الحرارة مع الشعلة بنسن أو بندقية الحرارة لختم الأنابيب تقلص إلى سلك </li><li style=";text-align:right;direction:rtl"> لشحذ غيض من سلك التنجستن ، وتراجع في السلك هيدروكسيد الصوديوم 1.0 N (كونراد وآخرون 1993) ، واستخدام ورقة كليب باعتبارها القطب الآخر ، electrolyze السلك مع Electroporator الموجة مربعة. الشروط التي نستخدمها هي 5 50 فولت لكل البقول دائم 100 مللي ثانية مع 50 مللي في ما بين البقوليات. وينبغي شحذ أقطاب ليبلغ قطرها 15-20 ميكرون </li><li style=";text-align:right;direction:rtl"> الحفاظ على الأسلاك في صينية داخل أخاديد الضغط في الصلصال قبل استخدامها في electroporation </li></ol> 2. انشاء محطة Electroporation <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> شحذ الشريط التنغستن الأقطاب 75μm إلى micromanipulators (الصكوك العالمية الدقة). </li><li style=";text-align:right;direction:rtl"> micromanipulators مكان على جانبي المسرح مجهر تشريح (لايكا). </li><li style=";text-align:right;direction:rtl"> توصيل الأقطاب الكهربائية إلى حماية Electroporator تحرير CUY - 21 الموج سكوير (الشكل 1). </li><li style=";text-align:right;direction:rtl"> بدوره على electroporator وإعداد معلمات لelectroporation ، بما في ذلك الجهد ، ومدة النبضة ، وعدد من البقول. تم العثور على المعلمات الأكثر فعالية لهذه التجربة إلى ثلاثة 13 فولت لكل البقول التي استمرت لمدة 5.0ms ، مع 100ms بين كل نبضة. إذا electroporation يخلق فقاعات الهواء في الجنين ، والحد من طول النبض. </li></ol> 3. Microinjection من Morpholinos في الحويصلة الأذنية اسماك الزرد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> حصاد الأجنة الزرد من خزان التربية. احتضان الأجنة في جنين لرفع المتوسط ​​بنسبة 0.3 PPM الميثيلين الأزرق (Westerfield ، 2005) على 28،5 درجة مئوية خلال الليل. </li><li style=";text-align:right;direction:rtl"> سحب الإبر الزجاج مع مجتذب سوتر P - 97 مسرى </li><li style=";text-align:right;direction:rtl"> الاحماء الجل agarose قاعدة (1 ٪ agarose في أسماك المياه في طبق بتري مم 10) إلى 37 درجة مئوية في حمام مائي </li><li style=";text-align:right;direction:rtl"> حرارة منخفضة بنسبة 1 ٪ نقطة ذوبان agarose (LMPA) في أسماك المياه حتى ذاب وابقائه في حمام دافئ ° 37 C المياه. </li><li style=";text-align:right;direction:rtl"> شغل الإبرة الزجاج بمحلول morpholino (GeneTools ، كورفاليس ، OR) وقطع رأس إلى القطر المناسب. جبل حقن الإبرة في الصعود إلى micromanipulator (كن). </li><li style=";text-align:right;direction:rtl"> قطع طرف الإبرة إلى ما يقرب من 10 ميكرومتر وتحقن الزيوت المعدنية للتأكد من أن يسمح طرف تسليم ما يكفي من حل morpholino. </li><li style=";text-align:right;direction:rtl"> Dechorinate postfertilization أجنة في 24 ساعة (HPF) وتخدير لهم MS222 (tricaine ، سيجما) في 0.3 الماء الميثيلين PPM السمك الأزرق. </li><li style=";text-align:right;direction:rtl"> محاذاة 3-5 أجنة تخدير على قاعدة هلام agarose مع الجانب الأيمن للحصول على تحليل موحد مريحة </li><li style=";text-align:right;direction:rtl"> وضع 1-2 قطرات من LMPA 1 ٪ أكثر من كل جنين والسماح لترسيخ الإصلاح في مكان الجنين </li><li style=";text-align:right;direction:rtl"> تدوير طبق بتري بحيث الحويصلة الأذنية هو على الجانب الأيمن </li><li style=";text-align:right;direction:rtl"> مكان الإبرة في تجويف الحويصلة الأذنية وحقن محلول morpholino مع هوائي PicoPump PV820 (الآلات الدقيقة الدولي) مع دبابة النيتروجين المرفقة (الشكل 2) </li></ol> 4. Electroporation الداخلي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نقل الأجنة لنصرة محطة electroporation فورا بعد الحقن </li><li style=";text-align:right;direction:rtl"> مكان القطب الموجب على النسيج الخلفي عادل للحويصلة الأذن ، ولكن لا اختراق لا ؛ إدراج القطب السالب في الدماغ الأمامية فقط إلى الحويصلة الأذنية </li><li style=";text-align:right;direction:rtl"> تطبيق الحالي باستخدام دواسة الأقدام أو عن طريق دفع التبديل. </li><li style=";text-align:right;direction:rtl"> صب الماء على الأسماك وإزالة agarose أجنة من agarose مع دوامات وماصة الزجاج. توخي الحذر حتى لا نضر الأجنة. للأجنة التي من الصعب إزالتها ، واستخدام إبرة لكسر بلطف بعيدا أي LMPA المحيطة الجنين. </li><li style=";text-align:right;direction:rtl"> أجنة مكان في اللوحة مع المياه الزرقاء الميثيلين الأسماك ورفع الأجنة إلى المراحل المطلوبة للتحليل (المورفولوجية ، المناعى ، في anlaysis التهجين ، الخ ، والمجهرية الموقع). </li></ol> 5. ممثل النتائج : <img src="/files/ftp_upload/2466/2466fig1.jpg" alt="الشكل 1" /> الشكل 1. محطة Electroporation. أدلى به أقطاب شحذ أسلاك التنجستن 75μm ومتصلة بواسطة يؤدي إلى حماية Electroporator تحرير CUY - 21 الموج سكوير. وقد سجلت هذه الأقطاب لmicromanipulators. <img src="/files/ftp_upload/2466/2466fig2.jpg" alt="الشكل 2" /> الشكل 2. محطة حقن. تم حقن جميع الأجنة في الأذن اليمنى لأغراض التوحيد. <img src="/files/ftp_upload/2466/2466fig3.jpg" alt="الشكل 3" /> تلطيخ Phalloidin الرقم 3. من شعيرات أكتين مع أجنة DPF 3. (A) وinjecte الجنين 3 DPFد MO مع سيطرة قوية من تلطيخ وphalloidin في البقعة الخلفي (بعد الظهر). (ب) وكان الجنين الذي تم حقنه بمادة MO التحكم ثم electroporated مستويات مماثلة من تلطيخ phalloidin في الظهر في أجنة الحقن فقط. (C) مع المنظمات الأعضاء لم حقن MIF في الحويصلة الأذنية وحده لا يؤدي الحد من تلطيخ phalloidin ، في حين حقن MIF جنبا إلى جنب مع المنظمات الأعضاء electroporation أدى إلى انخفاض هائل من تلطيخ phalloidin في مساء (D). صباحا ، البقعة الأمامي. <img src="/files/ftp_upload/2466/2466fig4.jpg" alt="الشكل 4" /> الشكل 4. Phalloidin تلون شعيرات أكتين مع يرقات DPF 5. لم يكن هناك فرق بين الحقن فقط (A) ، والحقن مع electroporation عندما تم استخدام معيار السيطرة morpholino (B). ومع ذلك ، أظهرت انخفاض اليرقات DPF 5 التي حقنوا morpholinos MIF وتلطيخ electroporated phalloidin في البقعة الخلفي (بعد الظهر) (D) ، وإن كان أقل دراماتيكية من 3 DPF ، بالمقارنة مع الجنين الذي تم حقنه بمادة morpholinos MIF فقط (C ). صباحا ، البقعة الأمامي. <img src="/files/ftp_upload/2466/2466fig5.jpg" alt="الشكل 5" /> الشكل 5. الأسيتيل تلطيخ تويولين الأجنة في 3 DPF. لم الجنين في الفقرة (أ) لم تتلق أي حقن أو electroporation. وكان electroporated الجنين في (B) لكنها لم تتلق الحقن. وكان كل من الأجنة تلقي الحقن وelectroporation (C ، D) مع تراجع واضح morpholinos MIF تلطيخ تويولين مقارنة بالمجموعة الضابطة. (م ، البقعة الخلفي). <img src="/files/ftp_upload/2466/2466fig6.jpg" alt="الشكل 6" /> الشكل 6. الأسيتيل تلطيخ تويولين الأجنة في 3 DPF مع morpholino السيطرة. (أ) أظهرت الأجنة دون أي علاج قوي تلطيخ تويولين الأسيتيل في البقعة الخلفي (الظهر) وتعصيب واسعة النطاق. (ب) مع حقن الأجنة morpholino السيطرة. (C) الأجنة تعامل مع electroporation فقط. (D) مع مراقبة الجنين morpholino التحكم وحقن electroporated ومستويات مماثلة من تويولين الأسيتيل في البقعة الخلفي وتعصيب مقارنة تحكم معاملة لا.

<ol>
	<li>Conrad, G. W., Bee, J. A., Roche, S. M., Teillet, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fabrication+of+microscalpels+by+electrolysis+of+tungsten+wire+in+a+meniscus.">Fabrication of microscalpels by electrolysis of tungsten wire in a meniscus.</a> J Neurosci Methods. 50, 123-127 (1993).</li><li>Suzuki, M., Takamura, Y., Maeno, M., Tochinai, S., Iyaguchi, D., Tanaka, I., Nishihira, J., Ishibashi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenopus+laevis+macrophage+migration+inhibitory+factor+is+essential+for+axis+formation+and+neural+development.">Xenopus laevis macrophage migration inhibitory factor is essential for axis formation and neural development.</a> J Biol Chem. 279, 21406-21414 (2004).</li><li>Barald, K. F., Kelley, M. W., W, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+placode+to+polarization:+new+tunes+in+inner+ear+development.">From placode to polarization: new tunes in inner ear development.</a> Development. 131, 4119-4135 (2004).</li></ol>

وقد رعت انتاج المقالة أدوات الجينات ، LLC الذين ينتجون الكواشف المذكورة في الفيديو والنص.

قدمنا ​​بنجاح المنظمات الأعضاء قليل النوكليوتيد العقاقير في أذن الجنين 24 الزرد HPF. والأجنة التي أثيرت بعد الحقن وelectroporation قابلة للحياة. إذا نجا من أجنة electroporation ، وأنها نمت بمعدلات طبيعية مقارنة الأجنة التي لم تتلق العلاج ، وكذلك الأجنة التي لم تحظ حقن والأجنة التي لم تحظ electroporated. لاحظنا آثار MIF MIF والمنظمات الأعضاء تشبه الأذن وبعد الحقن عن طريق وضع العلامات electroporation مع phalloidin وتويولين الأسيتيل. Phalloidin تلون شعيرات الأكتين في الخلايا الحسية من الشعر البقعة الخلفية يشير إلى أن من electroporation MIF MIF ومثل MO في المرحلة ال 24 HPF تسبب تغيرات في الخلية الشعر و / أو أرقام أهداب ساكنة عند مقارنة الأجنة التي حقنت فقط مع المنظمات الأعضاء (الشكل 3). هذا الانخفاض في عدد خلايا الشعر ويتسق مع نتائج شين وآخرون (المقدمة) أن المنظمات الأعضاء في MIF MIF وشبيهة تؤدي إلى انخفاض في عدد خلايا الشعر في البقعة الكييس. قد تناقص أعداد الخلايا الشعر في الأجنة التي حقنوا المنظمات الأعضاء وelectroporated تثبت أن electroporation مساعدة في تحريك المنظمات الأعضاء عبر غشاء الخلية ، وبالتالي زيادة حجم التأثيرات المورفولوجية بالمقارنة إلى الأجنة التي تم حقن فقط الحويصلة الأذنية. وقد لوحظت تغييرات في التشكل من خلال تلطيخ العقدة statoacoustic تويولين الأسيتيل. وقد تأثر حجم تعصيب من العقدة statoacoustic ، والأجنة التي تم حقنها وelectroporated تظهر انخفاض المتفرعة من neurites (الشكل 5). قد يكون هناك أيضا انخفاض التكثيف من الخلايا العقدية و / أو انخفاض عدد خلايا العقدة ، وذلك لأن انخفاض كبير في تلطيخ تويولين الأسيتيل في الأجنة التي كانت على حد سواء وحقن electroporated. لأنه قد ثبت لMIF ستكون حاسمة لتطوير النظام العصبي (سوزوكي وآخرون ، 2004) ، قد شهدت تغييرات بعد electroporation يكون نتيجة لزيادة ترنسفكأيشن من MIF MIF والشبيهة. MO حل في الخلايا neuroblast Electroporation بنسبة ضئيلة من morpholinos العقاقير مباشرة في الأنسجة النامية هو أداة مفيدة للسيطرة على التعبير عن الجينات أثناء تطور الأنسجة ، سواء مكانيا وزمانيا ، في جنين. نتج من Electroporation MIF MIF ومثل المنظمات الأعضاء في أنسجة الأذن الداخلية في التشكل غير طبيعية من البقعة الخلفية على حد سواء ، والعقدة statoacoustic. كان هناك انخفاض في عدد خلايا الشعر الحسية في البقعة الخلفي في الأجنة التي تم حقنها في وelectroporated مقارنة مع الأجنة التي لم يتلق أي علاج ، أو الأجنة التي إما تم حقنه فقط أو electroporated فقط. كان هناك أيضا انخفاض في درجة التعصيب من تصحيح الحسي الخلفي من العقدة statoacoustic وحجم SAG. Electroporation هي طريقة قيمة لtransfecting الجزيئات في أنسجة معينة ، مع الاستفادة من رصد الآثار الأولية لهذا الحمض النووي وجه الخصوص ، RNA ، أو MO في النسيج المطلوب ، وتميز هذه من آثار ثانوية على الأنسجة الأخرى ، بما في ذلك المخ ، والعرف العصبي المحيطة بالأذن اللحمة المتوسطة في التنمية الأذن الداخلية (Barald وكيلي ، 2004).

<ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> MOS : 0.3 مم من مزيج من لMIF ، MIF مثل MO1 وMIF مثل استخدام MO2 كان. MIF MO مجاني رامزة إلى بداية مرنا MIF الزرد : 5&#39; - 3 - acatcggcatgactgcgacagagat. واستخدمت اثنين من المنظمات الأعضاء لمثل MIF MIF مثل MO1 مجاني لموقع بداية متعدية : 5&#39; - 3 - GTTTCTATATTTATGAACGGCATGA ، بينما MIF مثل MO2 المستمدة منها وتسلسل في حدود 2 intron1/exon : 5&#39; - GATTCATCCTCTGAAGACGTAAGCC -3 &quot;. تم السيطرة MO تسلسل النوكليوتيدات تدافعت من أدوات جين : 5&#39; - 3 - CCTCTTACCTCAGTTACAATTTATA. </li><li style=";text-align:right;direction:rtl"> الميثيلين الأزرق (0.3 جزء في المليون) في أسماك المياه </li><li style=";text-align:right;direction:rtl"> MS222 (tricaine ، سيغما ؛ 0،64 ملم في أسماك المياه) </li><li style=";text-align:right;direction:rtl"> نقطة انصهار منخفضة agarose (LMPA ؛ روش) </li><li style=";text-align:right;direction:rtl"> الفينول الحمراء (سيجما) </li><li style=";text-align:right;direction:rtl"> مكافحة الأسيتيل تويولين (سيجما) </li><li style=";text-align:right;direction:rtl"> الكسا فلور ® 488 الماعز المضادة للجسم الفأر الثاني (تحقيقات الجزيئية) </li><li style=";text-align:right;direction:rtl"> تكساس الحمراء phalloidin (تحقيقات الجزيئية) </li></ol>

direct delivery of mif morpholinos into the zebrafish otocyst by injection and electroporation affects inner ear development

في السنوات الأخيرة ، أصبح electroporation تقنية الشعبية لترنسفكأيشن في الجسم الحي من الحمض النووي ، والجيش الملكي النيبالي ، وmorpholinos في الأنسجة المختلفة ، بما في ذلك العين ، والدماغ ، وsomites من الزرد. ميزة electroporation خلال وسائل أخرى للتلاعب الجيني يمكن أن تكون مستهدفة أنسجة معينة ، مكانيا وزمنيا ، لإدخال الجزيئات الكبيرة من تطبيق التيار الكهربائي. نحن هنا وصف استخدام electroporation لtransfecting MIF MIF وmorpholinos تشبه في أنسجة الأذن الداخلية النامية من الزرد. في دراسات سابقة ، MIF morpholino تحقن الأجنة في 1 -- 8 خلايا المرحلة أسفرت عن تغيرات شكلية على نطاق واسع في الجهاز العصبي والعين ، وكذلك الأذن. من خلال استهداف أنسجة الأذن الداخلية في مراحل لاحقة في عملية التنمية ، يمكننا تحديد الآثار الأولية لMIF في الأذن الداخلية النامية ، بالمقارنة مع الآثار الثانوية التي قد تنجم عن تأثير الأنسجة الأخرى. باستخدام تويولين phalloidin الأسيتيل وتلطيخ لدراسة مورفولوجية الخلايا العصبية ، والعمليات العصبية ، والخلايا المرتبطة الشعر البقعة الخلفي ، كنا قادرين على تقييم فعالية electroporation كطريقة لترنسفكأيشن المستهدفة في الأذن الداخلية الزرد. تم حقن الحويصلات أذني الأجنة 24hpf مع morpholinos وelectroporated وتمت مقارنة ثم إلى الأجنة التي لم تتلق العلاج أو حقنت فقط أو electroporated. وأظهرت الأجنة التي تم حقنها وelectroporated انخفاض في أعداد خلايا الشعر ، وانخفاض تعصيب من العقدة statoacoustic (SAG) ، وعدد أقل من الخلايا العصبية SAG مقارنة مع مجموعات المراقبة. وأظهرت نتائجنا ان النقل المباشر للmorpholinos في otocysts في مراحل لاحقة يتجنب نظام غير محددة العصبي والآثار العصبية للقمة morpholinos ألقاها في مرحلة الخلية 1-8. أنها تسمح أيضا دراسة التأثيرات التي توجه إلى الأذن الداخلية ، وليس الآثار الثانوية على الأذن من الآثار الأولية في الدماغ ، أو اللحمة المتوسطة قمة العصبية المحيطة بالأذن.

Watch this Scientific Journal Video about Direct Delivery of MIF Morpholinos Into the Zebrafish Otocyst by Injection and Electroporation Affects Inner Ear Development at JoVE.com

Direct Delivery of MIF Morpholinos Into the Zebrafish Otocyst by Injection and Electroporation Affects Inner Ear Development

وقد تم تطوير طريقة لإيصال morpholinos مباشرة في otocyst الزرد في 24hpf. microinjection به من morpholinos في تجويف الحويصلة الأذنية وelectroporation لإحداث الاختراق ، وكنا قادرين على تجاوز تأثير morpholinos على الدماغ والحصول على آثار محددة على الأذن الداخلية.

التسليم المباشر للMorpholinos MIF في Otocyst اسماك الزرد عن طريق الحقن وElectroporation يؤثر على التنمية الداخلية الأذن

In recent years, electroporation has become a popular technique for in vivo transfection of DNA, RNA, and morpholinos into various tissues, including the ...

direct-delivery-mif-morpholinos-into-zebrafish-otocyst-injection

Research

JoVE Journal

Biology

14.2K Views.  University of Wisconsin, Madison. وقد تم تطوير طريقة لإيصال morpholinos مباشرة في otocyst الزرد في 24hpf. microinjection به من morpholinos في تجويف الحويصلة الأذنية وelectroporation لإحداث الاختراق ، وكنا قادرين على تجاوز تأثير morpholinos على الدماغ والحصول على آثار محددة على الأذن الداخلية.

Video: Direct Delivery of MIF Morpholinos Into the Zebrafish Otocyst by Injection and Electroporation Affects Inner Ear Development

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish (Danio rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the cellular and molecular features of the epithelia, which are mainly composed of two types of cells: hair cells (HCs) and supporting cells (SCs). Here we choose to study the inner ear sensory epithelia in adult zebrafish not only because the epithelial structures are highly conserved in all vertebrates studied, but also because the adult zebrafish is able to regenerate HCs, an ability that mammals lose shortly after birth. We use the inner ear of adult zebrafish as a model system to study the mechanisms of inner ear HC regeneration in adult vertebrates that could be helpful for clinical therapy of hearing/balance deficits in human as a result of HC loss.
Here we demonstrate how to do gross and fine dissections of inner ear sensory epithelia in adult zebrafish. The gross dissection removes the tissues surrounding the inner ear and is helpful for preparing tissue sections, which allows us to examine the detailed structure of the sensory epithelia. The fine dissection cleans up the non-sensory-epithelial tissues of each individual epithelium and enables us to examine the heterogeneity of the whole epithelium easily in whole-mount epithelial samples.

Gross and Fine Dissection of Inner Ear Sensory Epithelia in Adult Zebrafish Danio rerio

The inner ear sensory epithelium of adult zebrafish is a good model system for understanding the mechanisms of hair cell regeneration in adult vertebrates. This protocol demonstrates the fine dissection of the epithelia, through which we can get tissue samples for studying the regenerative events at cellular and subcellular levels.

الجسيمة والجميلة تشريح الأذن الداخلية الظهارة الحسية في اسماك الزرد الكبار ( دانيو rerio)

Neurosensory epithelia in the inner ear are the crucial structures for hearing and balance functions. Therefore, it is important to understand the ...

Primary Culture and Plasmid Electroporation of the Murine Organ of Corti. 

In all mammals, the sensory epithelium for audition is located along the spiraling organ of Corti that resides within the conch shaped cochlea of the inner ear (fig 1). Hair cells in the developing cochlea, which are the mechanosensory cells of the auditory system, are aligned in one row of inner hair cells and three (in the base and mid-turns) to four (in the apical turn) rows of outer hair cells that span the length of the organ of Corti. Hair cells transduce sound-induced mechanical vibrations of the basilar membrane into neural impulses that the brain can interpret. Most cases of sensorineural hearing loss are caused by death or dysfunction of cochlear hair cells.
An increasingly essential tool in auditory research is the isolation and in vitro culture of the organ explant 1,2,9. Once isolated, the explants may be utilized in several ways to provide information regarding normative, anomalous, or therapeutic physiology. Gene expression, stereocilia motility, cell and molecular biology, as well as biological approaches for hair cell regeneration are examples of experimental applications of organ of Corti explants.
This protocol describes a method for the isolation and culture of the organ of Corti from neonatal mice. The accompanying video includes stepwise directions for the isolation of the temporal bone from mouse pups, and subsequent isolation of the cochlea, spiral ligament, and organ of Corti. Once isolated, the sensory epithelium can be plated and cultured in vitro in its entirety, or as a further dissected micro-isolate that lacks the spiral limbus and spiral ganglion neurons. Using this method, primary explants can be maintained for 7-10 days. As an example of the utility of this procedure, organ of Corti explants will be electroporated with an exogenous DsRed reporter gene. This method provides an improvement over other published methods because it provides reproducible, unambiguous, and stepwise directions for the isolation, microdissection, and primary culture of the organ of Corti.

Primary Culture and Plasmid Electroporation of the Murine Organ of Corti.

This procedure describes a method for the isolation and culture of the murine organ of Corti with or without the spiral limbus and spiral ganglion neurons. We also demonstrate a method for the expression of an exogenous reporter gene in the organ of Corti explant by electroporation.

الابتدائية الثقافة وElectroporation البلازميد الجهاز الفئران كورتي.

In all mammals, the sensory epithelium for audition is located along the spiraling organ of Corti that resides within the conch shaped cochlea of the ...

Intraperitoneal Injection into Adult Zebrafish

A convenient method for chemically treating zebrafish is to introduce the reagent into the tank water, where it will be taken up by the fish. However, this method makes it difficult to know how much reagent is absorbed or taken up per fish. Some experimental questions, particularly those related to metabolic studies, may be better addressed by delivering a defined quantity to each fish, based on weight. Here we present a method for intraperitoneal (IP) injection into adult zebrafish. Injection is into the abdominal cavity, posterior to the pelvic girdle. This procedure is adapted from veterinary methods used for larger fish. It is safe, as we have observed zero mortality. Additionally, we have seen bleeding at the injection site in only 5 out of 127 injections, and in each of those cases the bleeding was brief, lasting several seconds, and the quantity of blood lost was small. Success with this procedure requires gentle handling of the fish through several steps including fasting, weighing, anesthetizing, injection, and recovery. Precautions are required to minimize stress throughout the procedure. Our precautions include using a small injection volume and a 35G needle. We use Cortland salt solution as the vehicle, which is osmotically balanced for freshwater fish. Aeration of the gills is maintained during the injection procedure by first bringing the fish into a surgical plane of anesthesia, which allows slow operculum movements, and second, by holding the fish in a trough within a water-saturated sponge during the injection itself. We demonstrate the utility of IP injection by injecting glucose and monitoring the rise in blood glucose level and its subsequent return to normal. As stress is known to increase blood glucose in teleost fish, we compare blood glucose levels in vehicle-injected and non-injected adults and show that the procedure does not cause a significant rise in blood glucose.

We demonstrate intraperitoneal injection into adult zebrafish. We use a 10 &mu;l NanoFil microsyringe controlled by a Micro4 controller and UltraMicroPump III. This demonstration includes the use of cold water as an anesthetic.

حقن داخل الصفاق الى اسماك الزرد الكبار

A convenient method for chemically treating zebrafish is to introduce the reagent into the tank water, where it will be taken up by the fish. However, ...

RNAi Interference by dsRNA Injection into Drosophila Embryos

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements and tools for genetic manipulation have become available in Drosophila 2. Soon after the initial discovery by Frie and Mello 3 that double stranded RNA can be used to knockdown the activity of individual genes in Caenorhabditis elegans, RNA interference (RNAi) was shown to provide a powerful reverse genetic approach to analyze gene functions in Drosophila organ development 4, 5.
Many organs, including lung, kidney, liver, and vascular system, are composed of branched tubular networks that transport vital fluids or gases 6, 7. The analysis of Drosophila tracheal formation provides an excellent model system to study the morphogenesis of other tubular organs 8. The Berkeley Drosophila genome project has revealed hundreds of genes that are expressed in the tracheal system. To study the molecular and cellular mechanism of tube formation, the challenge is to understand the roles of these genes in tracheal development. Here, we described a detailed method of dsRNA injection into Drosophila embryo to knockdown individual gene expression. We successfully knocked down endogenous dysfusion(dys) gene expression by dsRNA injection. Dys is a bHLH-PAS protein expressed in tracheal fusion cells, and it is required for tracheal branch fusion 9, 10. dys-RNAi completely eliminated dys expression and resulted in tracheal fusion defect. This relatively simple method provides a tool to identify genes requried for tissure and organ development in Drosophila.

RNAi Interference by dsRNA Injection into Drosophila Embryos

RNA interference has been proven very effective to analyze gene function in Drosophila tracheal development. A detailed protocol used by Jiang lab to inject dsRNA into fly embryos to knockdown gene expression is illustrated. This technique has the potential for screening genes required for tissue and organ development in Drosophila.

رني التدخل عن طريق الحقن في الرنا المزدوج الجديلة ذبابة الفاكهة الأجنة

Genetic screening is one of the most powerful methods available for gaining insights into complex biological process 1. Over the years many improvements ...

Electroporation of Craniofacial Mesenchyme

Electroporation is an efficient method of delivering DNA and other charged macromolecules into tissues at precise time points and in precise locations. For example, electroporation has been used with great success to study neural and retinal development in Xenopus, chicken and mouse 1-10. However, it is important to note that in all of these studies, investigators were not targeting soft tissues. Because we are interested in craniofacial development, we adapted a method to target facial mesenchyme.
When we searched the literature, we found, to our surprise, very few reports of successful gene transfer into cartilaginous tissue. The majority of these studies were gene therapy studies, such as siRNA or protein delivery into chondrogenic cell lines, or, animal models of arthritis 11-13. In other systems, such as chicken or mouse, electroporation of facial mesenchyme has been challenging (personal communications, Dept of Craniofacial Development, KCL). We hypothesized that electroporation into procartilaginous and cartilaginous tissues in Xenopus might work better. In our studies, we show that gene transfer into the facial cartilages occurs efficiently at early stages (28), when the facial primordium is still comprised of soft tissue prior to cartilage differentiation.
Xenopus is a very accessible vertebrate system for analysis of craniofacial development. Craniofacial structures are more readily visible in Xenopus than in any other vertebrate model, primarily because Xenopus embryos are fertilized externally, allowing analyses of the earliest stages, and facilitating live imaging at single cell resolution, as well as reuse of the mothers 14. Among vertebrate models developing externally, Xenopus is more useful for craniofacial analysis than zebrafish, as Xenopus larvae are larger and easier to dissect, and the developing facial region is more accessible to imaging than the equivalent region in fish. In addition, Xenopus is evolutionarily closer to humans than zebrafish (&tilde;100 million years closer) 15. Finally, at these stages, Xenopus tadpoles are transparent, and concurrent expression of fluorescent proteins or molecules will allow easy visualization of the developing cartilages. We anticipate that this approach will allow us to rapidly and efficiently test candidate molecules in an in vivo model system.

Craniofacial cartilages develop in close contact with other tissues and are difficult to manipulate in live animals. We are using electroporation to deliver molecular tools during growth of the craniofacial skeleton while bypassing early embryonic effects. This approach will allow us to efficiently test candidate molecules in vivo.

Electroporation من اللحمة المتوسطة الجمجمة

Electroporation is an efficient method of delivering DNA and other charged macromolecules into tissues at precise time points and in precise locations. ...

In vivo Electroporation of Morpholinos into the Adult Zebrafish Retina

Many devastating inherited eye diseases result in progressive and irreversible blindness because humans cannot regenerate dying or diseased retinal neurons. In contrast, the adult zebrafish retina possesses the robust ability to spontaneously regenerate any neuronal class that is lost in a variety of different retinal damage models, including retinal puncture, chemical ablation, concentrated high temperature, and intense light treatment 1-8. Our lab extensively characterized regeneration of photoreceptors following constant intense light treatment and inner retinal neurons after intravitreal ouabain injection 2, 5, 9. In all cases, resident M&uuml;ller glia re-enter the cell cycle to produce neuronal progenitors, which continue to proliferate and migrate to the proper retinal layer, where they differentiate into the deficient neurons. 
	We characterized five different stages during regeneration of the light-damaged retina that were highlighted by specific cellular responses. We identified several differentially expressed genes at each stage of retinal regeneration by mRNA microarray analysis 10. Many of these genes are also critical for ocular development. To test the role of each candidate gene/protein during retinal regeneration, we needed to develop a method to conditionally limit the expression of a candidate protein only at times during regeneration of the adult retina. 
	Morpholino oligos are widely used to study loss of function of specific proteins during the development of zebrafish, Xenopus, chick, mouse, and tumors in human xenografts 11-14. These modified oligos basepair with complementary RNA sequence to either block the splicing or translation of the target RNA. Morpholinos are stable in the cell and can eliminate or "knockdown" protein expression for three to five days 12. 
	Here, we describe a method to efficiently knockdown target protein expression in the adult zebrafish retina. This method employs lissamine-tagged antisense morpholinos that are injected into the vitreous of the adult zebrafish eye. Using electrode forceps, the morpholino is then electroporated into all the cell types of the dorsal and central retina. Lissamine provides the charge on the morpholino for electroporation and can be visualized to assess the presence of the morpholino in the retinal cells. 
	Conditional knockdown in the retina can be used to examine the role of specific proteins at different times during regeneration. Additionally, this approach can be used to study the role of specific proteins in the undamaged retina, in such processes as visual transduction and visual processing in second order neurons.

In vivo Electroporation of Morpholinos into the Adult Zebrafish Retina

A method to conditionally knockdown a target protein&#x2019;s expression in the adult zebrafish retina is described, which involves intravitreally injecting antisense morpholinos and electroporating them into the retina. The resulting protein is knocked down for several days, which allows testing the protein&#x2019;s role in the regenerating or intact retina.

في الجسم الحي من Electroporation Morpholinos في شبكية العين اسماك الزرد الكبار

Many devastating inherited eye diseases result in progressive and irreversible blindness because humans cannot regenerate dying or diseased retinal ...

In vivo Electroporation of Morpholinos into the Regenerating Adult Zebrafish Tail Fin

Certain species of urodeles and teleost fish can regenerate their tissues. Zebrafish have become a widely used model to study the spontaneous regeneration of adult tissues, such as the heart1, retina2, spinal cord3, optic nerve4, sensory hair cells5, and fins6.
The zebrafish fin is a relatively simple appendage that is easily manipulated to study multiple stages in epimorphic regeneration. Classically, fin regeneration was characterized by three distinct stages: wound healing, blastema formation, and fin outgrowth. After amputating part of the fin, the surrounding epithelium proliferates and migrates over the wound. At 33 &deg;C, this process occurs within six hours post-amputation (hpa, Figure 1B)6,7. Next, underlying cells from different lineages (ex. bone, blood, glia, fibroblast) re-enter the cell cycle to form a proliferative blastema, while the overlying epidermis continues to proliferate (Figure 1D)8. Outgrowth occurs as cells proximal to the blastema re-differentiate into their respective lineages to form new tissue (Figure 1E)8. Depending on the level of the amputation, full regeneration is completed in a week to a month.
The expression of a large number of gene families, including wnt, hox, fgf, msx, retinoic acid, shh, notch, bmp, and activin-betaA genes, is up-regulated during specific stages of fin regeneration9-16. However, the roles of these genes and their encoded proteins during regeneration have been difficult to assess, unless a specific inhibitor for the protein exists13, a temperature-sensitive mutant exists or a transgenic animal (either overexpressing the wild-type protein or a dominant-negative protein) was generated7,12. We developed a reverse genetic technique to quickly and easily test the function of any gene during fin regeneration.
Morpholino oligonucleotides are widely used to study loss of specific proteins during zebrafish, Xenopus, chick, and mouse development17-19. Morpholinos basepair with a complementary RNA sequence to either block pre-mRNA splicing or mRNA translation. We describe a method to efficiently introduce fluorescein-tagged antisense morpholinos into regenerating zebrafish fins to knockdown expression of the target protein. The morpholino is micro-injected into each blastema of the regenerating zebrafish tail fin and electroporated into the surrounding cells. Fluorescein provides the charge to electroporate the morpholino and to visualize the morpholino in the fin tissue.
This protocol permits conditional protein knockdown to examine the role of specific proteins during regenerative fin outgrowth. In the Discussion, we describe how this approach can be adapted to study the role of specific proteins during wound healing or blastema formation, as well as a potential marker of cell migration during blastema formation.

In vivo Electroporation of Morpholinos into the Regenerating Adult Zebrafish Tail Fin

We describe a method to conditionally knockdown the expression of a target protein during adult zebrafish fin regeneration. This technique involves micro-injecting and electroporating antisense oligonucleotide morpholinos into fin tissue, which allows testing the protein&#x2019;s role in various stages of fin regeneration, including wound healing, blastema formation, and regenerative outgrowth.

في Electroporation المجراة من Morpholinos في الكبار التجديد زعنفة الذيل الزرد

Certain species of urodeles and teleost fish can regenerate their tissues. Zebrafish have become a widely used model to study the spontaneous regeneration ...

Gene Transfer into Older Chicken Embryos by ex ovo Electroporation

The chicken embryo provides an excellent model system for studying gene function and regulation during embryonic development. In ovo electroporation is a powerful method to over-express exogenous genes or down-regulate endogenous genes in vivo in chicken embryos1. Different structures such as DNA plasmids encoding genes2-4, small interfering RNA (siRNA) plasmids5, small synthetic RNA oligos6, and morpholino antisense oligonucleotides7 can be easily transfected into chicken embryos by electroporation. However, the application of in ovo electroporation is limited to embryos at early incubation stages (younger than stage HH20 - according to Hamburg and Hamilton)8 and there are some disadvantages for its application in embryos at later stages (older than stage HH22 - approximately 3.5 days of development). For example, the vitelline membrane at later stages is usually stuck to the shall membrane and opening a window in the shell causes rupture of the vessels, resulting in death of the embryos; older embryos are covered by vitelline and allantoic vessels, where it is difficult to access and manipulate the embryos; older embryos move vigorously and is difficult to control the orientation through a relatively small window in the shell.
In this protocol we demonstrate an ex ovo electroporation method for gene transfer into chicken embryos at late stages (older than stage HH22). For ex ovo electroporation, embryos are cultured in Petri dishes9 and the vitelline and allantoic vessels are widely spread. Under these conditions, the older chicken embryos are easily accessed and manipulated. Therefore, this method overcomes the disadvantages of in ovo electroporation applied to the older chicken embryos. Using this method, plasmids can be easily transfected into different parts of the older chicken embryos10-12.

Gene Transfer into Older Chicken Embryos by ex ovo Electroporation

A method of gene transfer into chicken embryos at later incubation stages (older than Hamburger and Hamilton stage (HH) 22) is described. This method overcomes disadvantages of in ovo electroporation applied to older chicken embryos and is a useful technique to study gene function and regulation at older developmental stages.

نقل الجينات في أجنة الدجاج أقدم من قبل<em&gt; OVO السابقين</em&gt; Electroporation

The chicken embryo provides an  excellent model system for studying gene function and regulation during  embryonic development. In ovo electroporation is ...

A Comparative Study of Drug Delivery Methods Targeted to the Mouse Inner Ear: Bullostomy Versus Transtympanic Injection

We present two minimally invasive microsurgical techniques in rodents for specific drug delivery into the middle ear so that it may reach the inner ear. The first procedure consists of perforation of the tympanic bulla, termed bullostomy; the second one is a transtympanic injection. Both emulate human clinical intratympanic procedures.
Chitosan-glycerophosphate (CGP) and Ringer&#180;s Lactate buffer (RL) were used as biocompatible vehicles for local drug delivery. CGP is a nontoxic biodegradable polymer widely used in pharmaceutical applications. It is a viscous liquid at RT&#160;but it congeals to a semi solid phase at body temperature. RL is an isotonic solution used for intravenous administrations in humans. A small volume of this vehicle is precisely placed on the Round Window (RW) niche by means of a bullostomy. A transtympanic injection fills the middle ear and allows less control but broader access to the inner ear.
The safety profiles of both techniques were studied and compared by using functional and morphological tests. Hearing was evaluated by registering the Auditory Brainstem Response (ABR) before and several times after microsurgery. The cytoarchitecture and preservation level of cochlear structures were studied by conventional histological techniques in paraformaldehyde-fixed and decalcified cochlear samples. In parallel, unfixed cochlear samples were taken and immediately frozen to analyze gene expression profiles of inflammatory markers by quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR).
Both procedures are suitable as drug delivery methods into the mouse middle ear, although transtympanic injection proved to be less invasive compared to bullostomy.

A Comparative Study of Drug Delivery Methods Targeted to the Mouse Inner Ear: Bullostomy Versus Transtympanic Injection

Two microsurgery approaches for local drug delivery to the inner ear are described here and compared in terms of impact on hearing parameters, cochlear cytoarchitecture and expression of inflammatory markers.

دراسة مقارنة بين المخدرات طرق التسليم المستهدفة إلى الأذن ماوس الداخلية: Bullostomy<em&gt; مقابل</em&gt; بطريق غشاء الطبل حقن

We present two minimally invasive microsurgical techniques in rodents for specific drug delivery into the middle ear so that it may reach the inner ear. ...

Novel Method of Plasmid DNA Delivery to Mouse Bladder Urothelium by Electroporation

Genetically engineered mouse models (GEMMs) are extremely valuable in revealing novel biological insights into the initiation and progression mechanisms of human diseases such as cancer. Transgenic and conditional knockout mice have been frequently used for gene overexpression or ablation in specific tissues or cell types in vivo. However, generating germline mouse models can be time-consuming and costly. Recent advancements in gene editing technologies and the feasibility of delivering DNA plasmids by viral infection have enabled rapid generation of non-germline autochthonous mouse cancer models for several organs. The bladder is an organ that has been difficult for viral vectors to access, due to the presence of a glycosaminoglycan layer covering the urothelium. Here, we describe a novel method developed in lab for efficient delivery of DNA plasmids into the mouse bladder urothelium in vivo. Through intravesical instillation of pCAG-GFP DNA plasmid and electroporation of surgically exposed bladder, we show that the DNA plasmid can be delivered specifically into the bladder urothelial cells for transient expression. Our method provides a fast and convenient way for overexpression and knockdown of genes in the mouse bladder, and can be applied to building GEMMs of bladder cancer and other urological diseases.

We describe a novel method for the delivery of DNA plasmid into the urothelial cells of mouse bladder in vivo through urethra catheterization and electroporation. It offers a fast and convenient way for generating autochthonous mouse models of bladder diseases.

أسلوب الرواية بلازميد الحمض النووي إيصالها إلى الماوس المثانة أوروثيليوم انهانسر

Genetically engineered mouse models (GEMMs) are extremely valuable in revealing novel biological insights into the initiation and progression mechanisms ...