وقدم هذا العمل ممكن من المنح المقدمة إلى JK من مراكز أونتاريو للتميز وصندوق أبحاث أونتاريو. ونود أن نشكر Siddika Pardhan والدكتور بيتر فيرغسون للحصول على المساعدة الفنية أثناء التصوير.

ملاحظة: تم تصميم بروتوكول التالية للاستخدام مع الخلايا الملتصقة. ويطلب تعديلات على تطبيق طريقة إلى الخلايا غير ملتصقة تزرع في تعليق. وقد صممت هذه التجارب CAM موضح في البروتوكول للاستخدام مع الخلايا التي تعبر عن علامة فلوري (على سبيل المثال، GFP، RFP، الخ). مطلوبة الأجنة تسعة أيام الدجاج القديمة في يوم 2 من البروتوكول التجريبي للتجارب CAM. 1. إعداد وترنسفكأيشن من الخلايا السرطانية مع العقاقير [أليغنوكليوتيد] (خدمات الإيدز) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> نضح المتوسطة من T75 قارورة (ق) التي تحتوي على خلايا الفائدة، ويغسل مع 1XPBS، وإضافة 2 مل من 0.25٪ التربسين / EDTA. إضافة 10 مل من متوسط ​​النمو الكامل لكل قارورة ونقل الخلايا في حل لأنبوب 50 مل. عد الخلايا وضبط مستوى الصوت بحيث التركيز النهائي هو 1.0x10 5 خلايا لكل مل. </li><li style=";text-align:right;direction:rtl"> التسمية مجموعتين من قوارير T25: مجموعة واحدة وسيتضمن ثمانية قوارير، وصفت 1-8، وستكون شالحوار الاقتصادي الاستراتيجي لفي الوقت الحقيقي تجربة قياس التمثيل الغذائي. وستحتوي المجموعة الثانية أيضا 8 قوارير وسوف تستخدم للتجربة CAM الجنين الدجاج. إضافة 2 مل من الخلايا في حل كل قارورة ووضعه في الحاضنة (37 ° C، 5٪ CO 2 O / N). </li><li style=";text-align:right;direction:rtl"> في صباح اليوم التالي (يوم 0، 0 الوقت)، والتسمية ثلاثة 5 مل أنابيب النحو التالي: التحكم (عدم استهداف ASO أو سيرنا)، &#39;الهدف من الفوائد &quot;(أي استهداف ASO أو سيرنا)، وLipofectamine عام 2000 (أو ما شابه ترنسفكأيشن الكاشف). تمييع الحلول الأسهم ASO إلى التركيز المناسب مع المتوسطة مجانا المصل في أنبوب المناسب. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة المبلغ المطلوب من كاشف ترنسفكأيشن إلى أنبوب المناسب واحتضان في المصل خالية متوسطة لمدة 5 دقائق. إضافة محلول كاشف ترنسفكأيشن للأنابيب ASO واحتضان لمدة 20 دقيقة. </li></ol></li><li style=";text-align:right;direction:rtl"> إضافة 250 ميكرولتر من السيطرة ASO حل كاشف ترنسفكأيشن إلى كل من قوارير 1-4 في كل مجموعة، و 250ميكرولتر من &quot;الهدف من الفوائد&quot; ASO حل كاشف ترنسفكأيشن إلى كل من قوارير 5-8 في كل مجموعة. احتضان لمدة 4 ساعات (37 ᵒC، 5٪ CO 2). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أثناء الحضانة، وتنفيذ الخطوات الموضحة في القسم 2.1. بعد الحضانة، إضافة 3 مل من المتوسط ​​الكامل على كل قارورة في مجموعة التجربة CAM والعودة إلى الحاضنة O / N (37 ᵒC، 5٪ CO 2). معالجة مجموعة تجربة التمثيل الغذائي وفقا لوصف في القسم 2.2. معالجة التجربة CAM تعيين وفقا للوصف في الفرع 4. </li></ol></li></ol> 2. جهاز الاستشعار البيولوجي إعداد رقاقة والبذر الخلية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> في بيئة معقمة، وغسل بعناية ستة رقائق جهاز الاستشعار البيولوجي مع 400 ميكرولتر من برنامج تلفزيوني. تعقيم رقائق مع 400 ميكرولتر من الايثانول 70٪ لمدة 20 دقيقة. يغسل ثلاث مرات مع 400 ميكرولتر من برنامج تلفزيوني. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وضع رقائق داخل الثقافيه الأنسجة العقيمةأطباق البريد لمنع التلوث. وضع ثلاث رقائق في طبق المسمى &quot;السيطرة&quot;، وثلاثة في طبق المسمى &quot;الهدف من الفائدة. </li></ol></li><li style=";text-align:right;direction:rtl"> تسمية اثنين من 50 مل أنابيب باسم &#39;السيطرة&#39; و &#39;الهدف من الفائدة. غسل الخلايا مع برنامج تلفزيوني وإضافة حجم مناسب من 0.25٪ التربسين / EDTA. الانتظار حتى يفصل أحادي الطبقة وجمع الخلايا من كل قارورة. إيداع الحل في أنبوب المناسب. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> عد الخلايا وضبط مستوى الصوت بحيث التركيز النهائي هو 6.0x10 5 خلية / مل. الطرد المركزي و resuspend الخلايا إذا كان تركيز أولي منخفض جدا. </li></ol></li><li style=";text-align:right;direction:rtl"> إضافة 250 ميكرولتر من محلول الخلية إلى كل رقاقة جهاز الاستشعار البيولوجي في المجموعة المناسبة (أي ما مجموعه 1.25x10 5 خلايا لكل رقاقة). تنفيذ هذه المهمة مجموعة واحدة في وقت واحد لتقليل مخاطر الخلط بين رقائق البطاطس. وضع أطباق العقيمة التي تحتوي على رقائق داخل غرفة الرطوبة لمنع التبخر، ووضع تشا الرطوبةmber في الحاضنة O / N (37 ᵒC، 5٪ CO 2). </li><li style=";text-align:right;direction:rtl"> في صباح اليوم التالي (يوم 1)، نضح بعناية متوسطة من كل رقاقة واستبدالها مع 250 ميكرولتر من النمو المتوسط ​​تستكمل مع المصل بنسبة 0.2٪ بقري جنيني (FBS) والبنسلين والستربتومايسين 1X (P / S). احتضان لمدة 4 ساعات (37 ᵒC، 5٪ CO 2). </li></ol> 3. الأيض قياس تحضير النظام وإعداد الحل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أثناء الحضانة، وإعداد الحلول المخدرات المطلوبة ونظام القياس الأيض للمقايسة القادم. ملاحظة: يحتوي نظام قياس التمثيل الغذائي ما مجموعه ست وحدات. كل وحدة تستوعب رقاقة واحدة في التجربة. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تقسيم الفحص في المجموعات التجريبية التالية: رقاقة واحدة من كل من &quot;السيطرة&quot; و &quot;الهدف من الفوائد&quot; مجموعات لاستقبال السيارة لمدة الفحص. اثنين من رقائق من كل مجموعة لتلقي العلاج من تعاطي المخدرات لفترة محددة من الوقت خلال لssay، تليها سيارة خلال الفترة من الاخفاق. </li><li style=";text-align:right;direction:rtl"> للدراسات توعية المخدرات، تعديل طول، والتوقيت، وتركيز العلاج من تعاطي المخدرات لتتناسب مع دواء معين في السؤال. ملاحظة: للحصول على سيسبلاتين، وتم تحديد الخطوات التالية تجريبيا مع خلايا A549، ويمكن أن تختلف اعتمادا على خط الخلية. تنفيذ كافة مراحل مع معدل التدفق الافتراضي من 4 ميكرولتر / دقيقة. 6 ساعات من النمو المتوسطة + FBS 0.2٪ و1X P / S 24 ساعة من 6 ميكرومتر سيسبلاتين في المتوسط ​​+ 0.2٪ FBS 1X P / S 24 ساعة من النمو المتوسطة + FBS 0.2٪ و1X P / S 18 ساعة من النمو المتوسطة + FBS 0.2٪ و1X P / S 4 ساعات من 0.1٪ تريتون-X ملاحظة: سوف الانحرافات عن هذه الخطوات تتطلب حسابية لتحديد حجم المطلوب من حلول متوسطة والمخدرات على أساس معدل التدفق المطلوب ومدة التجربة. وتقوم الأقسام التالية على الخطوات الموضحة أعلاه. </li></ol></li><li style=";text-align:right;direction:rtl"> التسمية وملء أربعة عشر 50 مل الأنابيب مع 50 مل من النمو المتوسطة + 0.2٪ FBS لد 1X P / S. وضع ستة في واحد قياس التمثيل الغذائي أنبوب نظام الرف، ستة في بلد آخر، والباقيين في رفوف أنبوب الثالث الذي يحتوي أيضا على أنابيب مع سيسبلاتين. ختم رفوف الأولين مع غشاء منفذ الهواء لمنع التبخر. </li><li style=";text-align:right;direction:rtl"> يعد حل من 6 ميكرومتر سيسبلاتين (من حجم مناسب) في المتوسط ​​+ 0.2٪ FBS مع 1X P / S. الاستغناء عن حجم المطلوب من حل سيسبلاتين إلى أربعة وصفت 50 مل أنابيب. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وضع أنابيب في فتحات الأربعة المتبقية في عملية التمثيل الغذائي الثالث أنبوب قياس الرف. ضمان أن يتم وضع الأنابيب في فتحات المناسبة التي تتوافق مع biomodules المطلوب. ختم الأنابيب مع غشاء نفاذية الهواء. </li></ol></li><li style=";text-align:right;direction:rtl"> إعداد وتسمية ستة 50 مل أنابيب وشغل لهم مع 20 مل لكل من 0.1٪ تريتون-X الحل في المتوسط. فإن الحل تريتون-X ليز أي الخلايا المتبقية وتوفير قيمة &quot;الصفر&quot; لكل رقاقة. وضع الأنابيب في قياس التمثيل الغذائي الرابع أنبوب حدة رف وختم خفة دمح غشاء permable الهواء لمنع التبخر المفرط. </li><li style=";text-align:right;direction:rtl"> تحميل رقائق في biomodules وبدء التجربة. </li></ol> 4. CAM تجربة العلاج من تعاطي المخدرات وحقن ملاحظة: الخطوات والإجراءات لإعداد أجنة الدجاج لإجراء تجربة CAM موصوفة في أماكن أخرى 19 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> بدء معالجة CAM تجربة 48 ساعة بعد ترنسفكأيشن (يوم 2). تقسيم الفرعي &quot;السيطرة&quot; و &quot;الهدف من الفوائد&quot; مجموعة إلى قسمين قوارير للمركبة، واثنين من لسيسبلاتين. نضح المتوسطة من قوارير وتجديد مع أي 3 مل من المتوسط ​​الطازجة، أو 6 ميكرومتر سيسبلاتين. احتضان لمدة 6 ساعات (37 ᵒC، 5٪ CO 2). </li><li style=";text-align:right;direction:rtl"> نضح المتوسطة، ثم غسل ويعرض للتريبسين الخلايا. جمع الخلايا trypsinized في حل إلى أربعة وصفت بشكل مناسب 15 مل الأنابيب. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> الطرد المركزي وغسل الخلايا ثلاث مرات مع برنامج تلفزيوني. اعادة تعليق بيليه خلية في 5 مل من برنامج تلفزيوني لد عد الخلايا. </li><li style=";text-align:right;direction:rtl"> ضبط مستوى الصوت بحيث تركيز الخلية النهائي هو 1.0x10 6 خلية / مل. نقل الحل خلية في المسمى 5 مل أنابيب للحقن، ووضع على الجليد. عكس أنابيب بلطف قبل الحقن للتأكد من أن الخلايا هي مختلطة أيضا. </li></ol></li><li style=";text-align:right;direction:rtl"> تخصيص ما مجموعه 24 أجنة الدجاج (9 أيام من العمر) للحقن (6 لكل مجموعة). إجراء الحقن باستخدام إبرة الزجاج تعلق على أنبوب مرن متصلة حقنة 1 مل. يجب أعمى الفرد أداء الحقن لمجموعة العلاج. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> باستخدام مجهر ستيريو، وضخ 1.0x10 5 الخلايا في حجم 100 ميكرولتر إلى الدورة الدموية الوريدية للCAM. استخدام بطيئة، تقنية النبض لحقن حجم كامل من الخلايا. ربت بلطف موقع الحقن مع مسح لينة لوقف تدفق الدم وامتصاص أي تسرب. تسمية كل حاوية الجنين بشكل مناسب بعد كل حقنة. </li></ol></li><li style=";text-align:right;direction:rtl"> تأكد من وجود وزعتهيسود تبادل الخلايا الفلورسنت في الأوعية الدموية للCAM بعد الحقن من خلال وضع تصور لهم باستخدام المجهر الفلورسنت. يحيط علما أي الأجنة التي يبدو أن عدد الخلايا السرطانية منخفضة، أو توزيع ضعيف. </li><li style=";text-align:right;direction:rtl"> وضع أجنة الدجاج في غرفة الرطوبة وتخزينها في حاضنة (37 ° C، الرطوبة 60٪). الانتظار 7-9 أيام قبل تعداد البؤر النقيلي. </li></ol> 5. النقيلي التركيز التعداد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> خلال فترة الحضانة 7-9 يوم، ومراقبة الأجنة وتجاهل أي منها ميتة. تأكد من أن غرفة الرطوبة تبقى رطبة في جميع الأوقات خلال فترة الحضانة. </li><li style=";text-align:right;direction:rtl"> باستخدام مجهر ستيريو الفلورسنت في 20X التكبير، مسح السطح العلوي بأكمله للCAM الجنين في، نمط الشبكة مثل منتظم. </li><li style=";text-align:right;direction:rtl"> حساب عدد من البؤر المنتشر في كل مجال الرؤية، ثم حصر عدد ليصبح المجموع النهائي في الجنين. سوف تفعل ذلك لأجنة ستة في كل مجموعة تقديم متوسط ​​عدد سبؤر النقيلي و لكل معاملة. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

الكتاب ليس لديهم ما يكشف.

نظرا لتكلفة الكامنة والمخاطر المرتبطة التجارب السريرية، هناك حاجة لتطوير أفضل وأكثر صرامة منهجية اختبار ما قبل السريرية لتقييم كاف نظم العلاج المضاد للسرطان الرواية. الحالية تقنيات شائعة الاستخدام جميع نقاط الضعف المعرض التي قد تحد من قدرتها على التمييز بين الأهد?...

اكتسبت مقاومة لاستهداف و / أو علاج السرطان السامة للخلايا هي مشكلة السريرية الهامة التي يمكن أن تؤدي إلى فشل العلاج، الانتكاس، وزيادة معدل وفيات مرضى 1. ونظرا لمستوى عال من عدم التجانس في معظم الأورام، بل هو اليقين الرياضي التي ورم من عدد الخلايا عالية بما فيه الكفاية سوف تحتوي مجموعة فرعية من خلايا مقاومة للعلاج واحدة أو مجتمعة استهداف المسارات الجزيئية التي تعتمد تلك الخلايا من أجل البقاء 2،3. الخلايا السرطانية هذه يمكن تحديدها بشكل إيجابي للأثناء العلاج، مما يؤدي إلى تكرار المرض. تطوير علاجات جديدة تستهدف في الوقت نفسه آليات بقاء الخلايا السرطانية المختلفة، سواء قبل أو بعد اختيار بوساطة العلاج، وبالتالي من المهم سريريا. وهناك مستوى عال من عدم الاستقرار الجينوم وطفرة في الجينوم الورم هو سمة الأساسية التي تميز الخلايا السرطانية من خلايا المضيف غير ورم-4. ونتيجة لذلك، ويلقون مفيدةاستراتيجية لتر إلى زيادة فعالية العلاج الكيميائي الضارة DNA ومنع تطور المقاومة لمنع بنشاط إصلاح الحمض النووي في الخلايا السرطانية 5. هذا هو الحقل النشط التحقيق ومجموعة متنوعة من الأهداف إصلاح الحمض النووي جديدة يجري استكشافها في إعداد ما قبل السريرية. وقد تم تطوير عدد من جزيء صغير أو مثبطات القائم على العقاقير من هذه الأهداف وتشهد اختبار 6-8. والهدف هو التعرف على المرشحين ما قبل السريرية الواعدة وتقييم سلامتها وفعاليتها في التجارب السريرية. ارتفاع تكلفة التجارب السريرية ومخاطر الفشل (لمجموعة متنوعة من الأسباب بما في ذلك تقييم ما قبل السريرية دون المستوى الأمثل) هي عقبات كأداء أمام التقدم في تطوير علاجات جديدة 9. استخدام نماذج مناسبة وصارمة ما قبل السريرية لتقييم كاف الأهداف العلاجية والأدوية المرشحة الجديد قد يقلل من نسبة الفشل عالية من التجارب السريرية 10 </suP&gt;. بعض أساليب ما قبل السريرية تستخدم عادة لتقييم فعالية نظم جديدة مضادة للسرطان هي: أ) قياس القدرة على الحد من انتشار الخلايا السرطانية في المختبر (المقايسات تكاثر الخلايا)، ب) تخفيض الناجم عن العلاج في قدرة الخلايا السرطانية ل المستعمرات زراعة الأنسجة شكل (المقايسات تشكيل مستعمرة)، ج) تخفيض الناجم عن العلاج في النشاط الأيضي الخلايا السرطانية في المختبر (تحويل الأكسدة صبغ)، د) التي يسببها العلاج تحريض في المختبر موت الخلايا السرطانية (أفكارك، نخرية، ذاتية البلعمة، ويرتبط مع الانقسام، وغيرها) 11، وه) في الجسم الحي الحد من النمو أو الاجتثاث من الفأر والإنسان xenografts 12-14 العلاج التي يسببها. ومن أوجه الضعف الرئيسية للفي المختبر الطرق المذكورة هو أن أيا منها لا توفر المستمر التقييم في الوقت الحقيقي لتأثير العلاجات مرشح. بدلا من ذلك، أنها توفر المعلومات فقط في المختارة، نقاط زمنية متباعدة-أثناء العلاج. وقد تضاءلت هذه القياسات القدرة على التفكير بدقة حجم وتوقيت استجابات الخلايا السرطانية. في الجسم الحي ونماذج الماوس طعم أجنبي محدودة أيضا التكلفة العالية، وطول الوقت لإكمال، وخطر دون المستوى الأمثل الجرعات والعلاج توقيت (جدولة). وبالإضافة إلى ذلك، هناك أدلة على أن نماذج القوارض طعم أجنبي هي تنبؤ محدودة من الفعالية السريرية في البشر، مقارنة مع التقييم في المختبر من ردود الخلايا السرطانية الإنسان الأساسية وخطوط الخلايا السرطانية البشرية التي أنشئت لمرشح التدخلات العلاجية 15،16. نحن وضعت بروتوكولا تركيبة جديدة لتقييم مجموعات دواء جديد قبل سريريا، بطريقة تعالج نقاط الضعف في الإجراءات أكثر شيوعا المذكورة أعلاه. في مكان الانتشار، تشكيل مستعمرة، أو الأكسدة صبغ المقايسات التحويل، نحن تستخدم وحدة قياس التمثيل الغذائي لتحليل التصاق الخلية، والتنفس، وتحمض في الوقت الحقيقيخلال فترة العلاج كاملة 17. في وقت واحد، ونحن التحقيق في الآثار المترتبة على الجمع بين العلاج في الجسم الحي باستخدام الجنين الدجاج مشيمائي غشاء (CAM) نموذج من الغزو والانبثاث 18،19. استخدمنا هذه الأساليب لتقييم قدرة قليل النوكليوتيد العقاقير (ASO) تستهدف BRCA2 لتحفيز فعالية يشيع استخدامها سيسبلاتين المخدرات العلاج الكيميائي.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

نظرا لمستوى عال من عدم التجانس والطفرات الكامنة في السرطانات البشرية، والعلاجات وكيل واحدة، أو نظم الجمع التي تستهدف نفس المسار، من المحتمل أن تفشل. ولا بد من التركيز على تثبيط الممرات التي هي المسؤولة عن المقاومة الذاتية و / أو التكيف للعلاج. حقل نشط من التحقيق هو تطوير واختبار مثبطات إصلاح الحمض النووي التي تشجع على العمل، ومنع مقاومة، وتستخدم عادة العلاج الكيميائي والعلاج الإشعاعي. استخدمنا بروتوكول رواية لتقييم فعالية BRCA2 تثبيط كوسيلة لتوعية الخلايا السرطانية على الحمض النووي الضارة سيسبلاتين المخدرات. تم رصد استقلاب الخلية السرطانية (تحمض والتنفس) في الوقت الحقيقي لمدة 72 ساعة لتحديد فعالية العلاج على أساس كل دقيقة دقيقة. في الجمع، وأجرينا تقييما لتردد المنتشر باستخدام غشاء مشيمائي جنين الدجاج (CAM) نموذج من التسرب والغزو. هذابروتوكول يعالج بعض نقاط الضعف في يشيع استخدامها في التجارب المختبرية وأساليب الجسم الحي لتقييم نظم جديدة علاج السرطان. ويمكن استخدامه بالإضافة إلى الطرق الشائعة مثل فحوصات تكاثر الخلايا، المقايسات موت الخلايا، وفي الدراسات المجراة طعم أجنبي الفئران، للتمييز بشكل وثيق بين أهداف المرشح والوكلاء، وحدد فقط المرشحين الواعدين لمزيد من التطوير.

النتائج والأرقام تكييفها بإذن من الأعمال المنشورة 22. BRCA2 تثبيط يؤدي الى انخفاض في التنفس في سيسبلاتين تعامل الخلايا السرطانية الخلايا السرطانية A549 رئة الإنسان تعامل مع BRCA2 استهداف...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

تقييم فعالية سرطان المخدرات توعية<em&gt; في المختبر</em&gt; و<em&gt; في فيفو</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K Views.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Video: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

و في المختبر النظام الدراسي لاستئصال ورم من الخمول وتبديل للنمو النقيلي

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

يعيش التصوير من الاستجابة للأدوية الأورام المكروية في في نماذج الماوس من سرطان الثدي

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

بطء الإفراج تسليم المخدرات من خلال Elvax 40W إلى الجرذ الشبكية: الآثار المترتبة على علاج الحالات المزمنة

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

الحقن الشريان السباتي لوأضافا الدوائية وتحليل Taxanes في الفئران

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

في فيفو وفيفو السابقين المداخل لدراسة سرطان المبيض النقيلي الاستعمار من الهياكل التبانة بقعة في البريتوني الدهنية

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

دراسة سرطان البنكرياس الجذعية خصائص الخلايا لتطوير استراتيجيات علاجية جديدة

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

نضوب خلايا الفأر من Xenografts ورم الإنسان يحسن بشكل ملحوظ تحليل المصب من الخلايا المستهدفة

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Forskolin-الناجم عن تورم في الأمعاء Organoids: ل<em&gt; في المختبر</em&gt; الفحص لتقييم الاستجابة للدواء في التليف الكيسي المرضى

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

تحليل الأمثل ل<em&gt; في فيفو</em&gt; و<em&gt; في المختبر</em&gt; كبدي تشحم

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the body, an additional extraction procedure is commonly required to release the active constituents from raw herbs. Water decoction is a classical extraction procedure that is still broadly used in the clinical settings. Here, we propose a detailed protocol for er-xian decoction (EXD) in order to apply herbal decoctions to experimental studies. The calculation of an animal-appropriate dose is described, as well as the four main steps of EXD: soaking, water decoction, filtration, and concentration. In addition, serum-containing EXD is introduced to rats as a means of in vitro validation. Here, rats were orally administered EXD for three days. Blood samples were then collected, inactivated, centrifuged, and filtered. The serum, diluted with the culture medium, can be utilized to treat cells or tissues in vitro. For example, EXD was applied to both in vivo and in vitro studies and demonstrated that EXD enhances osteogenesis. This protocol can be used as a reference for the preparation and application of herbal medicines.

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Here, we present the preparation of an er-xian decoction (EXD) in four steps&#8212;soaking, decoction, filtration, and concentration&#8212;and demonstrate the administration of a prepared EXD-containing serum to rats. These methods are applicable to the in vivo and in vitro study of herbal decoctions such as traditional Chinese medicines.

إعداد الأدوية العشبية: إير-زيان ديكوتيون و إير-زيان التي تحتوي على مصل ل<em&gt; في فيفو</em&gt; و<em&gt; في المختبر</em&gt; التجارب

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...