The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

1. قالب التحضير ملاحظة: أي قالب الحمض النووي الجيني يشتبه في احتوائها على DNA المستمدة من واحدة من سبعة أنواع الأيمرية التي تصيب الدجاج ويمكن استخدام قالب لتحديد الأنواع الأيمرية القائم على LAMP. عينات الأنسجة المعوية لتحليل تشخيصي المجال ينبغي جمع خلال روتينية بعد الوفاة كما هو موضح هنا. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> اختيار القسم (أو الأقسام) من الأمعاء لفحصها. انظر الجدول رقم 1 لدليل لاختيار الموقع العينة والأنواع الأيمرية الأكثر احتمالا أن يكون حاضرا 18 والشكل 1 لمجموعة أنواع محددة من التوزيع وموقع من مواقع أخذ العينات. ملاحظة: هذا هو ذات أهمية رئيسية منذ الأيمرية هي أبرزها الموقع المضيف معين. كل الأنواع التي تصيب الدجاج تم تعريفه من قبل المنطقة المعوية أنه يستهدف 19. قد تكون أثرت على قرار من خبرة سابقة في المزرعة، والفائدة في واحد أو موإعادة الأنواع الأيمرية محددة أو المؤشرات التشخيصية الأخرى 6. </li><li style=";text-align:right;direction:rtl"> المكوس 5 سم أو أطوال أطول من قسم الأمعاء (ق) المختارة لاختبار الأيمرية باستخدام مقص العقيمة أو مشرط. اختياريا، وتخزين العينات لتحليلها لاحقا في تثبيتي مثل على سبيل المثال في RNAlater 18 أو 95٪ من الإيثانول. ملاحظة: إذا تخزينها في الإيثانول العينة يجب غسلها جيدا في العقيمة تريس ethylenediaminetetraacetic حمض (TE) العازلة قبل الاستخدام. </li><li style=";text-align:right;direction:rtl"> قطع العينة مفتوحة طوليا، وإزالة محتويات الأكثر المعوية (إذا كان موجودا) وكشط الخلايا من الطبقة المخاطية مجانا باستخدام إما حافة معقمة شريحة ميكروسكوب زجاجية أو شفرة مقص الإيثانول / اللهب تعقيمها. اختياريا لعينة المجمعة تشمل الخلايا من كل أربعة من المواقع الأنواع محددة في الامعاء في أنبوب واحد. </li><li style=";text-align:right;direction:rtl"> وضع مواد كشط في العقيمة 1.5 مل المسمار أعلى أنبوب microcentrifuge تحتوي على 100 ميكرولتر العقيمة العازلة TE بما في ذلك 10٪ (ث / ت) Chelex 100 الراتنج. </li><li style=";text-align:right;direction:rtl"> يهز كل عينة بقوة لمدة 1 دقيقة. تأكد من أن رأس المسمار مغلق بإحكام ثم احتضان في حمام الماء المغلي لمدة 10 دقيقة. </li><li style=";text-align:right;direction:rtl"> بعد الغليان تسمح لكل عينة لتبرد في درجة حرارة الغرفة لمدة 1-2 دقيقة. </li><li style=";text-align:right;direction:rtl"> الطرد المركزي كل عينة باستخدام microcentrifuge في سرعة قصوى (على سبيل المثال، ~ 10،000 x ج) لمدة 1 دقيقة. </li><li style=";text-align:right;direction:rtl"> جمع 2 ميكرولتر من طاف مما أدى إلى أن يكون القالب في كل فحص LAMP التي يتعين الاضطلاع بها. اختياريا، تجمع أكثر من موقع الأمعاء في أنبوب واحد لتوفير الفحص في مواقع متعددة. </li></ol> 2. الأيمرية LAMP التمهيدي إعداد (ما قبل الفحص) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد الأسهم التمهيدي الأيمرية LAMP كافية ل100 المقايسات: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعادة تشكيل كل lyophilised الأيمرية LAMP التمهيدي بإضافة الماء الصف الجزيئية إلى تركيز 100 ميكرومتر (كما هو محدد من قبل الشركة المصنعة). إذا لم يكن محددا، وحساب حجم الصف الجزيئية المياه اللازمة النقيبز الأوزان البدنية والجزيئية من كل التمهيدي. </li><li style=";text-align:right;direction:rtl"> ماصة 60 ميكرولتر الصف الجزيئية المياه إلى 0.5 مل الوجه العلوي أنبوب microcentrifuge منفصلة لكل نوع الأيمرية أن يعاير. </li><li style=";text-align:right;direction:rtl"> إضافة الاشعال FIP، BIP، F3، B3، LF وLB محددة إلى الهدف الأنواع الأيمرية إلى الماء باستخدام كميات هو مبين في الجدول رقم 2، وخلق سلسلة من يمزج التمهيدي سبعة أنواع محددة. </li><li style=";text-align:right;direction:rtl"> لفترة وجيزة دوامة مزيج الحل التمهيدي، ثم نبض microfuge وتجميد حتى المطلوبة. </li></ol></li><li style=";text-align:right;direction:rtl"> إعداد mastermix رد فعل LAMP لكل الأنواع الأيمرية أن يعاير. مضاعفة كميات هو مبين في الجدول 3 من قبل عدد من العينات وإضافة ثلاثة إلى مراقبة إيجابية، والسيطرة السلبية وpipetting لالغيار. ماصة إلى 0.5 أو 1.5 مل الوجه العلوي أنبوب microcentrifuge. </li></ol> 3. الأيمرية LAMP الفحص <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ماصة 23 ميكرولتر الأيمرية أنواع محددة بتوقيت جرينتش DNA بوليميريز / LAMP mastermix إلى 0.5 مل أنبوب microcentrifuge. </li><li style=";text-align:right;direction:rtl"> إضافة قالب DNA 2 ميكرولتر (المعد في القسم 1)، مما يجعل حجم رد الفعل النهائي من 25 ميكرولتر. </li><li style=";text-align:right;direction:rtl"> إضافة الحمض النووي الجيني 2 ميكرولتر الأيمرية أنواع محددة لرد فعل واحد (مراقبة إيجابية). إضافة 2 ميكرولتر المياه الصف الجزيئية إلى رد فعل (المراقبة السلبية). ملاحظة: إذا كان الحمض النووي الجيني أنواع محددة لا يتوفر على LAMP إيجابي السابق أو منتج PCR القياسية يمكن أن تستخدم بدلا من ذلك. </li><li style=";text-align:right;direction:rtl"> احتضان في حمام مائي أو كتلة الحرارة عند 62 درجة مئوية لمدة 30 دقيقة. اختياريا، دي-تفعيل البلمرة بتوقيت جرينتش DNA عن طريق التسخين إلى 80 درجة مئوية لمدة 10 دقيقة إذا كان رد الفعل لن تكون قراءة الفور. </li></ol> 4. LAMP الفحص للقراءة خارج <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> وفي ختام حضانة تقييم اللون من كل رد فعل من جانب العين تحت ضوء داخلي. نتائج سلبية تظهر الوردي إلى البنفسجي في اللون، وتظهر نتائج إيجابية السماء الزرقاء 20. </li><li style=";text-align:right;direction:rtl"> اختياريا، تأكيد نتيجة الفحص LAMP في laboratأوري عن طريق خلط 5 ميكرولتر ناتج التفاعل LAMP مع 1 ميكرولتر عازلة هلام DNA تحميل لالاغاروز الكهربائي هلام باستخدام 2٪ هلام الاغاروز في 1 × تريس / البورات / EDTA (TBE) العازلة، ملطخة مسبقا باستخدام صمة عار الحمض النووي (5 ميكرولتر في 50 مل الاغاروز). إضافة 5 ميكرولتر من 1KB الجزيئي سلم DNA حجم حارة 1 من هلام للسماح حساب حجم شظية. </li></ol>

<ol>
	<li>Chapman, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+selective+review+of+advances+in+coccidiosis+research.">A selective review of advances in coccidiosis research.</a> Adv Parasitol. 83, 93-171 (2013).</li><li>Shirley, M. W., Smith, A. L., Tomley, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+biology+of+avian+Eimeria+with+an+emphasis+on+their+control+by+vaccination.">The biology of avian Eimeria with an emphasis on their control by vaccination.</a> Adv Parasitol. 60, 285-330 (2005).</li><li>Fornace, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Occurrence+of+Eimeria+species+parasites+on+small-scale+commercial+chicken+farms+in+Africa+and+indication+of+economic+profitability.">Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability.</a> PLoS ONE. 8 (12), e84254 (2013).</li><li>Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+analysis+of+Eimeria+spp.+populations+in+relation+to+performance+levels+of+broiler+chicken+farms+in+Arkansas+and+North+Carolina.">Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina.</a> J Parasitol. 95 (4), 871-880 (2009).</li><li>Peek, H. W., Landman, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coccidiosis+in+poultry:+anticoccidial+products,+vaccines+and+other+prevention+strategies.">Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies.</a> Vet Q. 31 (3), 143-161 (2011).</li><li>Johnson, J., Reid, W. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anticoccidial+drugs:+lesion+scoring+techniques+in+battery+and+floor-pen+experiments+with+chickens.">Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens.</a> Exp Parasitol. 28 (1), 30-36 (1970).</li><li>Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+survey+of+the+economic+impact+of+subclinical+Eimeria+infections+in+broiler+chickens+in+Norway.">A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway.</a> Avian Pathol. 37 (3), 333-341 (2008).</li><li>Procunier, J., Fernando, M., Barta, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+and+strain+differentiation+of+Eimeria+spp.+of+the+domestic+fowl+using+DNA+polymorphisms+amplified+by+arbitrary+primers.">Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers.</a> Parasitology Research. 79 (2), 98-102 (1993).</li><li>Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+diagnostic+PCR+assay+for+the+detection+and+discrimination+of+four+pathogenic+Eimeria+species+of+the+chicken.">Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken.</a> Avian Pathol. 27 (5), 490-497 (1998).</li><li>Vrba, V., Blake, D. P., Poplstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+real-time+PCR+assays+for+detection+and+quantification+of+all+seven+Eimeria+species+that+infect+the+chicken.">Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken.</a> Vet Parasitol. 174 (3-4), 183-190 (2010).</li><li>Morris, G. M., Gasser, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotechnological+advances+in+the+diagnosis+of+avian+coccidiosis+and+the+analysis+of+genetic+variation+in+Eimeria.">Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria.</a> Biotechnol Adv. 24 (6), 590-603 (2006).</li><li>Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Investing in animal health research to alleviate poverty. , (2002).</li><li>Nagamine, K., Hase, T., Notomi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accelerated+reaction+by+loop-mediated+isothermal+amplification+using+loop+primers).">Accelerated reaction by loop-mediated isothermal amplification using loop primers).</a> Mol Cell Probes. 16 (3), 223-229 (2002).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), E63 (2000).</li><li>Kaneko, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+enterotoxigenic+Clostridium+perfringens+in+meat+samples+by+using+molecular+methods.">Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.</a> Appl Environ Microbiol. 77 (21), 7526-7532 (2011).</li><li>Karanis, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+preliminary+evaluation+of+a+loop-mediated+isothermal+amplification+procedure+for+sensitive+detection+of+cryptosporidium+oocysts+in+fecal+and+water+samples.">Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples.</a> Appl Environ Microbiol. 73 (17), 5660-5662 (2007).</li><li>Xue, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+detection+of+Infectious+bursal+disease+virus+by+reverse+transcription+loop-mediated+isothermal+amplification+assay.">Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay.</a> J Vet Diagn Invest. 21 (6), 841-843 (2009).</li><li>Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+(LAMP)+assays+for+the+species-specific+detection+of+Eimeria+that+infect+chickens.">Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.</a> BMC Vet Res. 7 (1), 67 (2011).</li><li>Long, P., Joyner, L., Millard, B., Norton, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+laboratory+techniques+used+in+the+study+and+diagnosis+of+avian+coccidiosis.">A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis.</a> Folia Veterinaria Latina. 6 (3), 201-217 (1976).</li><li>Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+of+loop-mediated+isothermal+amplification+reaction+by+using+hydroxy+naphthol+blue.">Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.</a> BioTechniques. 46 (3), 167-172 (2009).</li><li>Arakawa, A., Baba, E., Fukata, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+tenella+infection+enhances+Salmonella+typhimurium+infection+in+chickens.">Eimeria tenella infection enhances Salmonella typhimurium infection in chickens.</a> Poult Sci. 60 (10), 2203-2209 (1981).</li><li>Blake, D. P., Smith, A. L., Shirley, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplified+fragment+length+polymorphism+analyses+of+Eimeria+spp.:+an+improved+process+for+genetic+studies+of+recombinant+parasites.">Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites.</a> Parasitol Res. 90 (6), 473-475 (2003).</li><li>Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Campylobacter+spp.+in+chicken+fecal+samples+by+real-time+PCR.">Detection of Campylobacter spp. in chicken fecal samples by real-time PCR.</a> J Clin Microbiol. 42 (11), 5125-5132 (2004).</li><li>Raj, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR-based+quantification+of+Eimeria+genomes:+a+method+to+outweigh+underestimation+of+genome+numbers+due+to+PCR+inhibition.">Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition.</a> Avian Pathol. 42 (4), 304-308 (2013).</li><li>Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eimeria+maxima:+the+influence+of+host+genotype+on+parasite+reproduction+as+revealed+by+quantitative+real-time+PCR.">Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR.</a> Int J Parasitol. 36 (1), 97-105 (2006).</li><li>Beck, H. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+approaches+to+diversity+of+populations+of+apicomplexan+parasites.">Molecular approaches to diversity of populations of apicomplexan parasites.</a> Int J Parasitol. 39 (2), 175-189 (2009).</li></ol>

The authors declare that they have no competing financial interests.

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~&#163;0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment. 
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25. 
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

إنتاج الدجاج العالمي زاد عشرة أضعاف على مدى السنوات ال 50 الماضية مع العالم النامي تستضيف ما يقرب من أربعة أضعاف التوسع الذي شهدته بلدان العالم المتقدم <a href="http://www.faostat.org">(www.faostat.org)</a> . كما نمت أهمية إنتاج الدجاج للأمن الغذائي العالمي كذلك فعلت الملف الشخصى مسببات الأمراض التي يمكن أن تسبب مرض خطير في الدجاج. واحد مثال هي الأنواع الأيمرية، الطفيليات في كل مكان والتي يمكن أن تسبب المرض المعوي الكوكسيديا 1. أينما وتربى الدجاج من المرجح أن تكون مشتركة 2-4 واحد أو أكثر من الأنواع الأيمرية. في العالم المتقدم يتم التحكم الأيمرية المقام الأول عن طريق الوقاية الكيميائية، وتوظيف برامج المكوك أو دوران للحد من تأثير المقاومة 5. وتستخدم اللقاحات الحية أيضا في أنظمة حيث القيمة الطيور كافية لتبرير التكلفة (على سبيل المثال، تربية الماشية، والطبقات وبعض الفراريج 5). ونتيجة لدورة الفتشوبLT هذه التدابير غالبا ما تسيطر الكوكسيديا السريري بشكل جيد، على الرغم من العدوى دون السريرية هو شائع 5. في التطعيم العالم النامي أمر نادر وتطبيق المخدرات في كثير من الأحيان أبلغ أقل أيضا. ونتيجة لذلك الكوكسيديا الفرعي السريرية والسريرية هو أكثر شيوعا ويمارس تأثير اقتصادي كبير 3. وقد اعتمد تشخيص العدوى eimerian تقليديا على الآفة وسجل بعد الوفاة، على الرغم من أن الكتاب من سجل النظام الأكثر استخداما على نطاق واسع وعلق أنه بالنسبة لبعض الأنواع &quot;يبدو المشكوك فيه ما إذا كان ينبغي حاول هذا الإجراء في أي ولكن باعتدال شديدة العدوى&quot; (6). ويمكن جمع أدلة التكميلي من خلال الكشف المجهري للمقاومة للبيئة مرحلة البيوض المتكيسة دورة الحياة في عينات البراز أو القمامة، على الرغم من تداخل التشكل يمكن أن نخلط جميع ولكن الخبير 6،7. بدائل الجزيئية باستخدام تفاعل البلمرة المتسلسل (PCR)، amplificatio عشوائيوقد ن من متعدد الأشكال DNA PCR (RAPD-PCR) والتكنولوجيات PCR الكمي متاح لمدة تصل إلى 20 سنوات 8-10، ولكن حتى الآن فشلوا لتصبح شعبية. حساب النسبي ومتطلبات معدات المختبرات المتخصصة أو معالجة حدت امتصاص، وعلى الرغم من الطبيعة في كثير من الأحيان غير موضوعية وتطلبا من الناحية الفنية من pathology- كبار السن والنهج القائم على الفحص المجهري 10،11. وهذه القيود يمكن أن يكون مبالغا فيه في كثير من المناطق الأكثر فقرا من العالم مثل جنوب شرق آسيا، حيث قد يكون تأثير الكوكسيديا على الفقر أكبر نسبيا 12. وردا على ذلك هناك طلب واضح عن الجديد واضحة وحساسة، ولكن فعالة من حيث التكلفة، فحوصات تشخيصية الأيمرية أنواع محددة. متحاور التضخيم (LAMP) بوساطة حلقة هو وسيلة سهلة لإعداد DNA تقنية يحركها البلمرة التي هي قادرة على تضخيم كميات كبيرة من الحمض النووي. الأهم من ذلك، يستخدم LAMP على polymera بتوقيت جرينتش DNAحد ذاته بدلا من البلمرة DNA طق التي يشيع استخدامها في PCR، مما يسهل تضخيم DNA عند درجة حرارة ثابتة واحدة دون الحاجة لركوب الدراجات الحرارية 13،14. LAMP يمكن أن تكون قابلة للتطبيق حتى في المختبر الأكثر بدائية أو في الميدان. ومن خلال تميزها المقاومة النسبية للعديد من مثبطات PCR، وحساسية عالية وخصوصية، تم وضع المقايسات LAMP لمجموعة واسعة من مسببات الأمراض بما في ذلك فيروس داء الغومبورو، المطثية الحاطمة والكريبتوسبوريديوم 15-17. وردا على الطلب على التشخيص الأيمرية فعالة من حيث التكلفة أنواع محددة جديدة وقد وضعت لجنة من المقايسات LAMP محددة لكل من سبعة أنواع الأيمرية التي تصيب الدجاج 18. وتشمل التطبيقات لفحوصات جديدة للرصد الطفيل واقعة ذات قيمة خاصة نظرا لارتباط الأنواع مثل الأيمرية ماكسيما أو الأيمرية الفاتكة مع المؤسسة العامة الاقتصادي الضعيفrformance 3،4. وتشمل التطبيقات الأخرى تقييم فعالية الاستراتيجية المزرعة anticoccidial، تشخيص العدوى دون السريري أو المرض السريري وتقييم المخاطر التي يشكلها الأيمرية إلى مزرعة.

<table border="0" cellpadding="0" cellspacing="0" width="889">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">Name</td>
			<td style="width:161px;">Company</td>
			<td style="width:139px;">Catalogue number</td>
			<td style="width:295px;">Comments</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">RNAlater</td>
			<td style="width:161px;">Ambion</td>
			<td style="width:139px;">AM7024</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Ethanol</td>
			<td style="width:161px;">VWR Chemicals</td>
			<td style="width:139px;">20821.321</td>
			<td style="width:295px;">Caution, highly flammable</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">100 x Tris-EDTA (TE) buffer concentrate</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">T9285</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Chelex 100 resin</td>
			<td style="width:161px;">Bio-Rad</td>
			<td style="width:139px;">142-1253</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Molecular grade water</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">10977035</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTAACATTTCGCTTCACGGAC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATGAGCAAGTGGAACACCTTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. acervulina BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TAAGGTTACACCCGTGGAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. acervulina LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCATGCACAAAGCGACTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GGCCATCAAGTTCCATGAGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCAACCTCCTGAGTGTGGTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. brunetti BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAAACGCTCGAACATGGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. brunetti LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CTTCTCCACAGACCCAGAGGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACTACGGAAAAGTGCGTAGCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCTTCCTCCCTTCTGAAAACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAGTCACTGCTGATGTACCAAA 
			AG-GAACTATGCCGCTTTCCCCTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. maxima BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CAAGCCTACGCGGACATC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. maxima LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TTATGCAGCTGGGTCAACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ACGATAGCCAAGACACGTAAGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCCCGTGATAAGAGTAGGAACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCGGGTCGTGAGATTTAAATT 
			AT-GGAAGATCAGGACGGGCACT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. mitis BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTCAGTTGATGAACAAGCGA 
			GA-TGCGCCTCTAGAATCAAGACG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TCCATGCATCCCCTTGTT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. mitis LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGTGGGCACAGATTGATTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*TGGCTTTCCCGCGTACC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGGCCCAACACAAAGACTG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCTTGAGTTTTAAGCTATGCA 
			CA-GACCCAAGCAGCTCACCAA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. necatrix BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCTGTAACTTGGGACGTTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. necatrix LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAACAGCCGGAGCCTCTC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCCTTGTATGTTGCTGTTTCT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCGCACGAATCTGAATCACAC</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*ATCTCCTCAAAGACTTTCGCGT 
			A-GCGCTTGGCTATATCCATAGG</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. praecox BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GAATAGCATTGCCAGGTGG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. praecox LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTCCACTGTCATTAATATTGC 
			TGC</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella F3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTTGTGAAGGTCAGCGTG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella B3</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCTGAGTCCATACGTACTTCCT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella FIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GCCACTGCTATGGAAAGTCAC 
			AC-CATAACTGGCATGCAGGGGT</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella BIP</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*GTTTGGCCCGAAAGTTGTGAA 
			GA-CGTCAGAAATTGCTGCCCAAT</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">E. tenella LB</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CGCATGTGCAGTTGAAGACA</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:295px;">E. tenella LF</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">VC00021</td>
			<td style="width:295px;">*CCAAATGTATCTGCTAGTTATA 
			TTAACAAG</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x ThermoPol reaction buffer</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">B9004S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;width:295px;">MgSO4</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">M7506</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">dNTPs</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">U1330</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Betaine solution (5 M)</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">B0300</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Bst polymerase</td>
			<td style="width:161px;">New England Biolabs</td>
			<td style="width:139px;">M0275S</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Hydroxynaphthol blue</td>
			<td style="width:161px;">Sigma-Aldrich</td>
			<td style="width:139px;">33936</td>
			<td style="width:295px;">Dissolved in molecular grade water.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">UltraPure agarose</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">16500-500</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">10 x Tris/Borate/EDTA (TBE) buffer</td>
			<td style="width:161px;">Invitrogen</td>
			<td style="width:139px;">AM9863</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">Blue/Orange DNA loading dye (x6)</td>
			<td style="width:161px;">Promega</td>
			<td style="width:139px;">G1881</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:295px;">GeneRuler 1Kb DNA ladder</td>
			<td style="width:161px;">Thermo Scientific</td>
			<td style="width:139px;">SM0313</td>
			<td style="width:295px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">SafeView nucleic acid stain</td>
			<td style="width:161px;">NBS Biologicals</td>
			<td style="width:139px;">NBS-SV</td>
			<td style="width:295px;"></td>
		</tr>
	</tbody>
</table>

loop-mediated isothermal amplification (lamp) assays for the species-specific detection of eimeria that infect chickens

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm&#8217;s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

التحقق من صحة الفحص أثناء التحقق من الصحة تم اختبار كل الأيمرية أنواع محددة LAMP الفحص باستخدام لوحة عينات DNA نقية تمثل جميع سبعة أنواع الأيمرية التي تصيب الدجاج، وكذلك الحمض النووي الجيني الدجاج كعنصر تحكم المضيف. وقد استخدم الاغاروز الكهربائي للهلام لحل كل فحص وأظهرت خصوصية الأنواع المطلقة مع أي مضيف عبر التفاعل 18. وبعد ذلك، أعدت عشرة أضعاف مسلسل سلسلة التخفيف باستخدام النقى الرهيفة الأيمرية كشف الحمض النووي الجيني حدا حساسية الفحص من بين واحد وعشر نسخ الجينوم 18. تم تحديد أي حد العلوي مع النتائج الإيجابية التي تحققت وبما يصل إلى أعلى تركيز (100،000 نسخة الجينوم) 18. التطبيق مع العينات الميدانية العينات التي تم جمعها للاختبار الأيمرية من المرجح أن تكون مستمدة من الدجاج عثر عليه ميتا، أعدمت نتيجة لصOOR الصحية أو أعدمت للمراقبة الصحية الخافرة، مما يدل على أن من المرجح حجم العينة من بين واحد وثلاثة عندما جزءا من روتين. اختبار ثلاثة طيور التي تم جمعها من مزرعة الدجاج اللاحم الولايات المتحدة كجزء من برنامج المراقبة أسفرت عن ثلاث مجموعات من عينات الأمعاء. تستهدف تطبيق أنواع محددة المقايسات LAMP، إعطاء الأولوية لمواقع المعوية المفضلة لكل نوع الأيمرية (الجدول 1)، يسمح التعرف البصري للعدوى eimerian في جميع الطيور اختبارها باستخدام hydroxynaphthol الأزرق كمؤشر (الشكل 2A). لون يتحقق مع رد فعل سلبي LAMP عند استخدام hydroxynaphthol الأزرق يمكن أن تتراوح من البنفسجي إلى الوردي، ولكن هو دائما متميزة من اللون الأزرق من قبل نتيجة الإيجابية التي تحققت. تأكيد الاغاروز الكهربائي للهلام قدمت نتائج مماثلة (الشكل 2B). خلال التطبيق الميداني قد يختار المستخدم لتطبيق كامل الشاشة ضد جميع الأنواع السبعة، أو تستهدف فقط تلك الأنواع ذات الأولوية كماأهمية أو المعروف أن تعميم في المزرعة أو المنطقة المحيطة بها. فشل النهج القائمة على PCR لأصبح راسخا باعتباره التشخيص لحدوث الأيمرية يشدد على الحاجة إلى البساطة في أي اختبار جديد. في حين LAMP يقدم إعداد بساطة ومعالجة من PCR، واشتراط اختبار المواقع المعوية متعددة لكل الطيور لا يزال غير مشجع. إنتاج عينة DNA المجمعة واحدة لكل الطيور، ومن ثم يمكن اختبار مع واحد أو أكثر من المقايسات LAMP، ومن المرجح أن يكون أكثر جاذبية. تجهيز العينات المجمعة واحد لكل الطيور، وتمثل المواد التي تم جمعها من كل موقع من المواقع المعوية محددة وصفها في الجدول 1 والمجمعة قبل إعداد DNA، للاختبار مع جميع المقايسات LAMP سبعة شريطة نفس النتيجة كما هو الحال عندما تم معالجتها كل موقع على حدة الأمعاء (الشكل 2 مقارنة مع الشكل 3). <img alt="الشكل (1)" src=&quot;/files/ftp_upload/52552/52552fig1.jpg&quot; /&gt; الشكل 1. مواقع أخذ العينات المعوية للكشف LAMP من الطفيليات التي تصيب الأنواع الأيمرية الدجاج. ومن أبرز المناطق المعوية مستهدفة من قبل كل الأنواع الأيمرية من قبل خطوط ملونة، مع المواقع المفضلة لأخذ العينات المشار إليها بواسطة رقم بين خطوط سوداء منقطة (E. acervulina: أصفر / 1، E. برونيتي: الوردي / 2، E. ماكسيما: أزرق / 3، E. هين: البرتقال / 4، E. الفاتكة: أحمر / 5، E. مبتسر: الأخضر / 6 و E. الرهيفة: الرمادي / 7). <a href="https://www.jove.com/files/ftp_upload/52552/52552fig1large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الشكل 2" src="/files/ftp_upload/52552/52552fig2.jpg" /> الشكل 2. LAMP تشخيص العدوى eimerian جيئة وذهابام ثلاث الدجاج اللاحم التجارية. ردود الفعل LAMP حلها باستخدام (A) hydroxynaphthol الزرقاء، حيث كان رد فعل السماء الزرقاء إيجابي وكان البنفسجي إلى رد فعل سلبي الوردي، و (ب) الاغاروز الكهربائي للهلام. المواقع المعوية عينات كما عرضت في الجدول 1 لكل أنواع الطفيليات. A = E. acervulina، B = E. برونيتي، ما = E. ماكسيما، مي = E. هين، N = E. الفاتكة، P = E. مبتسر وT = E. الرهيفة. حارة 1 يرد سلم GeneRuler 1KB DNA. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig2large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الشكل (3)" src="/files/ftp_upload/52552/52552fig3.jpg" /> الشكل 3. LAMP تشخيص العدوى eimerian باستخدام العينات المجمعة من ثلاث الدجاج اللاحم تجارية منفصلة. REAC LAMPحل ستعقد باستخدام الأزرق hydroxynaphthol، حيث كان رد فعل السماء الزرقاء إيجابي وكان البنفسجي إلى رد فعل سلبي الوردي. A = E. acervulina، B = E. برونيتي، ما = E. ماكسيما، مي = E. هين، N = E. الفاتكة، P = E. مبتسر وT = E. الرهيفة. <a href="https://www.jove.com/files/ftp_upload/52552/52552fig3large.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> موقع نموذج </td><td> فحص الأنواع الأيمرية (على الأرجح) </td></tr><tr><td> العفج (D) </td><td> E. acervulina، E. مبتسر </td></tr><tr><td> الصائم / الدقاق * (J / I) </td><td> E. ماكسيما، E. الفاتكة </td></tr><tr><td> Caeca (C) </td><td> E. الفاتكة، E. الرهيفة </td></tr><tr><td> محطة الدقاق (TI) </td><td> E. برونيتي، E. هين </td></tص&gt; <tr><td> عينة المجمعة (P) </td><td> E. acervulina، E. برونيتي، E. ماكسيما، E. هين، E. الفاتكة، E. مبتسر، E. الرهيفة </td></tr></tbody></table> الجدول 1. المعوية منطقة معينة مختارة من المقايسات الأنواع مرشح الأيمرية. إن اختيار المنطقة لأخذ عينات يختلف عن كل نوع من الأنواع الأيمرية كما هو موضح في الشكل (1). وتشمل العينات المجمعة المواد التي تم جمعها من جميع مواقع محددة الأربعة التي تم بعد ذلك جنبا إلى جنب من أجل إعداد DNA. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> التمهيدي * </td><td> تركيز الأسهم (ميكرومتر) </td><td> الحجم (ميكرولتر) </td></tr><tr><td> ماء </td><td> - </td><td> 60 </td></tr><tr><td> إلى الأمام التمهيدي الداخلية (FIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> متخلف الحزب الثوري المؤسسي الداخليةمير (BIP) </td><td> 100 </td><td> 40 </td></tr><tr><td> إلى الأمام الخارجي التمهيدي (F3) </td><td> 100 </td><td> 10 </td></tr><tr><td> متخلف التمهيدي الخارجي (B3) </td><td> 100 </td><td> 10 </td></tr><tr><td> حلقة الأمام (LF) </td><td> 100 </td><td> 20 </td></tr><tr><td> حلقة الخلف (LB) </td><td> 100 </td><td> 20 </td></tr><tr><td> مجموع </td><td></td><td> 200 </td></tr></tbody></table> الجدول 2. إعداد الخلطة الجاهزة LAMP التمهيدي. المكونات والنسب المطلوبة لإعداد الخلطة الجاهزة التمهيدي لLAMP. كميات المعروضة هي 100 ردود الفعل LAMP. * الهويات التمهيدي كما هو مبين في المواد وBarkway وآخرون (2011) 18. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td></td><td> الأسهم اضرب ن </td><td> رد الفعل النهائي اضرب ن </td><td> حجم في رد الفعل (ميكرولتر) </td></tr><tr><td> أحواض دبي الجافة العالمية </td><td> - </td><td> - </td><td> 10.1 </td></tr><tr><td> عازلة ThermoPol </td><td> 10 × </td><td> 1 × </td><td> 2.5 </td></tr><tr><td> MgSO 4 </td><td> 100 ملي </td><td> 2 مم </td><td> 0.5 </td></tr><tr><td> مزيج التمهيدي * </td><td colspan="2"> الجدول 2 </td><td> 2.5 </td></tr><tr><td> dNTPs </td><td> 25 ملي </td><td> 400 أوقية </td><td> 0.4 </td></tr><tr><td> البيتين </td><td> 5 M </td><td> 1 M </td><td> 5 </td></tr><tr><td> Hydroxynaphthol الأزرق </td><td> 3 مم </td><td> 120 ميكرومتر </td><td> 1 </td></tr><tr><td> BST DNA بوليميريز </td><td> 8،000 U / مل </td><td> 8 U </td><td> 1 </td></tr><tr><td> مجموع </td><td></td><td></td><td> 23 </td></tr></tbody></table> الجدول 3. إعداد LAMmastermix رد فعل P. * الأيمرية أنواع محددة.

Watch this Scientific Journal Video about Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens at JoVE.com

Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

متساوي التضخيم (LAMP) فحوصات بوساطة حلقة للكشف عن أنواع محددة من<em&gt; الأيمرية</em&gt; التي تصيب الدجاج

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the ...

loop-mediated-isothermal-amplification-lamp-assays-for-species

Research

JoVE Journal

Immunology and Infection

Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

26.8K Views.  Royal Veterinary College, London. Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Video: Loop-mediated Isothermal Amplification LAMP Assays for the Species-specific Detection of Eimeria that Infect Chickens

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

مزيج من الشريط اللاصق على أساس أخذ العينات والإسفار في الموقع تهجين للكشف السريع عن السالمونيلا على المنتجات الطازجة

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

تضخيم وقياس HIV - 1 الحمض النووي الريبي في الأفراد المصابين بالايدز مع الأحمال الفيروسية أقل من الحد كشفها بواسطة فحوصات السريرية القياسية

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

Assays for the Identification of Novel Antivirals against Bluetongue Virus

To identify potential antivirals against BTV, we have developed, optimized and validated three assays presented here. The CPE-based assay was the first assay developed to evaluate whether a compound showed any antiviral efficacy and have been used to screen large compound library. Meanwhile, cytotoxicity of antivirals could also be evaluated using the CPE-based assay. The dose-response assay was designed to determine the range of efficacy for the selected antiviral, i.e. 50% inhibitory concentration (IC50) or effective concentration (EC50), as well as its range of cytotoxicity (CC50). The ToA assay was employed for the initial MoA study to determine the underlying mechanism of the novel antivirals during BTV viral lifecycle or the possible effect on host cellular machinery. These assays are vital for the evaluation of antiviral efficacy in cell culture system, and have been used for our recent researches leading to the identification of a number of novel antivirals against BTV.

Three assays, including the cytopathic effect (CPE)-based assay, dose-response assay and Time-of-Addition (ToA) assay have been developed, optimized, validated and utilized to identify novel antivirals against Bluetongue virus (BTV), as well as to determine the possible Mechanism-of-Action (MoA) for newly identified antivirals.

فحوصات لتحديد رواية الأدوية المضادة للفيروسات ضد فيروس اللسان الأزرق

To identify potential antivirals against BTV, we have  developed, optimized and validated three assays presented here. The CPE-based  assay was the first ...

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense against gram-negative bacterium Salmonella typhimurium. Salmonella establishes persistent infection in the intestine of C. elegans and results in early death of infected animals. A number of immunity mechanisms have been identified in C. elegans to defend against Salmonella infections. Autophagy, an evolutionarily conserved lysosomal degradation pathway, has been shown to limit the Salmonella replication in C. elegans and in mammals. Here, a protocol is described to infect C. elegans with Salmonella typhimurium, in which the worms are exposed to Salmonella for a limited time, similar to Salmonella infection in humans. Salmonella infection significantly shortens the lifespan of C. elegans. Using the essential autophagy gene bec-1 as an example, we combined this infection method with C. elegans RNAi feeding approach and showed this protocol can be used to examine the function of C. elegans host genes in defense against Salmonella infection. Since C. elegans whole genome RNAi libraries are available, this protocol makes it possible to comprehensively screen for C. elegans genes that protect against Salmonella and other intestinal pathogens using genome-wide RNAi libraries.

A Protocol to Infect Caenorhabditis elegans with Salmonella typhimurium

C. elegans has emerged as a new genetic model to study host-pathogen interactions. Here we describe a protocol to infect C. elegans with Salmonella typhimurium coupled with the double-strand RNAi interference technique to examine the role of host genes in defense against Salmonella infection.

بروتوكول لتصيب<em&gt; انواع معينة ايليجانس</em&gt; مع<em&gt; السالمونيلا التيفية الفأرية</em

In the last decade, C. elegans has emerged as an invertebrate organism to study interactions between hosts and pathogens, including the host defense ...

Early Viral Entry Assays for the Identification and Evaluation of Antiviral Compounds

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic approach to identify and evaluate antiviral agents that target specific steps of the viral entry. In this report, the methods of examining viral inactivation, viral attachment, and viral entry/fusion as antiviral assays for such purposes are described, using hepatitis C virus as a model. These assays should be useful for discovering novel antagonists/inhibitors to early viral entry and help expand the scope of candidate antiviral agents for further drug development.

Here, we present a protocol that examines specific steps of the viral entry to identify and evaluate novel antiviral agents.

الفيروسية في وقت مبكر فحوصات دخول لتحديد وتقييم المركبات المضادة للفيروسات

Cell-based systems are useful for discovering antiviral agents. Dissecting the viral life cycle, particularly the early entry stages, allows a mechanistic ...

Qualitative and Quantitative Assays for Detection and Characterization of Protein Antimicrobials

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods to screen for target enzymes prior to investing greater research effort and resources. The goal of this protocol is to demonstrate two complementary assays for conducting these initial evaluations. The microslide diffusion assay provides an initial or simple detection screen to enable the qualitative and rapid assessment of proteolytic activity against an array of both viable and heat-killed bacterial target substrates. As a counterpart, the increased sensitivity and reproducibility of the dye-release assay provides a quantitative platform for evaluating and comparing environmental influences affecting the hydrolytic activity of protein antimicrobials. The ability to label specific heat-killed cell culture substrates with Remazol brilliant blue R dye expands this capability to tailor the dye-release assay to characterize enzymatic activity of interest.

Here, we present protocols to rapidly screen and characterize enzymes for antimicrobial activity. The microslide diffusion assay and the dye-release assay utilize target bacterial substrates for qualitative and quantitative enzymatic activity evaluation.

فحوصات النوعية والكمية للكشف وتوصيف مضادات الميكروبات البروتين

Initial evaluations of large microbial libraries for potential producers of novel antimicrobial proteins require both qualitative and quantitative methods ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. burnetii DNA in cell cultures and clinical samples. PCR requires specialized equipment and extensive end user training, and therefore, it is not suitable for routine work especially in a resource-constrained area. We have developed a loop-mediated isothermal amplification (LAMP) assay to detect the presence of C. burnetii in patient samples. This method is performed at a single temperature around 60 &#176;C in a water bath or heating block. The sensitivity of this LAMP assay is very similar to PCR with a detection limit of about 25 copies per reaction. This report describes the preparation of the reaction using lyophilized reagents and visualization of results using hydroxynaphthol blue (HNB) or a UV lamp with fluorescent intercalating dye in the reaction. The LAMP reagents were lyophilized and stored at room temperature (RT) for one month without loss of detection sensitivity. This LAMP assay is particularly robust because the reaction mixture preparation does not involve complex steps. This method is ideal for use in resource-limited settings where Q fever is endemic.

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

We described here a simple loop-mediated isothermal amplification (LAMP) method using lyophilized reagents for the detection of C. burnetii in patient samples.

تطوير بوساطة حلقة-المجففة بالتبريد متساوي التضخيم الكواشف للكشف عن<em&gt; الكوكسيلا البورنيتية</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Assays for Studying the Role of Vitronectin in Bacterial Adhesion and Serum Resistance

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin acquisition at the bacterial cell surface plays in resistance to the host immune system. Flow cytometry experiments identified human plasma vitronectin as a ligand for the bacterial receptor outer membrane protein H of Haemophilus influenzae type f. An enzyme-linked immunosorbent assay was employed to characterize the protein-protein interactions between purified recombinant protein H and vitronectin, and binding affinity was assessed using bio-layer interferometry. The biological importance of the binding of vitronectin to protein H at the bacterial cell surface in evasion of the host immune response was confirmed using a serum resistance assay with normal and vitronectin-depleted human serum. The importance of vitronectin in bacterial adherence was analyzed using glass slides with and without vitronectin coating, followed by Gram staining. Finally, bacterial adhesion to human alveolar epithelial cell monolayers was investigated. The protocols described here can be easily adapted to the study of any bacterial species of interest.

This report describes protocols for characterizing interactions between bacterial outer membrane proteins and the human complement regulator vitronectin. The protocols can be used to study the binding reactions and biological function of vitronectin in any bacterial species.

فحوصات لدراسة دور فيترونيكتين في التصاق البكتيريا ومقاومة المصل

Bacteria utilize complement regulators as a means of evading the host immune response. Here, we describe protocols for evaluating the role vitronectin ...

Detection of Antibodies That Neutralize the Cellular Uptake of Enzyme Replacement Therapies with a Cell-based Assay

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The characterization of these anti-drug antibodies (ADA), especially those that may neutralize the biological activity of the drug, termed neutralizing antibodies (NAbs), is crucial in understanding the effects of these antibodies on the drug&#39;s pharmacological profile. This protocol describes a cell-based flow cytometry method to detect factors that neutralize the cellular uptake of a representative lysosomal ERT in human matrix. The protocol consists of three procedures: screening, a confirmatory step, and titer assays to detect, identify, and establish the relative level of neutralizing antibody titer in subject samples.
In this method, samples are first mixed with the fluorophore-conjugated ERT product, then incubated with cells [e.g., human T lymphocytes (Jurkat cells)] that express a cell-surface cation-independent mannose 6-phosphate receptor (CI-M6PR), and finally, analyzed with a flow cytometer. A sample without NAbs will result in the uptake of the fluorophore-conjugated ERT product via CI-M6PR, whereas, the presence of NAbs will bind to the drug and interfere with the CI-M6PR binding and uptake. The amount of the fluorophore-conjugated ERT internalized by the Jurkat cells is measured by flow cytometry and evaluated as the percentage (%) signal inhibition compared to the response obtained in the presence of a representative drug-na&#239;ve matrix. In the confirmatory step, the samples are pre-incubated with ERT-conjugated magnetic beads to deplete drug-specific factors that bind to the drug (such as NAbs) prior to an incubation with cells. Samples that screen and confirm positive for drug-specific NAbs in the assay are then serially diluted to generate an antibody titer. Semi-quantitative antibody titers may be correlated with measurements of drug safety and efficacy.

Here we present a cell-based flow cytometry method to detect neutralizing antibodies or other factors that interfere with the cellular uptake of enzyme replacement therapies in a human matrix, such as cerebral spinal fluid (CSF) or human serum.

الكشف عن الأجسام المضادة التي تحييد استيعاب الخلوية لأنزيم استبدال العلاجات مع تحليل يستند إلى الخلية

The administration of enzyme replacement therapies (ERTs) and other biologic therapies to patients may elicit an anti-drug immune response. The ...

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella spp./Shigella spp. The gold standard method for the detection of Salmonella spp./Shigella spp. is direct culture but this is labor-intensive and time-consuming. Here, we describe a high-throughput platform for Salmonella spp./Shigella spp. screening, using real-time polymerase chain reaction (PCR) combined with guided culture. There are two major stages: real-time PCR and the guided culture. For the first stage (real-time PCR), we explain each step of the method: sample collection, pre-enrichment, DNA extraction and real-time PCR. If the real-time PCR result is positive, then the second stage (guided culture) is performed: selective culture, biochemical identification and serological characterization. We also illustrate representative results generated from it. The protocol described here would be a valuable platform for the rapid, specific, sensitive and high-throughput screening of Salmonella spp./Shigella spp.

A High-throughput Platform for the Screening of Salmonella spp./Shigella spp.

Salmonella spp./Shigella spp. are common pathogens attributed to diarrhea. Here, we describe a high-throughput platform for the screening of Salmonella spp./Shigella spp. using real-time PCR combined with guided culture.

منصة الفائق لفحص السالمونيلا spp./دوسنتاريا spp.

Fecal-oral transmission of acute gastroenteritis occurs from time to time, especially when people who handled food and water are infected by Salmonella ...