يود المؤلفون أن يشكروا البرنامج الوطني للبحث والتطوير الرئيسي في الصين (المنحة رقم 2021YFD2200502) ، والمؤسسة الوطنية للعلوم الطبيعية في الصين (المنحة رقم 31971736) على الدعم المالي.

1. تحضير شتلات الخيزران
<ol><li>تحضير شتلات موسو الخيزران (Phyllostachys edulis) باستخدام البذور التي تم حصادها في قويلين ، قوانغشي ، الصين. ابدأ بنقع البذور في الماء لمدة 2-3 أيام ، مع التأكد من تغيير الماء يوميا. بعد ذلك ، قم بإنشاء ركيزة عن طريق خلط التربة والفيرميكوليت بنسبة 3: 1.</li>
	<li>زرع البذور المنقوعة في الركيزة للإنبات. الحفاظ على الشتلات تحت ظروف المختبر ، والحفاظ على درجة الحرارة بين 18-25 درجة مئوية. تأكد من فترة ضوئية مظلمة لمدة 16 ساعة / 8 ساعات مع شدة ضوء تبلغ 250-350 ميكرومول / م2 / ثانية خلال مرحلة الضوء.</li>
	<li>الحفاظ على رطوبة نسبية تبلغ حوالي 60٪. بالنسبة لعدوى Agrobacterium ، استخدم الشتلات التي يبلغ عمرها 15 يوما ويبلغ ارتفاعها 2-10 سم ، وهي أفضل مرحلة للتحول. ملاحظة: نظرا لأن ازدهار الخيزران لا يمكن التنبؤ به ، فإن البذور غير متوفرة كل عام. عادة ما يتم تخزين البذور لمدة 2-3 سنوات عند 4 درجات مئوية في بيئة جافة ولا يزال بإمكانها الحفاظ على صلاحيتها لأكثر من 20٪.</li>
</ol>2. إعداد البلازميدات و Agrobacterium
<ol><li>البلازميدات: للتحقق من صحة تأثير التعبير العابر، استخدم بنية pHDE-35S::RUBY التي تحتوي على جين مراسل مرئي مدفوع بواسطة مروج CaMV 35S 10. لتحرير الجينات ، استخدم بنية pCambia1300-Ubi::Cas9 ، والتي تحمل جين Cas9 الذي يقوده مروج الذرة Ubi 11. أدخل التسلسلات التوجيهية sgRNA ل PeVDE والجينات المستهدفة الأخرى بين موقعي AarI في pCambia1300-Ubi::Cas9 build9.</li>
	<li>أدخل تسلسل الحمض النووي الريبي لدليل CRISPR / Cas9 بين موقعي نوكلياز تقييد AarI لبناء pCambia1300-Ubi::Cas9 ، بما في ذلك الجينات المستهدفة PeVDE و PeCCR5 .</li>
	<li>أضف GGCA إلى نهاية 5 'من تسلسل 20 نيوكليوتيد وقم بتوليف تسلسل DNA أحادي الشريط. استكمل عكسيا تسلسل 20 نيوكليوتيد وأضف AAAC إلى نهاية 5 '، ثم قم بتجميع تسلسل DNA آخر أحادي الشريط.</li>
	<li>قم بتخفيف كل من تسلسل الحمض النووي أحادي الشريط إلى تركيز 10 نانومتر / لتر في الماء المخفف ، واخلطه جيدا ، وقم بتسخينه عند 95 درجة مئوية لمدة 5 دقائق. اترك الخليط يبرد إلى درجة حرارة الغرفة ، مما يؤدي إلى تكوين محولات مزدوجة تقطعت بهم السبل.</li>
	<li>قم بتوصيل المحولات بجزء pCambia1300-Ubi::Cas9 الخطي الذي تم هضمه بواسطة نوكلياز AarI باستخدام T4 DNA ligase وتسلسل ناقل CRISPR / Cas9 المبني للحصول على بنية استهداف الجينات المطلوبة.</li>
	<li>لتحويل البلازميدات إلى Agrobacterium ، استخدم طريقة التجميد والذوبان على النحو التالي: امزج 1 ميكرولتر من البلازميدات (التركيز: 10 - 1000 نانوغرام / ميكرولتر) مع 100 ميكرولتر من الخلايا ذات الكفاءة الزراعية (كفاءة الترجمة: > 1 × 104 وحدات تشكيل مستعمرة / ميكروغرام) واخلطها برفق. ضع الخليط على الثلج لمدة 5 دقائق. انقل الخليط إلى النيتروجين السائل لمدة 5 دقائق.</li>
	<li>يذوب المزيج في حمام مائي على حرارة 37 درجة مئوية لمدة 5 دقائق. أضف 500 ميكرولتر من وسط Luria-Bertani (LB) إلى الخليط واحتضانه على حاضنة اهتزاز عند 28 درجة مئوية عند 200 دورة في الدقيقة لمدة 2-3 ساعات. بالنسبة لبلازميدات الياقوت pHDE-35S::RUBY، أدخلها كل على حدة في سلالات AGL1 وGV3101 و LBA4044 وEHA105 من البكتيريا الزراعية tumefaciens (A. tumefaciens)12. بالنسبة لبلازميدات كريسبر / كاس9 ، أدخلها في سلالة GV3101 من A. tumefaciens.</li>
	<li>تنمو Agrobacterium في وسط مستخلص الخميرة الببتون (YEP) (10 جم من مستخلص اللحم البقري ، و 10 جم من خلاصة الخميرة ، و 5 جم من كلوريد الصوديوم لكل لتر) مع المضادات الحيوية المقابلة (سبكتينومايسين ل 35S::RUBY وكاناميسين ل CRISPR / Cas9) عند 28 درجة مئوية. لوحظت المستعمرات الفردية بعد 36-48 ساعة من الزراعة.</li>
	<li>اختر ونقل المستعمرات إلى وسط YEP السائل (مع المضادات الحيوية المقابلة) لمزيد من النمو. بعد 24-36 ساعة ، استخدم بادئات RUBY-F و RUBY-R (الجدول 1) لإجراء تفاعل البوليميراز المتسلسل لتأكيد النقل الناجح للبلازميدات إلى Agrobacterium.</li>
	<li>انقل 1 مل من Agrobacterium المحول بنجاح إلى 100 مل من وسط YEP السائل الطازج (مع المضادات الحيوية المقابلة) ثم تنمو بين عشية وضحاها عند 28 درجة مئوية إلىOD 600 من 0.8.</li>
	<li>أجهزة الطرد المركزي التعليق البكتيري عند 4000 × جم لمدة 5 دقائق عند 4 درجات مئوية ، اغسل الحبيبات البكتيرية مرة واحدة باستخدام وسط تسلل معلقات (10 mM MgCl2 و 10 mM MES-KOH [درجة الحموضة 5.6]) ، ثم الطرد المركزي مرة أخرى. أعد تعليق الحبيبات البكتيرية في وسط تسلل معلق إلىOD 600 من 0.6 لتحويل الخيزران.</li>
</ol>3. Agrobacterium بوساطة في نظام تحويل النبات
<ol><li>الاستعداد للتحول ؛ قم بإزالة الشتلات بعناية ذات الجذور المرتبطة بالتربة من الركيزة ، مما يضمن بقاء الجذور سليمة. لف الشتلات بورق القصدير للحفاظ على الرطوبة ومنع انفصال التربة (الشكل 1 أ).</li>
	<li>انقل الشتلات المغلفة إلى بيئة ذات رطوبة أعلى (رطوبة هواء نسبية >90٪) وإضاءة أقل (كثافة أقل من 50 ميكرومول / م2 / ثانية) لمدة ساعتين.</li>
	<li>باستخدام إبرة حادة من حقنة ، قم بجرح الجزء العلوي من الأوراق غير الناضجة المجعدة (حوالي 1-2 سم من الأعلى) من شتلات الخيزران مرة أو مرتين (كما هو موضح في المثلثات الحمراء في الشكل 1 أ).</li>
	<li>بعد ذلك ، اغمس الجزء العلوي المصاب من الشتلات في معلقات Agrobacterium. قم بإجراء العملية بأكملها ، من الجرح إلى الغمس في Agrobacterium بسرعة ، لأن الجرح الجديد سيزيد من كفاءة التلقيح.</li>
	<li>نقل الشتلات على الفور إلى غرفة فراغ مع ضغط 25-27 مم زئبق لمدة 2 دقيقة (الشكل 1B).</li>
	<li>بعد التنظيف بالمكنسة الكهربائية ، قم بفك الشتلات بعناية وإعادة زرعها في الركيزة. ضع الشتلات في ضوء خافت أو ظلام (<50 ميكرومول / م2 / ثانية) مع رطوبة عالية (RH>90٪) في درجة حرارة الغرفة (18-25 درجة مئوية) لمدة يومين. بعد ذلك ، قم بزراعة الشتلات في ظل ظروف النمو الطبيعية ، وسقيها كل 5-7 أيام. راقب أنماطها الظاهرية لتوفير المواد اللازمة للتجارب اللاحقة.</li>
</ol>4. تصميم دليل واحد RNAs (sgRNAs) لتحرير الجينات
<ol><li>تحديد موقع الشكل المجاور للفضاء الأولي (PAM) الموجود بالقرب من مجال محدد ومحفوظ لتسلسل الجينات المستهدف. تأكد من أن تسلسل PAM المحدد هو NGG في نظام CRISPR / Cas9 هذا. تحقق من الخصوصية على الهدف للتسلسل المحدد عن طريق إجراء بحث BlastN مقابل قاعدة بيانات جينوم الخيزران. تأكد من أن sgRNA فريد من نوعه ، خاصة في منطقة المنبع وعلى مقربة من PAM 9,11. ملاحظة: ستقلل هذه المقارنة بشكل فعال من المواقع المحتملة خارج الهدف في الجينوم المتأثرة بعملية تحرير الجينات.</li>
	<li>صمم اثنين من sgRNAs (sgRNA-1 و sgRNA-2) على أول إكسون لجين PeVDE 13. قم بتضمين مواقع تقييد العمرI في المنبع من PAM في مواقع تقييد sgRNA-1 و XbaI في المنبع من PAM في sgRNA-2. صمم sgRNA واحدا على الإكسون الرابع من جين PeCCR5 ، والذي يشفر الشكل المحفوظ ل KNWYCYGK. هذا الشكل أمر بالغ الأهمية لتحفيزCCRs 14.</li>
	<li>صمم تسلسل فاصل 20 نيوكليوتيد مجاور لموقع PAM. سيوجه هذا التسلسل المباعد إنزيم Cas9 إلى الموقع المستهدف لانقسام الحمض النووي وتحرير الجينات اللاحق. ملاحظة: من المستحسن اختيار منطقة مستهدفة في المنبع من موقع انشقاق إنزيم النوكلياز الداخلي داخل موقع PAM. هذا سيسهل التحقق من كفاءة تحرير الجينات.</li>
</ol>5. تصميم التمهيدي و PCR
<ol><li>تصميم بادئات محددة يدويا لتضخيم شظايا PeVDE و PeCCR5 . صمم بادئات المنبع والمصب لتكون موجودة على الأقل 100 نقطة أساس خارج الموقع المستهدف ، مع اختلاف في الطول يزيد عن 100 نقطة أساس للسماح بفصل النطاق المميز أثناء الرحلان الكهربائي. تصميم الاشعال لتضخيم روبي داخل أول 500 bp من الجين. يتم توفير قائمة بجميع الاشعال المستخدمة في الجدول 1.</li>
	<li>استخدم بوليميراز الحمض النووي عالي الدقة لتفاعل البوليميراز المتسلسل. في هذه الحالة ، استخدم بوليميراز الحمض النووي بدقة عالية وتضخيم فعال في استنساخ الجينات.</li>
	<li>تحضير خليط تفاعل PCR على النحو التالي: 5x عازلة (Mg2+ Plus): 4 ميكرولتر ؛ خليط dNTP (2.5 مللي متر لكل منهما): 1.6 ميكرولتر ؛ الاشعال الأمامية والخلفية (10 مساء لكل منهما): 1 ميكرولتر لكل منهما ؛ الحمض النووي لجينوم الخيزران (حوالي 50 نانوغرام) ؛ بوليميراز الحمض النووي (2.5 وحدة / ميكرولتر): 0.2 ميكرولتر ؛ تمييع الماء إلى حجم إجمالي قدره 20 ميكرولتر.</li>
	<li>اتبع ظروف تشغيل PCR: تمسخ أولي عند 98 درجة مئوية لمدة 5 دقائق ؛ تمسخ عند 98 درجة مئوية لمدة 10 ثوان ؛ التلدين عند 56 درجة مئوية لمدة 5 ثوان ؛ تمديد عند 72 درجة مئوية لمدة 30 ثانية ؛ كرر تمسخ لتمديد لمدة 32 دورة ؛ التمديد النهائي عند 72 درجة مئوية لمدة 5 دقائق ؛ يمسك عند 4 درجات مئوية إلى أجل غير مسمى. ملاحظة: يتم توفير شروط تفاعل البوليميراز المتسلسل كمثال وقد تحتاج إلى تحسينها لتطبيقات أو أهداف محددة.</li>
</ol>6. استخراج الحمض النووي ، هضم إنزيم النوكلياز الداخلي ، والتسلسل
<ol><li>افصل المنطقة ذات قيم NPQ المنخفضة عن شفرات أوراق الخيزران الطازجة باستخدام المقص ، كما هو محدد بواسطة مقياس الفلور التصوير - PAM (راجع الخطوة 7.4). قم بتجميد عينات الأوراق بالنيتروجين السائل وانقل عينات الأوراق المجمدة إلى ملاط. قم بطحن العينات إلى مسحوق ناعم باستخدام مدقة ، مع إضافة ما يكفي من النيتروجين السائل أثناء عملية الطحن. تساعد هذه الخطوة في إطلاق المحتوى الخلوي ، بما في ذلك الحمض النووي.</li>
	<li>استخرج الحمض النووي الجينومي من الورقة المسحوقة باستخدام طريقة سيتيل تريميثيل أمونيوم بروميد الأمونيوم (CTAB). أضف 50 مجم من عينات مسحوق الأوراق إلى 800 ميكرولتر من محلول CTAB بنسبة 2٪. امزج العينة جيدا واحتضانها على حرارة 65 درجة مئوية لمدة 30 دقيقة ، مع رج لطيف كل 5 دقائق.</li>
	<li>أضف كمية متساوية من كحول الكلوروفورم / الأيزو أميل (24: 1 ، v / v) ورج الخليط بقوة. بعد الطرد المركزي عند 8000 جم لمدة 8 دقائق ، انقل المادة الطافية إلى أنبوب جديد.</li>
	<li>أضف حجما متساويا من كحول الكلوروفورم / الأيزو أميل وكرر الخطوة 6.3. أضف كمية متساوية من الأيزوبروبانول المثلج ، واقلب الأنبوب عدة مرات قبل وضعه عند -20 درجة مئوية لمدة 30 دقيقة. بعد الطرد المركزي عند 8000 × جم لمدة 5 دقائق ، تخلص من المادة الطافية.</li>
	<li>اغسل حبيبات الحمض النووي 2x بإيثانول 75٪ عند 4 درجات مئوية ، ثم قم بإذابة 50 ميكرولتر من الماء.</li>
	<li>تضخيم الحمض النووي الجينومي الذي يحتوي على الموقع المستهدف للجينات المستهدفة من كل من أوراق الخيزران من النوع البري والبكتيريا الزراعية المصابة بالبروتوكول في الخطوة 5.4.</li>
	<li>أداء هضم إنزيم النوكلياز الداخلي لمنتجات PCR. حدد إنزيما معينا يتعرف على مواقع التقييد المطلوبة داخل شظايا الحمض النووي المضخمة. استخدم النوكليازات الداخلية من العمرالأول و XbaI للهضم.</li>
	<li>تحضير خليط تفاعل يتكون من العمرI أو XbaI (20 وحدة / ميكرولتر) - 1 ميكرولتر ، 1 ميكروغرام من منتجات تفاعل البوليميراز المتسلسل ، 10x buffer- 5 ميكرولتر ، وإضافة الماء إلى حجم إجمالي قدره 50 ميكرولتر. احتضان عند 37 درجة مئوية لمدة 1 ساعة.</li>
	<li>تحليل نسبة شظايا الحمض النووي المهضومة باستخدام هلام الكهربائي. قارن الشظايا المهضومة من العينات البرية والمصابة بالبكتيريا الزراعية لتقييم كفاءة تحرير الجينات.</li>
	<li>ضع علامة على تسلسل محول transposase TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG و GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG إلى نهاية 5 'من البادئات الأمامية والخلفية ، على التوالي ، لتضخيم شظايا PeVDE و PeCCR5 9,15. استخدم البروتوكول الموضح في الخطوة 5.4 للتضخيم. تحضير منتجات PCR (قبل الهضم) للتسلسل العميق.</li>
</ol>7. قياس مضان الكلوروفيل لقيم NPQ في الأوراق
<ol><li>قبل القياسات ، قم بتعريض شتلات الخيزران لظروف شدة ضوء عالية تبلغ 1200 ميكرومول / م2 / ثانية لمدة ساعتين. يزيد هذا التعرض من كمية الضوء الممتص وينشط نظام الحماية الضوئية في الأوراق.</li>
	<li>استخدم مقياس فلورو التصوير PAM لقياس مضان الكلوروفيل PS II في الجسم الحي لأوراق الخيزران. اضبط شدة الضوء الأكتيني على 800 ميكرومول / م2 / ثانية لقياسات مضان لمدة 6 دقائق. خلال هذه الفترة ، ضع نبضة مشبعة كل 30 ثانية للحصول على منحنيات مضان الكلوروفيل. سيتم استخدام القيم المستقرة للمنحنيات للحسابات13.</li>
	<li>احسب التبريد غير الكيميائي الضوئي (NPQ) باستخدام الصيغة: NPQ = (F m - F m') / F m' حيث يمثل F m الحد الأقصى للتألق في الحالة المتكيفة مع الظلام ، ويمثل Fm الحد الأقصى للتألق في أي حالة متكيفة مع الضوء.</li>
	<li>راقب قيم NPQ من الواجهة المرئية لبرنامج التصوير. يسمح البرنامج بالتحليل في الوقت الحقيقي وعرض بيانات التألق ، بما في ذلك قيم NPQ.</li>
</ol>

تطوير طرق تحويل الجينات وتحريرها في الخيزران

<ol>
	<li>Jiang, Z. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Bamboo and Rattan (in Chinese). , (2002).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+plant+regeneration+and+transformation+system+of+ma+bamboo+(Dendrocalamus+latiflorus+Munro)+started+from+young+shoot+as+explant.">An efficient plant regeneration and transformation system of ma bamboo (Dendrocalamus latiflorus Munro) started from young shoot as explant.</a> Frontiers in Plant Science. 8, 1298 (2017).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Robust+CRISPR/Cas9+mediated+genome+editing+and+its+application+in+manipulating+plant+height+in+the+first+generation+of+hexaploid+Ma+bamboo+(Dendrocalamus+latiflorus+Munro).">Robust CRISPR/Cas9 mediated genome editing and its application in manipulating plant height in the first generation of hexaploid Ma bamboo (Dendrocalamus latiflorus Munro).</a> Plant Biotechnology Journal. 18 (7), 1501-1503 (2020).</li><li>Xiang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+purple+Ma+bamboo+(Dendrocalamus+latiflorus+Munro)+with+enhanced+drought+and+cold+stress+tolerance+by+engineering+anthocyanin+biosynthesis.">Production of purple Ma bamboo (Dendrocalamus latiflorus Munro) with enhanced drought and cold stress tolerance by engineering anthocyanin biosynthesis.</a> Planta. 254 (3), 50 (2021).</li><li>Huang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genetic+transformation+and+CRISPR/Cas9-based+genome+editing+system+for+moso+bamboo+(Phyllostachys+edulis).">An efficient genetic transformation and CRISPR/Cas9-based genome editing system for moso bamboo (Phyllostachys edulis).</a> Frontiers in Plant Science. 13, 822022 (2022).</li><li>Lee, M. W., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+assay+by+agroinfiltration+of+leaves.">Transient expression assay by agroinfiltration of leaves.</a> Methods in Molecular Biology. 323, 225-229 (2006).</li><li>Canto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+systems+in+plants:+potentialities+and+constraints.">Transient expression systems in plants: potentialities and constraints.</a> Advances in Experimental Medicine and Biology. 896, 287-301 (2016).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+the+production+and+expedient+screening+of+CRISPR/Cas9-mediated+non-transgenic+mutant+plants.">A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants.</a> Horticulture Research. 5, 13 (2018).</li><li>Sun, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+biotechnology+for+in-planta+gene+editing+and+its+application+in+promoting+flavonoid+biosynthesis+in+bamboo+leaves.">A new biotechnology for in-planta gene editing and its application in promoting flavonoid biosynthesis in bamboo leaves.</a> Plant Methods. 19 (1), 20 (2023).</li><li>He, Y., Zhang, T., Sun, H., Zhan, H., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reporter+for+noninvasively+monitoring+gene+expression+and+plant+transformation.">A reporter for noninvasively monitoring gene expression and plant transformation.</a> Horticulture Research. 7 (1), 152 (2020).</li><li>Wang, C., Shen, L., Fu, Y., Yan, C., Wang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+CRISPR/Cas9+system+for+multiplex+genome+editing+in+rice.">A simple CRISPR/Cas9 system for multiplex genome editing in rice.</a> Journal of Genetics and Genomics. 42 (12), 703-706 (2015).</li><li>McCormick, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leaf+disc+transformation+of+cultivated+tomato+(L.+esculentum)+using+Agrobacterium+tumefaciens.">Leaf disc transformation of cultivated tomato (L. esculentum) using Agrobacterium tumefaciens.</a> Plant Cell Reports. 5 (2), 81-84 (1986).</li><li>Lou, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+violaxanthin+de-epoxidase+gene+from+moso+bamboo,+confers+photoprotection+ability+in+transgenic+Arabidopsis+under+high+light.">a violaxanthin de-epoxidase gene from moso bamboo, confers photoprotection ability in transgenic Arabidopsis under high light.</a> Frontiers in Plant Science. 13, 927949 (2022).</li><li>Zhou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cinnamoyl+CoA+reductases+involved+in+parallel+routes+to+lignin+in+Medicago+truncatula.">Distinct cinnamoyl CoA reductases involved in parallel routes to lignin in Medicago truncatula.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (41), 17803-17808 (2010).</li><li>De Roeck, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deleterious+ABCA7+mutations+and+transcript+rescue+mechanisms+in+early+onset+Alzheimer's+disease.">Deleterious ABCA7 mutations and transcript rescue mechanisms in early onset Alzheimer's disease.</a> Acta Neuropathologica. 134 (3), 475-487 (2017).</li></ol>

يعلن أصحاب البلاغ أنه ليس لديهم مصالح متنافسة.

تقلل هذه الطريقة بشكل كبير من الوقت المطلوب مقارنة بطرق التحول الجيني التقليدية ، والتي تستغرق عادة 1-2 سنوات ، وتحقق تعبيرا عابرا عن الجينات الخارجية وتحرير الجينات للجينات الداخلية في غضون 5 أيام. ومع ذلك ، فإن هذه الطريقة لها قيود لأنها لا يمكنها تحويل سوى نسبة صغيرة من الخلايا ، والأورا?...

إن التحقيق في وظيفة الجينات في الخيزران يحمل وعدا كبيرا للفهم المتقدم للخيزران وإطلاق العنان لإمكاناته للتعديل الوراثي. يمكن تحقيق طريقة فعالة لذلك من خلال عملية العدوى بوساطة Agrobacterium في أوراق الخيزران ، حيث يتم إدخال جزء T-DNA الذي يحتوي على جينات خارجية في الخلايا ، مما يؤدي لاحقا إلى التعبير عن الجينات داخل خلايا الأوراق.
الخيزران هو مورد قيم ومتجدد مع مجموعة واسعة من التطبيقات في التصنيع والفن والبحث. يمتلك الخيزران خصائص خشبية ممتازة مثل القوة الميكانيكية العالية والمتانة والصلابة المعتدلة والمرونة1 ، والتي تستخدم الآن على نطاق واسع في مجموعة متنوعة من اللوازم المنزلية والصناعية ، بما في ذلك فرش الأسنان والقش والأزرار وأدوات المائدة التي تستخدم لمرة واحدة وخطوط الأنابيب تحت الأرض وحشوات برج التبريد لتوليد الطاقة الحرارية. لذلك ، تلعب تربية الخيزران دورا حاسما في الحصول على أصناف الخيزران ذات الخصائص الخشبية الممتازة لاستبدال البلاستيك وتقليل استخدام البلاستيك ، وحماية البيئة ، ومعالجة تغير المناخ ، فضلا عن توليد قيمة اقتصادية كبيرة.
ومع ذلك ، فإن تربية الخيزران التقليدية تواجه تحديات بسبب مرحلة النمو الخضري الطويلة وفترة الإزهار غير المؤكدة. على الرغم من تطوير تقنيات التربية الجزيئية وتطبيقها على تربية الخيزران ، إلا أن عملية التحول الجيني للخيزران تستغرق وقتا طويلا وتتطلب عمالة مكثفة ومعقدة بسبب عمليات تحريض الكالسوتجديده 2،3،4،5. غالبا ما يتطلب التحول الوراثي المستقر طرقا بوساطة Agrobacterium ، والتي تتضمن عمليات زراعة الأنسجة مثل تحريض الكالس وتجديده. ومع ذلك ، فإن الخيزران لديه قدرة منخفضة على تجديد الكالس ، مما يحد بشكل كبير من تطبيق التحول الجيني المستقر في الخيزران. بعد أن تصيب Agrobacterium الخلايا النباتية ، تدخل جزء T-DNA إلى الخلايا النباتية ، مع بقاء غالبية شظايا T-DNA غير مدمجة في الخلايا ، مما يؤدي إلى تعبير عابر. فقط جزء صغير من شظايا T-DNA يندمج بشكل عشوائي في كروموسومه ، مما يؤدي إلى تعبير مستقر. تظهر مستويات التعبير العابر منحنى تراكم يمكن أن يختلف لكل جين يتم التعبير عنه من الحمض النووي التائي الذي يتم تسليمه بواسطة Agrobacterium. في معظم الحالات ، تحدث أعلى مستويات التعبير بعد 3-4 أيام من التسلل وتنخفض بسرعة بعد 5-6 أيام 6,7. أظهرت الدراسات السابقة أن أكثر من 1/3rd من الطفرات في النباتات المحررة جينيا التي تم الحصول عليها دون ضغط اختيار للمقاومة تأتي من التعبير العابر ل CRISPR / Cas9 ، في حين أن الطفرات المتبقية أقل من 2/3rd تأتي من التعبير المستقر بعد دمج الحمض النووي في الجينوم8. يشير هذا إلى أن تكامل T-DNA في جينوم النبات ليس ضروريا لتحرير الجينات. علاوة على ذلك ، فإن ضغط الاختيار للمقاومة يمنع بشكل كبير نمو الخلايا غير المعدلة وراثيا ، مما يؤثر بشكل مباشر على عملية تجديد النباتات المصابة. لذلك ، باستخدام التعبير العابر دون ضغط اختيار للمقاومة في الخيزران ، من الممكن تحقيق تعبير غير متكامل للجينات الخارجية ودراسة وظيفة الجينات مباشرة في أعضاء النبات. وبالتالي ، يمكن تطوير طريقة سهلة وموفرة للوقت للتعبير الجيني الخارجي وتحريره في الخيزران9.
تتميز طريقة التعبير الجيني الخارجي وتحرير الجينات المطورة ببساطتها وفعاليتها من حيث التكلفة وعدم وجود معدات باهظة الثمن أو إجراءات معقدة9. في هذه الطريقة ، تم استخدام جين الفيولاكسانثين ديبوكسيديز الداخلي من الخيزران (PeVDE) كمراسل للتعبير الجيني الخارجي دون ضغط الاختيار. وذلك لأن PeVDE المحرر في أوراق الخيزران يقلل من قدرة الحماية الضوئية تحت الضوء العالي ويوضح انخفاضا في قيمة التبريد غير الكيميائي الضوئي (NPQ) ، والتي يمكن اكتشافها من خلال التصوير الفلوري بالكلوروفيل. لإثبات فعالية هذه الطريقة ، تم التخلص من جين داخلي آخر من الخيزران ، وهو جين اختزال cinnamoyl-CoA (PeCCR5) 9 ، باستخدام هذا النظام ونجح في توليد طفرات من هذا الجين. يمكن استخدام هذه التقنية للتوصيف الوظيفي للجينات التي لها وظائف في أوراق الخيزران. من خلال الإفراط في التعبير عن هذه الجينات بشكل عابر في أوراق الخيزران ، يمكن تحسين مستويات تعبيرها ، أو عن طريق تحرير الجينات ، يمكن هدم تعبيرها ، مما يسمح بدراسة مستويات التعبير الجيني في اتجاه مجرى النهر ، والأنماط الظاهرية للأوراق ، ومحتويات المنتج. وهذا يوفر نهجا أكثر كفاءة وجدوى لأبحاث وظائف الجينات في الخيزران. يمكن تطبيق هذه التقنية على التوصيف الوظيفي للجينات التي تعمل في أوراق الخيزران. من خلال الإفراط في التعبير عن هذه الجينات بشكل عابر في أوراق الخيزران ، يمكن تحسين مستويات تعبيرها ، أو عن طريق تحرير الجينات ، يمكن هدم تعبيرها ، مما يسمح بدراسة مستويات التعبير الجيني في اتجاه مجرى النهر ، والأنماط الظاهرية للأوراق ، ومحتويات المنتج. بالإضافة إلى ذلك ، من المهم ملاحظة أنه بسبب تعدد الصبغيات على نطاق واسع ، فإن غالبية الجينات المهمة تجاريا في جينومات الخيزران موجودة في نسخ متعددة ، مما يؤدي إلى التكرار الجيني. هذا يشكل تحديا لإجراء تحرير الجينوم المتعدد في الخيزران. قبل تطبيق التحول الجيني المستقر أو تقنيات تحرير الجينات ، من الأهمية بمكان التحقق بسرعة من وظائف الجينات. في معالجة مسألة النسخ الجينية المتعددة ، يتمثل أحد الأساليب في تحليل ملفات تعريف تعبير النسخ لتحديد الجينات التي يتم التعبير عنها بنشاط خلال مراحل محددة. علاوة على ذلك ، فإن استهداف المجالات الوظيفية المحفوظة لهذه النسخ الجينية يسمح بتصميم تسلسلات مستهدفة مشتركة أو دمج مواقع مستهدفة متعددة في نفس ناقل CRISPR / Cas9 ، مما يتيح الضربة القاضية المتزامنة لهذه الجينات. وهذا يوفر نهجا أكثر كفاءة وجدوى لأبحاث وظائف الجينات في الخيزران.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>35S::RUBY</td>
			<td>Addgene, United States</td>
			<td>160908</td>
			<td>Plamid construct</td>
		</tr>
		<tr>
			<td>Agrobacterium competent cells of GV3101, EHA105,LBA4404, and AGL1</td>
			<td>Biomed, China</td>
			<td>BC304-01, BC303-01, BC301-01, and BC302-01</td>
			<td>For Agrobacterium infection</td>
		</tr>
		<tr>
			<td>CTAB</td>
			<td>Sigma-Aldrich, United States</td>
			<td>57-09-0</td>
			<td>DNA extraction</td>
		</tr>
		<tr>
			<td>Imaging-PAM fluorometer</td>
			<td>Walz, Effeltrich, Germany</td>
			<td></td>
			<td>Detect chlorophyll fluorescence of bamboo leaves</td>
		</tr>
		<tr>
			<td>ImagingWin</td>
			<td>Walz, Effeltrich, Germany</td>
			<td></td>
			<td>Software for Imaging-PAM fluorometer</td>
		</tr>
		<tr>
			<td>Paq CI or Aar I</td>
			<td>NEB, United States</td>
			<td>R0745S</td>
			<td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td>
		</tr>
		<tr>
			<td>PrimeSTAR Max DNA polymerase</td>
			<td>Takara, Japan</td>
			<td>R045Q</td>
			<td>For gene cloning</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB, United States</td>
			<td>M0202V</td>
			<td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td>
		</tr>
	</tbody>
</table>

in planta gene expression and gene editing in moso bamboo leaves

تم تطوير طريقة جديدة في تحويل الجينات النباتية للخيزران ، والتي تتجنب الحاجة إلى عمليات تحريض الكالس وتجديده التي تستغرق وقتا طويلا وكثيفة العمالة. تتضمن هذه الطريقة التعبير الجيني بوساطة Agrobacterium عن طريق الجرح والفراغ لشتلات الخيزران. لقد أظهر بنجاح التعبير عن الجينات الخارجية ، مثل مراسل RUBY وجين Cas9 ، في أوراق الخيزران. تم تحقيق أعلى كفاءة تحويل لتراكم البيتالين في شتلات الياقوت باستخدام سلالة GV3101 ، بنسبة 85.2٪ بعد الإصابة. على الرغم من أن الحمض النووي الأجنبي لم يندمج في جينوم الخيزران ، إلا أن الطريقة كانت فعالة في التعبير عن الجينات الخارجية. علاوة على ذلك ، تم أيضا تطوير نظام تحرير الجينات مع مراسل أصلي باستخدام هذه الطريقة ، والتي يتم من خلالها إنشاء طفرة في الموقع بواسطة جين de-epoxidase المحرر من الخيزران (PeVDE) في أوراق الخيزران ، بمعدل طفرة يبلغ 17.33٪. أدت طفرة PeVDE إلى انخفاض قيم التبريد غير الكيميائي الضوئي (NPQ) تحت الضوء العالي ، والتي يمكن اكتشافها بدقة بواسطة مقياس الفلورومتر. هذا يجعل PeVDE المحرر مراسلا أصليا محتملا لكل من الجينات الخارجية والداخلية في الخيزران. مع مراسل PeVDE ، تم تحرير جين اختزال سينامويل-CoA بنجاح بمعدل طفرة 8.3٪. تتجنب هذه العملية عملية زراعة الأنسجة أو تحريض الكالس ، وهي سريعة وفعالة للتعبير عن الجينات الخارجية وتحرير الجينات الداخلية في الخيزران. يمكن لهذه الطريقة تحسين كفاءة التحقق من وظائف الجينات وستساعد في الكشف عن الآليات الجزيئية لمسارات التمثيل الغذائي الرئيسية في الخيزران.

The investigation of gene function in bamboo holds great promise for the advanced understanding of bamboo and unlocking its potential for genetic modification. An effective way of this can be achieved through the process of Agrobacterium-mediated infection in bamboo leaves, whereby the T-DNA fragment containing exogenous genes is introduced into the cells, subsequently leading to the expression of the genes within the leaf cells.
Bamboo is a valuable and renewable resource with a wide range of applications in manufacturing, art, and research. Bamboo possesses excellent wood properties such as high mechanical strength, toughness, moderate stiffness, and flexibility1, which is now widely used in a variety of household and industrial supplies, including toothbrushes, straws, buttons, disposable tableware, underground pipelines, and cooling tower fillers for thermal power generation. Therefore, bamboo breeding plays a crucial role in obtaining bamboo varieties with excellent wood properties for replacing plastics and reducing plastic usage, protecting the environment, and tackling climate change, as well as generating significant economic value.
However, traditional bamboo breeding faces challenges due to the lengthy vegetative growth stage and uncertain flowering period. Although molecular breeding techniques have been developed and applied to bamboo breeding, the process of bamboo gene transformation is time-consuming, labor-intensive, and complicated due to the callus induction and regeneration processes2,3,4,5. Stable genetic transformation often requires Agrobacterium-mediated methods, which involve tissue culture processes such as callus induction and regeneration. However, bamboo has a low ability for callus regeneration, greatly limiting the application of stable genetic transformation in bamboo. After Agrobacterium infects plant cells, the T-DNA fragment enters the plant cells, with the majority of T-DNA fragments remaining non-integrated in the cells, resulting in transient expression. Only a small portion of T-DNA fragments randomly integrate into its chromosome, leading to stable expression. The transient expression levels show an accumulation curve that can vary for each gene expressed from an Agrobacterium-delivered T-DNA. In most cases, the highest expression levels occur 3-4 days after infiltration and quickly decrease after 5-6 days6,7. Previous studies have shown that more than 1/3rd of mutations in gene-edited plants obtained without selection pressure for resistance come from the transient expression of CRISPR/Cas9, while the remaining less than 2/3rd come from stable expression after DNA integration into the genome8. This indicates that T-DNA integration into the plant genome is not necessary for gene editing. Moreover, selection pressure for resistance significantly inhibits the growth of non-transgenic cells, directly affecting the regeneration process of infected explants. Therefore, by using transient expression without selection pressure for resistance in bamboo, it is possible to achieve non-integrated expression of exogenous genes and study gene function directly in plant organs. Hence, an easy and time-saving method can be developed for exogenous gene expression and editing in bamboo9.
The developed exogenous gene expression and gene editing method is characterized by its simplicity, cost-effectiveness, and the absence of expensive equipment or complex procedures9. In this method, the bamboo endogenous violaxanthin de-epoxidase gene (PeVDE) was used as the reporter for exogenous gene expression without selection pressure. This is because the edited PeVDE in bamboo leaves reduces the photoprotection ability under high light and demonstrates a decrease in the non-photochemical quenching (NPQ) value, which can be detected through chlorophyll fluorescence imaging. To demonstrate the effectiveness of this method, another bamboo endogenous gene, the cinnamoyl-CoA reductase gene (PeCCR5)9, was knocked out using this system and successfully generated mutants of this gene. This technique can be used for the functional characterization of genes that have functions in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. This provides a more efficient and feasible approach for gene function research in bamboo. This technique can be applied to the functional characterization of genes that function in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. Additionally, it is important to note that, due to extensive polyploidization, the majority of commercially important genes in bamboo genomes are present in multiple copies, resulting in genetic redundancy. This poses a challenge for performing multiplex genome editing in bamboo. Prior to the application of stable genetic transformation or gene editing techniques, it is crucial to quickly validate gene functions. In addressing the issue of multiple gene copies, one approach is to analyze transcriptome expression profiles to identify genes that are actively expressed during specific stages. Furthermore, targeting the conserved functional domains of these gene copies allows for the design of common target sequences or the incorporation of multiple target sites into the same CRISPR/Cas9 vector, enabling the simultaneous knockout of these genes. This provides a more efficient and feasible approach for gene function research in bamboo.

تسليط الضوء على المؤلف: النهوض بتحرير الجينات في أوراق الخيزران لبدائل بلاستيكية مستدامة 

في بلانتا التعبير الجيني وتحرير الجينات في أوراق الخيزران موسو

In this study, we used Agrobacterium as a vector to introduce foreign DNA fragments into bamboo leaves. Most DNA fragments are not integrated into chromosomes and undergo transient expression. We took advantage of this transient expression to carry out gene editing.The main challenge is the limitation of gene editing of bamboo leaves, which cannot regenerate. This propose difficulties in performing editing in regenerative organs, like young shoots, and obtaining edited branches or subsequent generations with desired genetic challenges. Its main advantage is the time-saving aspect of the principle.By being able to edit bamboo genes directly in bamboo leaves, it allows for quick verification of gene fractions. This eliminates the needs for time-consuming procedures, like tissue culture or transformation, significantly speeding up research on bamboo gene fractions. The primary research will be focused on investigating the molecular mechanism of bamboo biomass formation.This will involve understanding why bamboo grows rapidly, and using that knowledge to develop bamboo varieties which are suitable for plastic substituent.

Agrobacterium بوساطة في التعبير الجيني بلانتا في أوراق الخيزران وقد ثبت أن جين مراسل روبي فعال في تصور التعبير الجيني العابر بسبب قدرته على إنتاج بيتالين أحمر زاهي من التيروزين10. في هذه الدراسة ، تم استخدام التحول بوساطة Agrobacterium للتعبير بشكل عابر عن جي...

Watch this Scientific Journal Video about Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives at JoVE.com

في هذه الدراسة ، تم تطوير رواية في التعبير الجيني للنباتات وطريقة تحرير الجينات بوساطة Agrobacterium في الخيزران. حسنت هذه الطريقة بشكل كبير من كفاءة التحقق من صحة وظيفة الجينات في الخيزران ، والتي لها آثار كبيرة على تسريع عملية تربية الخيزران.

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and ...

في هذه الدراسة ، استخدمنا Agrobacterium كناقل لإدخال شظايا الحمض النووي الأجنبية في أوراق الخيزران. لا يتم دمج معظم شظايا الحمض النووي في الكروموسومات وتخضع لتعبير عابر. لقد استفدنا من هذا التعبير العابر لإجراء تحرير الجينات.التحدي الرئيسي هو الحد من التحرير الجيني لأوراق الخيزران ، والتي لا يمكن أن تتجدد. هذا يشير إلى صعوبات في إجراء التحرير في الأعضاء المتجددة ، مثل البراعم الصغيرة ، والحصول على فروع محررة أو أجيال لاحقة مع التحديات الوراثية المرغوبة. ميزته الرئيسية هي جانب توفير الوقت للمبدأ.من خلال القدرة على تحرير جينات الخيزران مباشرة في أوراق الخيزران ، فإنه يسمح بالتحقق السريع من كسور الجينات. هذا يلغي الحاجة إلى إجراءات تستغرق وقتا طويلا ، مثل زراعة الأنسجة أو التحول ، مما يسرع بشكل كبير من البحث عن أجزاء جين الخيزران. سيركز البحث الأساسي على التحقيق في الآلية الجزيئية لتشكيل الكتلة الحيوية من الخيزران.سيشمل ذلك فهم سبب نمو الخيزران بسرعة ، واستخدام هذه المعرفة لتطوير أصناف الخيزران المناسبة لبدائل البلاستيك.

in-planta-gene-expression-and-gene-editing-in-moso-bamboo-leaves

Research

JoVE Journal

Biology

In Planta Gene Expression and Gene Editing in Moso Bamboo Leaves

1.1K Views.  Key Laboratory of State Forestry and Grassland Administration/Beijing on Bamboo & Rattan Science and Technology. في هذه الدراسة ، استخدمنا Agrobacterium كناقل لإدخال شظايا الحمض النووي الأجنبية في أوراق الخيزران. لا يتم دمج معظم شظايا الحمض النووي في الكروموسومات وتخضع لتعبير عابر. لقد استفدنا من هذا التعبير العابر لإجراء تحرير الجينات.التحدي الرئيسي هو الحد من التحرير الجيني لأوراق ا?...

Video: تسليط الضوء على المؤلف: النهوض بتحرير الجينات في أوراق الخيزران لبدائل بلاستيكية مستدامة 

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and regeneration processes. This method involves Agrobacterium-mediated gene expression via wounding and vacuum for bamboo seedlings. It successfully demonstrated the expression of exogenous genes, such as the RUBY reporter and Cas9 gene, in bamboo leaves. The highest transformation efficiency for the accumulation of betalain in RUBY seedlings was achieved using the GV3101 strain, with a percentage of 85.2% after infection. Although the foreign DNA did not integrate into the bamboo genome, the method was efficient in expressing the exogenous genes. Furthermore, a gene editing system has also been developed with a native reporter using this method, from which an in situ mutant generated by the edited bamboo violaxanthin de-epoxidase gene (PeVDE) in bamboo leaves, with a mutation rate of 17.33%. The mutation of PeVDE resulted in decreased non-photochemical quenching (NPQ) values under high light, which can be accurately detected by a fluorometer. This makes the edited PeVDE a potential native reporter for both exogenous and endogenous genes in bamboo. With the reporter of PeVDE, a cinnamoyl-CoA reductase gene was successfully edited with a mutation rate of 8.3%. This operation avoids the process of tissue culture or callus induction, which is quick and efficient for expressing exogenous genes and endogenous gene editing in bamboo. This method can improve the efficiency of gene function verification and will help reveal the molecular mechanisms of key metabolic pathways in bamboo.

In this study, a novel in planta gene expression and gene editing method mediated by Agrobacterium was developed in bamboo. This method greatly improved the efficiency of gene function validation in bamboo, which has significant implications for accelerating the process of bamboo breeding.

Preparation of Bamboo Seedlings and Agrobacterium-Mediated In Planta Transformation System for Gene Expression

Preparation of Bamboo Seedlings and Agrobacterium -Mediated In Planta Transformation System for Gene Expression  

To begin, sow the pre-soaked bamboo seeds into the substrate of soil and vermiculite for germination. For agrobacterium infection, carefully remove the 15 day old seedlings with soil attached roots from the substrate. Wrap the seedlings with tinfoil to maintain moisture and prevent soil detachment.Transfer the wrapped seedlings to the plant growth chamber with higher humidity and lower illumination for two hours. Next, using a sharp needle from a syringe, wound the upper part of curled immature leaves once or twice. Quickly dip the wounded part of the leaves into agrobacterium suspension.Then immediately transfer the seedlings to a vacuum chamber with a pressure of 25 to 27 millimeters of mercury for two minutes. After vacuuming, carefully unwrap the seedlings and replant them into the substrate. Allow the seedlings to grow in a plant growth chamber in dim light with high humidity for two days.Then culture the seedlings under normal growth conditions, watering them every five to seven days.

تحضير شتلات الخيزران والبكتيريا الزراعية بوساطة في نظام تحويل النبات للتعبير الجيني

In Planta Gene Expression and Measurement of Chlorophyll Fluorescence of Non-Photochemical Quenching Values in Bamboo Leaves

Begin by extracting the genomic DNA from the wild-type and Agrobacterium-infected bamboo leaves. Amplify the genomic DNA containing the target site of the target genes from wild-type and Agrobacterium-infected bamboo leaves using the following PCR conditions. After PCR, perform endonuclease enzyme digestion by preparing a reaction mixture containing one microliter of age-1, one microgram of PCR products, and five-microliter 10X buffer.Then, add water to a final volume of 50 microliters. Incubate the digestion mixture at 37 degrees Celsius for one hour. Using gel electrophoresis, analyze the proportion of digested DNA fragments.Compare the digested fragments from the wild-type and Agrobacterium-infected samples to assess gene editing efficiency. Expose the bamboo seedlings to high light intensity conditions to increase the amount of absorbed light quantum and activation of the leaf photoprotection system. Next, turn on the IMAGING-PAM fluorometer and set the actinic light intensity to measure in vivo photosystem II chlorophyll fluorescence of bamboo leaves.The red beta lane color produced by the RUBY gene indicated successful Agrobacterium-mediated gene expression in bamboo leaves. Out of the four Agrobacterium strains, GV3101 strain caused the most significant beta lane accumulation in infected bamboo leaves. After infection with the CRISPR-Cas9 constructs and high light treatments, certain areas of the leaf blades showed lower non-photochemical quenching values.Furthermore, enzyme digestion and sequencing analysis confirmed the successful mutation of the PeVDE gene in the edited regions. Sanger sequencing results of the PeVDE fragment after editing by both sgRNA1 and sgRNA2 showed deletion of a long fragment in the PeVDE gene. After 30 days of Agrobacterium infection, the leaf areas transfected with sgRNAs for both PeVDE and PeCCR5 exhibited lower non-photochemical quenching values.