저자들은 재정 지원을 해준 중국 국가 중점 연구 개발 프로그램(보조금 번호 2021YFD2200502), 중국 국립 자연과학 재단(보조금 번호 31971736)에 감사의 뜻을 전합니다.

1. 대나무 묘목의 준비
<ol><li>중국 광시성 구이린에서 수확한 씨앗을 사용하여 모소 대나무(Phyllostachys edulis) 묘목을 준비합니다. 씨앗을 2-3일 동안 물에 담그는 것으로 시작하여 매일 물을 갈아줍니다. 다음으로 흙과 질석을 3:1의 비율로 섞어 기질을 만듭니다.</li>
	<li>발아를 위해 담근 씨앗을 기질에 뿌립니다. 실험실 조건에서 묘목을 유지하여 온도를 18-25 °C 사이로 유지하십시오. 광상 동안 250-350μmol/m2/s의 광도로 16시간 광주기/8시간 어두운 광주기를 보장합니다.</li>
	<li>약 60%의 상대 습도를 유지합니다. Agrobacterium 감염의 경우 15 일 된 묘목을 사용하고 높이가 2-10cm 인 묘목을 사용하십시오. 알림: 대나무 개화는 예측할 수 없기 때문에 매년 씨앗을 구할 수 있는 것은 아닙니다. 씨앗은 일반적으로 건조한 환경에서 4 °C에서 2-3 년 동안 보관되며 여전히 20 % 이상의 생존력을 유지할 수 있습니다.</li>
</ol>2. 플라스미드 및 아그로박테리움의 제조
<ol><li>플라스미드: 일시적인 발현 효과를 검증하기 위해, CaMV 35S 프로모터10에 의해 구동되는 가시적인 리포터 유전자를 포함하는 pHDE-35S::RUBY 구조체를 사용한다. 유전자 편집의 경우, 옥수수 Ubi 프로모터11에 의해 구동되는 Cas9 유전자를 운반하는 pCambia1300-Ubi::Cas9 구조체를 사용한다. PeVDE 및 기타 표적 유전자의 sgRNA 유도 서열을 pCambia1300-Ubi::Cas9 구조체9의 두 AarI 부위 사이에 삽입합니다.</li>
	<li>PeVDE 및 PeCCR5 표적 유전자를 포함하여 pCambia1300-Ubi::Cas9 구조체의 두 AarI 제한 엔도뉴클레아제 부위 사이에 CRISPR/Cas9 가이드 RNA 서열을 삽입합니다.</li>
	<li>20-뉴클레오티드 염기서열의 5' 말단에 GGCA를 추가하고 단일 가닥 DNA 염기서열을 합성합니다. 20-뉴클레오티드 서열을 역보체하고 AAAC를 5' 말단에 첨가한 다음 다른 단일 가닥 DNA 서열을 합성합니다.</li>
	<li>두 단일 가닥 DNA 염기서열을 희석된 물에 10nM/L 농도로 희석하고 완전히 혼합한 다음 95°C에서 5분 동안 가열합니다. 혼합물을 실온으로 식히면 이중 가닥 어댑터가 형성됩니다.</li>
	<li>T4 DNA 리가아제를 사용하여 AarI 엔도뉴클레아제에 의해 절단된 선형 pCambia1300-Ubi::Cas9 단편과 어댑터를 연결하고 구성된 CRISPR/Cas9 벡터의 염기서열을 분석하여 원하는 유전자 표적화 구조를 얻습니다.</li>
	<li>플라스미드를 아그로박테리움으로 형질전환시키려면, 다음과 같이 동결-해동 방법을 사용합니다: 1 μL의 플라스미드(농도: 10 - 1,000 ng/μL)와 100 μL의 아그로박테리움 적격 세포(번역 효율: > 1 x 104 colony-forming-units/μg)를 혼합하고 부드럽게 혼합합니다. 혼합물을 얼음 위에 5분 동안 놓습니다. 혼합물을 액체 질소로 5분 동안 옮깁니다.</li>
	<li>혼합물을 37°C 수조에서 5분 동안 해동합니다. 혼합물에 500μL의 Luria-Bertani(LB) 배지를 첨가하고 28°C, 200rpm의 진탕 인큐베이터에서 2-3시간 동안 배양합니다. pHDE-35S::RUBY 플라스미드의 경우, Agrobacterium tumefaciens (A. tumefaciens)의 AGL1, GV3101, LBA4044 및 EHA105 균주에 개별적으로 주입합니다12. CRISPR/Cas9 플라스미드의 경우, A. tumefaciens의 GV3101 균주에 도입합니다.</li>
	<li>효모 추출물 펩톤(YEP) 배지(쇠고기 추출물 10g, 효모 추출물 10g, L당 NaCl 5g)에서 해당 항생제(35S::RUBY의 경우 spectinomycin, CRISPR/Cas9의 경우 kanamycin)에서 28°C에서 Agrobacterium을 배양합니다. 단일 군체는 재배 후 36-48 시간 후에 관찰되었습니다.</li>
	<li>콜로니를 선택하여 추가 성장을 위해 액체 YEP 배지(해당 항생제 포함)로 옮깁니다. 24-36시간 후, RUBY-F 및 RUBY-R의 프라이머(표 1)를 사용하여 PCR을 수행하여 플라스미드가 Agrobacterium으로 성공적으로 전달되었는지 확인합니다.</li>
	<li>성공적으로 형질전환된 아그로박테리아 1mL를 100mL의 신선한 액체 YEP 배지(해당 항생제 포함)로 옮긴 다음 28°C에서 밤새 0.8의 OD600 으로 성장시킵니다.</li>
	<li>박테리아 현탁액을 4,000 x g 에서 4°C에서 5분 동안 원심분리하고, 현탁액 침투 배지(10mM MgCl2 및 10mM MES-KOH [pH 5.6])로 박테리아 펠릿을 한 번 세척한 다음 다시 원심분리합니다. 대나무 변형을 위해 현탁액 침투 매체에 박테리아 펠릿을600 의 OD 0.6으로 재현탁시킵니다.</li>
</ol>3. Agrobacterium - planta 전이 체계에서 중재하는
<ol><li>변신을 준비하십시오. 뿌리가 손상되지 않도록 토양이 부착된 뿌리가 있는 묘목을 기질에서 조심스럽게 제거합니다. 수분을 유지하고 토양 분리를 방지하기 위해 묘목을 은박지로 감쌉니다(그림 1A).</li>
	<li>포장된 묘목을 습도가 높고(상대 공기 습도 >90%) 조도가 낮은 환경(강도가 50μmol/m2/s 미만)인 환경으로 2시간 동안 옮깁니다.</li>
	<li>주사기의 날카로운 바늘을 사용하여 대나무 묘목의 말린 미성숙 잎의 윗부분(상단에서 약 1-2cm)을 한두 번 감습니다( 그림 1A의 빨간색 삼각형으로 표시).</li>
	<li>그런 다음 묘목의 상처 입은 윗부분을 Agrobacterium 현탁액에 담그십시오. 상처에서 아그로박테리움 에 빠르게 담그는 것까지 전 과정을 수행하면 신선한 상처가 접종 효율을 높일 수 있습니다.</li>
	<li>묘목을 즉시 25-27mmHg의 압력으로 진공 챔버로 2분 동안 옮깁니다(그림 1B).</li>
	<li>진공 청소기로 청소한 후 묘목의 포장을 조심스럽게 풀고 기질에 다시 심습니다. 묘목을 실온(18-25°C)에서 높은 습도(RH>90%)와 함께 희미한 빛이나 어둠(<50μmol/m 2/s)에2일 동안 둡니다. 그 후, 정상적인 성장 조건에서 묘목을 배양하고 5-7 일마다 물을줍니다. 후속 실험을 위한 재료를 제공하기 위해 표현형을 관찰합니다.</li>
</ol>4. 유전자 편집을 위한 단일 가이드 RNA(sgRNA) 설계
<ol><li>표적 유전자 염기서열의 특이적이고 보존된 도메인 근처에 위치한 protospacer adjacent motif (PAM) 부위를 식별합니다. 이 CRISPR/Cas9 시스템에서 특정 PAM 염기서열이 NGG인지 확인하십시오. 대나무 게놈 데이터베이스에 대해 BlastN 검색을 수행하여 선택한 염기서열의 표적 특이성을 확인합니다. sgRNA가 특히 업스트림 영역에서 고유하고 PAM 9,11에 가까운지 확인합니다. 참고: 이 비교는 유전자 편집 과정에 의해 영향을 받는 게놈에서 잠재적인 off-target 부위를 효과적으로 감소시킵니다.</li>
	<li>PeVDE 유전자13의 첫 번째 엑손에서 두 개의 sgRNA(sgRNA-1 및 sgRNA-2)를 설계합니다. sgRNA-1에 PAM의 업스트림에 AgeI 제한 부위를 포함하고 sgRNA-2에 PAM의 업스트림에 XbaI 제한 부위를 포함합니다. KNWYCYGK의 보존된 모티프를 암호화하는 PeCCR5 유전자의 네 번째 엑손에서 하나의 sgRNA를 설계합니다. 이 모티프는 CCR14의 촉매 작용에 매우 중요합니다.</li>
	<li>PAM 부위에 인접한 20 뉴클레오티드 스페이서 서열을 설계합니다. 이 spacer 염기서열은 Cas9 효소를 DNA 절단 및 후속 유전자 편집을 위한 표적 부위로 안내합니다. 참고: PAM 부위 내에서 엔도뉴클레아제 효소 절단 부위의 상류에 있는 표적 부위를 선택하는 것이 좋습니다. 이것은 유전자 편집 효율성의 검증을 용이하게 할 것입니다.</li>
</ol>5. 뇌관 디자인 및 PCR
<ol><li>PeVDE 및 PeCCR5 단편의 증폭을 위한 특정 프라이머를 수동으로 설계합니다. 업스트림 및 다운스트림 프라이머를 표적 부위 외부 최소 100bp에 위치하도록 설계하고, 전기영동 중에 뚜렷한 띠 분리를 허용하기 위해 100bp 이상의 길이 차이를 갖도록 합니다. 유전자의 처음 500bp 내에서 RUBY의 증폭을 위한 프라이머를 설계합니다. 사용된 모든 프라이머의 목록은 표 1에 나와 있습니다.</li>
	<li>PCR에 high-fidelity DNA polymerase를 사용하십시오. 이 경우에, 유전자 클로닝에 있는 높은 충실도 그리고 능률적인 확대를 가진 DNA 폴리메라이제를 이용하십시오.</li>
	<li>PCR 반응 혼합물을 다음과 같이 준비한다: 5x 완충액(Mg2+ Plus): 4 μL; dNTP 혼합물 (각각 2.5 mM): 1.6 μL; 정방향 및 역방향 프라이머(각각 10pmol): 각각 1μL; 대나무 게놈 DNA(약 50ng); DNA 중합효소 (2.5 U/μL): 0.2 μL; 물을 총 부피 20μL로 희석합니다.</li>
	<li>PCR 실행 조건을 따르십시오: 98°C에서 5분 동안 초기 변성; 98°C에서 10초 동안 변성; 56 °C에서 5 초 동안 어닐링; 72°C에서 30초 동안 확장; 32 사이클 동안 변성을 반복하여 연장합니다. 72°C에서 5분 동안 최종 확장; 4 °C에서 무기한 유지합니다. 참고: PCR 조건은 예제로 제공되며 특정 애플리케이션 또는 표적에 맞게 최적화해야 할 수 있습니다.</li>
</ol>6. DNA 추출, 엔도뉴클레아제 효소 소화 및 염기서열 분석
<ol><li>이미징-PAM 형광측정기로 식별한 대로 가위를 사용하여 신선한 대나무 잎 잎에서 NPQ 값이 낮은 영역을 분리합니다(7.4단계 참조). 액체 질소로 잎 샘플을 얼리고 얼어붙은 잎 샘플을 모르타르에 옮깁니다. 유봉을 사용하여 샘플을 미세한 분말로 분쇄하고 분쇄 과정에서 충분한 액체 질소를 첨가합니다. 이 단계는 DNA를 포함한 세포 내용물을 방출하는 데 도움이 됩니다.</li>
	<li>CTAB(Cetyltrimethylammonium Ammonium Bromide) 방법을 사용하여 분말 잎에서 게놈 DNA를 추출합니다. 잎 분말 샘플 50mg을 800μL의 2% CTAB 용액에 추가합니다. 샘플을 완전히 혼합하고 65°C에서 30분 동안 배양하고 5분마다 부드럽게 흔듭니다.</li>
	<li>같은 양의 클로로포름/이소아밀 알코올(24:1, v/v)을 넣고 혼합물을 세게 흔듭니다. 8,000g에서 8분 동안 원심분리한 후 상층액을 새 튜브로 옮깁니다.</li>
	<li>동일한 양의 클로로포름/이소아밀 알코올을 추가하고 6.3단계를 반복합니다. 얼음처럼 차가운 이소프로판올을 같은 부피로 넣고 튜브를 여러 번 뒤집은 후 -20°C에서 30분 동안 둡니다. 8,000 x g 에서 5분 동안 원심분리한 후 상층액을 버립니다.</li>
	<li>4°C에서 75% 에탄올로 DNA 펠릿을 2번 세척한 다음 50μL의 물에 녹입니다.</li>
	<li>5.4단계의 프로토콜로 야생형 및 Agrobacterium에 감염된 대나무 잎 모두에서 표적 유전자의 표적 부위를 포함하는 게놈 DNA를 증폭합니다.</li>
	<li>PCR 산물의 엔도뉴클레아제 효소 분해를 수행합니다. 증폭된 DNA 단편 내에서 원하는 제한 부위를 인식하는 특정 효소를 선택합니다. 소화를 위해 AgeI 및 XbaI 엔도뉴클레아제를 사용하십시오.</li>
	<li>AgeI 또는 XbaI(20 units/μL)-1 μL, 1 μg PCR 산물, 10x 완충액-5 μL로 구성된 반응 혼합물을 준비하고, 물을 첨가하여 총 부피 50 μL를 만듭니다. 37°C에서 1시간 동안 배양합니다.</li>
	<li>겔 전기영동을 사용하여 분해된 DNA 절편의 비율을 분석합니다. 야생형 및 아그로박테리움에 감염된 샘플에서 분해된 단편을 비교하여 유전자 편집 효율성을 평가합니다.</li>
	<li>PeVDE 및 PeCCR5 단편 9,15의 증폭을 위해 전치효소 어댑터 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 및 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 염기서열을 각각 정방향 및 역방향 프라이머의 5' 말단에 태깅합니다. 증폭을 위해 5.4단계에서 설명한 프로토콜을 사용합니다. 심층 염기서열분석을 위해 PCR 산물(분해 전)을 준비합니다.</li>
</ol>7. 잎의 NPQ 값의 엽록소 형광 측정
<ol><li>측정하기 전에 대나무 묘목을 2시간 동안 1200μmol/m2/s의 높은 광도 조건에 노출시킵니다. 이 노출은 흡수되는 빛의 양자를 증가시키고 잎의 광보호 시스템을 활성화합니다.</li>
	<li>이미징 PAM 형광측정기를 사용하여 대나무 잎의 in vivo PS II 엽록소 형광을 측정합니다. 6분 형광 측정을 위해 광선 광도를 800μmol/m2/s로 설정합니다. 이 기간 동안 30초마다 포화 펄스를 적용하여 엽록소 형광 곡선을 얻습니다. 곡선의 안정된 값은 계산13에 사용됩니다.</li>
	<li>다음 공식을 사용하여 비광화학 담금질(NPQ)을 계산합니다. NPQ = (F m - F m') / F m' 여기서 Fm은 어둡게 적응된 상태에서의 최대 형광을 나타내고, FM'은 임의의 빛에 적응된 상태에서의 최대 형광을 나타낸다.</li>
	<li>이미징 소프트웨어의 시각적 인터페이스에서 NPQ 값을 모니터링합니다. 이 소프트웨어를 사용하면 NPQ 값을 포함한 형광 데이터를 실시간으로 분석하고 표시할 수 있습니다.</li>
</ol>

Bamboo의 유전자 형질전환 및 편집 방법 개발

<ol>
	<li>Jiang, Z. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> World Bamboo and Rattan (in Chinese). , (2002).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+plant+regeneration+and+transformation+system+of+ma+bamboo+(Dendrocalamus+latiflorus+Munro)+started+from+young+shoot+as+explant.">An efficient plant regeneration and transformation system of ma bamboo (Dendrocalamus latiflorus Munro) started from young shoot as explant.</a> Frontiers in Plant Science. 8, 1298 (2017).</li><li>Ye, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Robust+CRISPR/Cas9+mediated+genome+editing+and+its+application+in+manipulating+plant+height+in+the+first+generation+of+hexaploid+Ma+bamboo+(Dendrocalamus+latiflorus+Munro).">Robust CRISPR/Cas9 mediated genome editing and its application in manipulating plant height in the first generation of hexaploid Ma bamboo (Dendrocalamus latiflorus Munro).</a> Plant Biotechnology Journal. 18 (7), 1501-1503 (2020).</li><li>Xiang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+purple+Ma+bamboo+(Dendrocalamus+latiflorus+Munro)+with+enhanced+drought+and+cold+stress+tolerance+by+engineering+anthocyanin+biosynthesis.">Production of purple Ma bamboo (Dendrocalamus latiflorus Munro) with enhanced drought and cold stress tolerance by engineering anthocyanin biosynthesis.</a> Planta. 254 (3), 50 (2021).</li><li>Huang, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+genetic+transformation+and+CRISPR/Cas9-based+genome+editing+system+for+moso+bamboo+(Phyllostachys+edulis).">An efficient genetic transformation and CRISPR/Cas9-based genome editing system for moso bamboo (Phyllostachys edulis).</a> Frontiers in Plant Science. 13, 822022 (2022).</li><li>Lee, M. W., Yang, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+assay+by+agroinfiltration+of+leaves.">Transient expression assay by agroinfiltration of leaves.</a> Methods in Molecular Biology. 323, 225-229 (2006).</li><li>Canto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+expression+systems+in+plants:+potentialities+and+constraints.">Transient expression systems in plants: potentialities and constraints.</a> Advances in Experimental Medicine and Biology. 896, 287-301 (2016).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+the+production+and+expedient+screening+of+CRISPR/Cas9-mediated+non-transgenic+mutant+plants.">A method for the production and expedient screening of CRISPR/Cas9-mediated non-transgenic mutant plants.</a> Horticulture Research. 5, 13 (2018).</li><li>Sun, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+biotechnology+for+in-planta+gene+editing+and+its+application+in+promoting+flavonoid+biosynthesis+in+bamboo+leaves.">A new biotechnology for in-planta gene editing and its application in promoting flavonoid biosynthesis in bamboo leaves.</a> Plant Methods. 19 (1), 20 (2023).</li><li>He, Y., Zhang, T., Sun, H., Zhan, H., Zhao, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reporter+for+noninvasively+monitoring+gene+expression+and+plant+transformation.">A reporter for noninvasively monitoring gene expression and plant transformation.</a> Horticulture Research. 7 (1), 152 (2020).</li><li>Wang, C., Shen, L., Fu, Y., Yan, C., Wang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+CRISPR/Cas9+system+for+multiplex+genome+editing+in+rice.">A simple CRISPR/Cas9 system for multiplex genome editing in rice.</a> Journal of Genetics and Genomics. 42 (12), 703-706 (2015).</li><li>McCormick, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leaf+disc+transformation+of+cultivated+tomato+(L.+esculentum)+using+Agrobacterium+tumefaciens.">Leaf disc transformation of cultivated tomato (L. esculentum) using Agrobacterium tumefaciens.</a> Plant Cell Reports. 5 (2), 81-84 (1986).</li><li>Lou, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+violaxanthin+de-epoxidase+gene+from+moso+bamboo,+confers+photoprotection+ability+in+transgenic+Arabidopsis+under+high+light.">a violaxanthin de-epoxidase gene from moso bamboo, confers photoprotection ability in transgenic Arabidopsis under high light.</a> Frontiers in Plant Science. 13, 927949 (2022).</li><li>Zhou, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+cinnamoyl+CoA+reductases+involved+in+parallel+routes+to+lignin+in+Medicago+truncatula.">Distinct cinnamoyl CoA reductases involved in parallel routes to lignin in Medicago truncatula.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (41), 17803-17808 (2010).</li><li>De Roeck, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Deleterious+ABCA7+mutations+and+transcript+rescue+mechanisms+in+early+onset+Alzheimer's+disease.">Deleterious ABCA7 mutations and transcript rescue mechanisms in early onset Alzheimer's disease.</a> Acta Neuropathologica. 134 (3), 475-487 (2017).</li></ol>

저자는 서로 상충되는 이해관계가 없다고 선언한다.

이 방법은 일반적으로 1-2년이 소요되는 기존의 유전자 형질전환 방법에 비해 소요 시간을 크게 단축하고 5일 이내에 외인성 유전자의 일시적인 발현과 내인성 유전자의 유전자 편집을 달성합니다. 그러나 이 방법은 극히 일부의 세포만 변형시킬 수 있고, 유전자 편집 잎은 키메라성이며 완전한 식물로 재생되는 능력이 부족하기 때문에 한계가 있습니다. 그럼에도 불구하고 이러한 식물 유?...

대나무의 유전자 기능에 대한 연구는 대나무에 대한 이해를 높이고 유전자 변형의 가능성을 여는 데 큰 가능성을 가지고 있습니다. 이것의 효과적인 방법은 대나무 잎에 있는 Agrobacterium-mediated 감염의 과정을 통해 달성될 수 있다, 외인성 유전자를 포함하는 T-DNA 파편이 세포로 소개되는, 이어서 잎 세포 내의 유전자의 발현으로 이끌어 내는.
대나무는 제조, 예술 및 연구 분야에서 광범위하게 응용되는 귀중하고 재생 가능한 자원입니다. 대나무는 높은 기계적 강도, 인성, 적당한 강성 및 유연성1과 같은 우수한 목재 특성을 가지고 있으며 현재 칫솔, 빨대, 단추, 일회용 식기, 지하 파이프 라인 및 화력 발전용 냉각탑 충진재를 포함한 다양한 가정 및 산업 용품에 널리 사용됩니다. 따라서 대나무 육종은 플라스틱을 대체하고 플라스틱 사용량을 줄이며 환경을 보호하고 기후 변화에 대처할 수 있는 우수한 목재 특성을 가진 대나무 품종을 확보하고 상당한 경제적 가치를 창출하는 데 중요한 역할을 합니다.
그러나 전통적인 대나무 육종은 긴 식물 성장 단계와 불확실한 개화 기간으로 인해 어려움에 직면해 있습니다. 분자 육종 기술이 개발되어 대나무 육종에 적용되었지만, 대나무 유전자 형질전환 과정은 굳은살 유도 및 재생 과정 2,3,4,5로 인해 시간이 많이 걸리고 노동 집약적이며 복잡합니다. 안정적인 유전자 형질전환을 위해서는 굳은살 유도 및 재생과 같은 조직 배양 과정을 포함하는 아그로박테리움 매개 방법이 필요한 경우가 많습니다. 그러나 대나무는 굳은살 재생 능력이 낮아 대나무에서 안정적인 유전자 변형의 적용을 크게 제한합니다. 아그로박테리움이 식물 세포를 감염시킨 후, T-DNA 단편은 식물 세포로 들어가고, 대부분의 T-DNA 단편은 세포에 통합되지 않은 상태로 남아 일시적인 발현을 초래합니다. T-DNA 단편의 작은 부분만이 염색체에 무작위로 통합되어 안정적인 발현을 유도합니다. 일시적인 발현 수준은 Agrobacterium-delivered T-DNA에서 발현된 각 유전자에 대해 달라질 수 있는 축적 곡선을 보여줍니다. 대부분의 경우, 가장 높은 발현 수준은 침윤 후 3-4일 후에 발생하고 5-6일 후에 빠르게 감소한다 6,7. 이전 연구에 따르면 내성에 대한 선택 압력 없이 얻은 유전자 편집 식물의 돌연변이 중 1/3 이상은 CRISPR/Cas9의 일시적인 발현에서 비롯되는 반면, 나머지 2/3 미만은 게놈8에 DNA가 통합된 후 안정적인 발현에서 비롯됩니다. 이것은 식물 게놈에 T-DNA를 통합하는 것이 유전자 편집에 필요하지 않다는 것을 나타냅니다. 더욱이, 내성에 대한 선택 압력은 유전자 변형되지 않은 세포의 성장을 현저히 억제하여 감염된 외식물의 재생 과정에 직접적인 영향을 미칩니다. 따라서 대나무에서 저항성에 대한 선택 압력이 없는 일시적 발현을 사용함으로써 외인성 유전자의 비통합적 발현을 달성하고 식물 기관에서 직접 유전자 기능을 연구할 수 있습니다. 따라서 대나무에서 외인성 유전자 발현 및 편집을 위한 쉽고 시간 절약적인 방법을 개발할 수 있다9.
개발된 외인성 유전자 발현 및 유전자 편집 방법은 단순성, 비용 효율성, 고가의 장비나 복잡한 절차가 없는 것이 특징이다9. 이 방법에서는 대나무 내인성 비올라잔틴 탈에폭시다제 유전자(PeVDE)를 선택 압력 없이 외인성 유전자 발현을 위한 리포터로 사용하였다. 이는 대나무 잎에서 편집된 PeVDE 가 높은 조명 하에서 광보호 능력을 감소시키고 엽록소 형광 이미징을 통해 검출할 수 있는 비광화학 담금질(NPQ) 값의 감소를 보여주기 때문입니다. 이 방법의 효과를 입증하기 위해 또 다른 대나무 내인성 유전자인 cinnamoyl-CoA 환원효소 유전자(PeCCR5)9를 이 시스템을 사용하여 녹아웃하고 이 유전자의 돌연변이를 성공적으로 생성했습니다. 이 기술은 대나무 잎에서 기능을 하는 유전자의 기능적 특성 분석에 사용할 수 있습니다. 대나무 잎에서 이러한 유전자를 일시적으로 과발현시킴으로써 발현 수준을 향상시키거나 유전자 편집을 통해 발현을 낮출 수 있어 다운스트림 유전자 발현 수준, 잎 표현형 및 제품 함량을 연구할 수 있습니다. 이는 대나무의 유전자 기능 연구를 위한 보다 효율적이고 실현 가능한 접근 방식을 제공합니다. 이 기술은 대나무 잎에서 기능하는 유전자의 기능적 특성화에 적용될 수 있습니다. 대나무 잎에서 이러한 유전자를 일시적으로 과발현시킴으로써 발현 수준을 향상시키거나 유전자 편집을 통해 발현을 낮출 수 있어 다운스트림 유전자 발현 수준, 잎 표현형 및 제품 함량을 연구할 수 있습니다. 또한 광범위한 배수체화로 인해 대나무 게놈에서 상업적으로 중요한 유전자의 대부분이 여러 사본에 존재하여 유전적 중복이 발생한다는 점에 유의하는 것이 중요합니다. 이것은 대나무에서 다중 게놈 편집을 수행하는 데 어려움을 제기합니다. 안정적인 유전자 형질전환 또는 유전자 편집 기술을 적용하기 전에 유전자 기능을 신속하게 검증하는 것이 중요합니다. 다중 유전자 복제 문제를 해결하는 데 있어 한 가지 접근 방식은 전사체 발현 프로파일을 분석하여 특정 단계에서 활발하게 발현되는 유전자를 식별하는 것입니다. 또한, 이러한 유전자 복제의 보존된 기능 도메인을 표적으로 삼으면 공통 표적 염기서열을 설계하거나 동일한 CRISPR/Cas9 벡터에 여러 표적 부위를 통합할 수 있어 이러한 유전자를 동시에 knockout할 수 있습니다. 이는 대나무의 유전자 기능 연구를 위한 보다 효율적이고 실현 가능한 접근 방식을 제공합니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>35S::RUBY</td>
			<td>Addgene, United States</td>
			<td>160908</td>
			<td>Plamid construct</td>
		</tr>
		<tr>
			<td>Agrobacterium competent cells of GV3101, EHA105,LBA4404, and AGL1</td>
			<td>Biomed, China</td>
			<td>BC304-01, BC303-01, BC301-01, and BC302-01</td>
			<td>For Agrobacterium infection</td>
		</tr>
		<tr>
			<td>CTAB</td>
			<td>Sigma-Aldrich, United States</td>
			<td>57-09-0</td>
			<td>DNA extraction</td>
		</tr>
		<tr>
			<td>Imaging-PAM fluorometer</td>
			<td>Walz, Effeltrich, Germany</td>
			<td></td>
			<td>Detect chlorophyll fluorescence of bamboo leaves</td>
		</tr>
		<tr>
			<td>ImagingWin</td>
			<td>Walz, Effeltrich, Germany</td>
			<td></td>
			<td>Software for Imaging-PAM fluorometer</td>
		</tr>
		<tr>
			<td>Paq CI or Aar I</td>
			<td>NEB, United States</td>
			<td>R0745S</td>
			<td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td>
		</tr>
		<tr>
			<td>PrimeSTAR Max DNA polymerase</td>
			<td>Takara, Japan</td>
			<td>R045Q</td>
			<td>For gene cloning</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>NEB, United States</td>
			<td>M0202V</td>
			<td>Incorporate the target sequence onto the CRISPR/Cas9 vector.</td>
		</tr>
	</tbody>
</table>

in planta gene expression and gene editing in moso bamboo leaves

대나무에 대한 새로운 식물 유전자 형질 전환 방법이 개발되어 시간이 많이 걸리고 노동 집약적인 굳은살 유도 및 재생 과정이 필요하지 않습니다. 이 방법은 대나무 묘목에 대한 상처 및 진공을 통한 Agrobacterium 매개 유전자 발현을 포함합니다. 대나무 잎에서 RUBY 리포터 및 Cas9 유전자와 같은 외인성 유전자의 발현을 성공적으로 입증했습니다. 루비 묘목에서 베타린 축적에 대한 가장 높은 형질전환 효율은 GV3101 균주를 사용하여 감염 후 85.2%의 비율로 달성되었습니다. 외래 DNA는 대나무 게놈에 통합되지 않았지만 이 방법은 외인성 유전자를 발현하는 데 효율적이었습니다. 또한, 이 방법을 사용하여 토착 리포터와 함께 유전자 편집 시스템도 개발되었는데, 이 방법에서 대나무 잎에서 편집된 대나무 비올라잔틴 탈에폭시다제 유전자(PeVDE)에 의해 생성된 in situ 돌연변이가 17.33%의 돌연변이율을 보입니다. PeVDE의 돌연변이로 인해 형광계로 정확하게 감지할 수 있는 높은 조명 하에서 비광화학적 담금질(NPQ) 값이 감소했습니다. 이것은 편집된 PeVDE를 대나무의 외인성 및 내인성 유전자 모두에 대한 잠재적인 네이티브 리포터로 만듭니다. PeVDE의 리포터와 함께 cinnamoyl-CoA reductase 유전자를 8.3%의 돌연변이율로 성공적으로 편집했습니다. 이 수술은 조직 배양 또는 굳은살 유도 과정을 피하여 대나무에서 외인성 유전자 및 내인성 유전자 편집을 빠르고 효율적으로 발현합니다. 이 방법은 유전자 기능 검증의 효율성을 향상시킬 수 있으며 대나무의 주요 대사 경로의 분자 메커니즘을 밝히는 데 도움이 될 것입니다.

The investigation of gene function in bamboo holds great promise for the advanced understanding of bamboo and unlocking its potential for genetic modification. An effective way of this can be achieved through the process of Agrobacterium-mediated infection in bamboo leaves, whereby the T-DNA fragment containing exogenous genes is introduced into the cells, subsequently leading to the expression of the genes within the leaf cells.
Bamboo is a valuable and renewable resource with a wide range of applications in manufacturing, art, and research. Bamboo possesses excellent wood properties such as high mechanical strength, toughness, moderate stiffness, and flexibility1, which is now widely used in a variety of household and industrial supplies, including toothbrushes, straws, buttons, disposable tableware, underground pipelines, and cooling tower fillers for thermal power generation. Therefore, bamboo breeding plays a crucial role in obtaining bamboo varieties with excellent wood properties for replacing plastics and reducing plastic usage, protecting the environment, and tackling climate change, as well as generating significant economic value.
However, traditional bamboo breeding faces challenges due to the lengthy vegetative growth stage and uncertain flowering period. Although molecular breeding techniques have been developed and applied to bamboo breeding, the process of bamboo gene transformation is time-consuming, labor-intensive, and complicated due to the callus induction and regeneration processes2,3,4,5. Stable genetic transformation often requires Agrobacterium-mediated methods, which involve tissue culture processes such as callus induction and regeneration. However, bamboo has a low ability for callus regeneration, greatly limiting the application of stable genetic transformation in bamboo. After Agrobacterium infects plant cells, the T-DNA fragment enters the plant cells, with the majority of T-DNA fragments remaining non-integrated in the cells, resulting in transient expression. Only a small portion of T-DNA fragments randomly integrate into its chromosome, leading to stable expression. The transient expression levels show an accumulation curve that can vary for each gene expressed from an Agrobacterium-delivered T-DNA. In most cases, the highest expression levels occur 3-4 days after infiltration and quickly decrease after 5-6 days6,7. Previous studies have shown that more than 1/3rd of mutations in gene-edited plants obtained without selection pressure for resistance come from the transient expression of CRISPR/Cas9, while the remaining less than 2/3rd come from stable expression after DNA integration into the genome8. This indicates that T-DNA integration into the plant genome is not necessary for gene editing. Moreover, selection pressure for resistance significantly inhibits the growth of non-transgenic cells, directly affecting the regeneration process of infected explants. Therefore, by using transient expression without selection pressure for resistance in bamboo, it is possible to achieve non-integrated expression of exogenous genes and study gene function directly in plant organs. Hence, an easy and time-saving method can be developed for exogenous gene expression and editing in bamboo9.
The developed exogenous gene expression and gene editing method is characterized by its simplicity, cost-effectiveness, and the absence of expensive equipment or complex procedures9. In this method, the bamboo endogenous violaxanthin de-epoxidase gene (PeVDE) was used as the reporter for exogenous gene expression without selection pressure. This is because the edited PeVDE in bamboo leaves reduces the photoprotection ability under high light and demonstrates a decrease in the non-photochemical quenching (NPQ) value, which can be detected through chlorophyll fluorescence imaging. To demonstrate the effectiveness of this method, another bamboo endogenous gene, the cinnamoyl-CoA reductase gene (PeCCR5)9, was knocked out using this system and successfully generated mutants of this gene. This technique can be used for the functional characterization of genes that have functions in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. This provides a more efficient and feasible approach for gene function research in bamboo. This technique can be applied to the functional characterization of genes that function in bamboo leaves. By overexpressing these genes transiently in bamboo leaves, their expression levels can be enhanced, or by gene editing, their expression can be knocked down, allowing for the study of downstream gene expression levels, leaf phenotypes, and product contents. Additionally, it is important to note that, due to extensive polyploidization, the majority of commercially important genes in bamboo genomes are present in multiple copies, resulting in genetic redundancy. This poses a challenge for performing multiplex genome editing in bamboo. Prior to the application of stable genetic transformation or gene editing techniques, it is crucial to quickly validate gene functions. In addressing the issue of multiple gene copies, one approach is to analyze transcriptome expression profiles to identify genes that are actively expressed during specific stages. Furthermore, targeting the conserved functional domains of these gene copies allows for the design of common target sequences or the incorporation of multiple target sites into the same CRISPR/Cas9 vector, enabling the simultaneous knockout of these genes. This provides a more efficient and feasible approach for gene function research in bamboo.

저자 스포트라이트: 지속 가능한 플라스틱 대체품을 위한 대나무 잎의 유전자 편집 발전 

플란타에 위치 Moso Bamboo Leaves의 유전자 발현 및 유전자 편집

In this study, we used Agrobacterium as a vector to introduce foreign DNA fragments into bamboo leaves. Most DNA fragments are not integrated into chromosomes and undergo transient expression. We took advantage of this transient expression to carry out gene editing.The main challenge is the limitation of gene editing of bamboo leaves, which cannot regenerate. This propose difficulties in performing editing in regenerative organs, like young shoots, and obtaining edited branches or subsequent generations with desired genetic challenges. Its main advantage is the time-saving aspect of the principle.By being able to edit bamboo genes directly in bamboo leaves, it allows for quick verification of gene fractions. This eliminates the needs for time-consuming procedures, like tissue culture or transformation, significantly speeding up research on bamboo gene fractions. The primary research will be focused on investigating the molecular mechanism of bamboo biomass formation.This will involve understanding why bamboo grows rapidly, and using that knowledge to develop bamboo varieties which are suitable for plastic substituent.

대나무 잎의 질경이 유전자 발현에서 Agrobacterium 매개 RUBY 리포터 유전자는 티로신10에서 생생한 레드 베타린을 생산할 수 있는 능력으로 인해 일시적인 유전자 발현을 시각화하는 데 효과적인 것으로 입증되었습니다. 이 연구에서는 대나무 잎에서 외인성 RUBY 유전자를 일시적으로 발현하기 위해 Agrobacterium-mediated transformation을 활?...

Watch this Scientific Journal Video about Advancing Gene Editing in Bamboo Leaves for Sustainable Plastic Alternatives at JoVE.com

본 연구에서는 대나무에서 아그로박테리움(Agrobacterium)을 매개로 하는 식물 유전자 발현 및 유전자 편집 방법의 새로운 방법을 개발하였다. 이 방법은 대나무의 유전자 기능 검증의 효율성을 크게 향상시켰으며, 이는 대나무 번식 과정을 가속화하는 데 중요한 의미를 갖습니다.

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and ...

이 연구에서는 아그로박테리움(Agrobacterium)을 벡터로 사용하여 대나무 잎에 외부 DNA 조각을 도입했습니다. 대부분의 DNA 단편은 염색체에 통합되지 않고 일시적인 발현을 겪습니다. 우리는 유전자 편집을 수행하기 위해 이 일시적인 발현을 이용했습니다.가장 큰 문제는 재생이 불가능한 대나무 잎의 유전자 편집의 한계입니다. 이것은 어린 새싹과 같은 재생 기관에서 편집을 수행하고 원하는 유전적 문제가 있는 편집된 가지 또는 후속 세대를 얻는 데 어려움을 시사합니다. 주요 장점은 원칙의 시간 절약 측면입니다.대나무 잎에서 직접 대나무 유전자를 편집할 수 있어 유전자 분획을 빠르게 확인할 수 있습니다. 이를 통해 조직 배양 또는 형질전환과 같은 시간 소모적인 절차가 필요하지 않아 대나무 유전자 분획에 대한 연구 속도가 크게 빨라집니다. 1차 연구는 대나무 바이오매스 형성의 분자 메커니즘을 조사하는 데 중점을 둘 것입니다.여기에는 대나무가 빠르게 자라는 이유를 이해하고 그 지식을 사용하여 플라스틱 치환기에 적합한 대나무 품종을 개발하는 것이 포함됩니다.

in-planta-gene-expression-and-gene-editing-in-moso-bamboo-leaves

Research

JoVE Journal

Biology

In Planta Gene Expression and Gene Editing in Moso Bamboo Leaves

1.1K 조회수.  Key Laboratory of State Forestry and Grassland Administration/Beijing on Bamboo & Rattan Science and Technology. 이 연구에서는 아그로박테리움(Agrobacterium)을 벡터로 사용하여 대나무 잎에 외부 DNA 조각을 도입했습니다. 대부분의 DNA 단편은 염색체에 통합되지 않고 일시적인 발현을 겪습니다. 우리는 유전자 편집을 수행하기 위해 이 일시적인 발현을 이용했습니다.가장 큰 문제는 재생이 불가능한 대나무 잎의 유전자 편집의 한계입니다. 이것은 어린 새싹과 같은 재생 기관에서 편?...

비디오: 저자 스포트라이트: 지속 가능한 플라스틱 대체품을 위한 대나무 잎의 유전자 편집 발전 

A novel in planta gene transformation method was developed for bamboo, which avoids the need for time-consuming and labor-intensive callus induction and regeneration processes. This method involves Agrobacterium-mediated gene expression via wounding and vacuum for bamboo seedlings. It successfully demonstrated the expression of exogenous genes, such as the RUBY reporter and Cas9 gene, in bamboo leaves. The highest transformation efficiency for the accumulation of betalain in RUBY seedlings was achieved using the GV3101 strain, with a percentage of 85.2% after infection. Although the foreign DNA did not integrate into the bamboo genome, the method was efficient in expressing the exogenous genes. Furthermore, a gene editing system has also been developed with a native reporter using this method, from which an in situ mutant generated by the edited bamboo violaxanthin de-epoxidase gene (PeVDE) in bamboo leaves, with a mutation rate of 17.33%. The mutation of PeVDE resulted in decreased non-photochemical quenching (NPQ) values under high light, which can be accurately detected by a fluorometer. This makes the edited PeVDE a potential native reporter for both exogenous and endogenous genes in bamboo. With the reporter of PeVDE, a cinnamoyl-CoA reductase gene was successfully edited with a mutation rate of 8.3%. This operation avoids the process of tissue culture or callus induction, which is quick and efficient for expressing exogenous genes and endogenous gene editing in bamboo. This method can improve the efficiency of gene function verification and will help reveal the molecular mechanisms of key metabolic pathways in bamboo.

In this study, a novel in planta gene expression and gene editing method mediated by Agrobacterium was developed in bamboo. This method greatly improved the efficiency of gene function validation in bamboo, which has significant implications for accelerating the process of bamboo breeding.

연구

생물학

Preparation of Bamboo Seedlings and Agrobacterium-Mediated In Planta Transformation System for Gene Expression

Preparation of Bamboo Seedlings and Agrobacterium -Mediated In Planta Transformation System for Gene Expression  

To begin, sow the pre-soaked bamboo seeds into the substrate of soil and vermiculite for germination. For agrobacterium infection, carefully remove the 15 day old seedlings with soil attached roots from the substrate. Wrap the seedlings with tinfoil to maintain moisture and prevent soil detachment.Transfer the wrapped seedlings to the plant growth chamber with higher humidity and lower illumination for two hours. Next, using a sharp needle from a syringe, wound the upper part of curled immature leaves once or twice. Quickly dip the wounded part of the leaves into agrobacterium suspension.Then immediately transfer the seedlings to a vacuum chamber with a pressure of 25 to 27 millimeters of mercury for two minutes. After vacuuming, carefully unwrap the seedlings and replant them into the substrate. Allow the seedlings to grow in a plant growth chamber in dim light with high humidity for two days.Then culture the seedlings under normal growth conditions, watering them every five to seven days.

유전자 발현을 위한 Planta 형질전환 시스템에서 대나무 묘목 및 Agrobacterium 매개 제조

In Planta Gene Expression and Measurement of Chlorophyll Fluorescence of Non-Photochemical Quenching Values in Bamboo Leaves

Begin by extracting the genomic DNA from the wild-type and Agrobacterium-infected bamboo leaves. Amplify the genomic DNA containing the target site of the target genes from wild-type and Agrobacterium-infected bamboo leaves using the following PCR conditions. After PCR, perform endonuclease enzyme digestion by preparing a reaction mixture containing one microliter of age-1, one microgram of PCR products, and five-microliter 10X buffer.Then, add water to a final volume of 50 microliters. Incubate the digestion mixture at 37 degrees Celsius for one hour. Using gel electrophoresis, analyze the proportion of digested DNA fragments.Compare the digested fragments from the wild-type and Agrobacterium-infected samples to assess gene editing efficiency. Expose the bamboo seedlings to high light intensity conditions to increase the amount of absorbed light quantum and activation of the leaf photoprotection system. Next, turn on the IMAGING-PAM fluorometer and set the actinic light intensity to measure in vivo photosystem II chlorophyll fluorescence of bamboo leaves.The red beta lane color produced by the RUBY gene indicated successful Agrobacterium-mediated gene expression in bamboo leaves. Out of the four Agrobacterium strains, GV3101 strain caused the most significant beta lane accumulation in infected bamboo leaves. After infection with the CRISPR-Cas9 constructs and high light treatments, certain areas of the leaf blades showed lower non-photochemical quenching values.Furthermore, enzyme digestion and sequencing analysis confirmed the successful mutation of the PeVDE gene in the edited regions. Sanger sequencing results of the PeVDE fragment after editing by both sgRNA1 and sgRNA2 showed deletion of a long fragment in the PeVDE gene. After 30 days of Agrobacterium infection, the leaf areas transfected with sgRNAs for both PeVDE and PeCCR5 exhibited lower non-photochemical quenching values.