Vielen Dank an Silke Kipper, Sarah Kiefer, Michael Weiß, Conny Bartsch und Silke Voigt-Heucke für begeisterte Probensammlung im Feld, um Janett Birkenfeld für die weitere Unterstützung, um Ulla Kobalz für die schönen Gele und Tobias Krause für die moralische Unterstützung.

Alle Verfahren wurden in Übereinstimmung mit dem Deutschen Tierschutzgesetz (TierSchG) durchgeführt. 1. Vorbereitung der Reagenzien und Verbrauchsmaterial <ol><li> Eine 5% (w / w) Chelex-100-Lösung in der molekularen Grad Wasser. Aliquots von 200 ul in Standard 1,5 ml Reaktionsgefäße. Da die Chelex-Harz fällt schnell aus der Suspension ist es notwendig, erneut homogenisiert die Suspension ständig während der Herstellung der Teilmengen. Es ist ratsam, 50 ml oder mehr in einer Charge vorbereiten und halten die homogenisiert mit einem Magnetrührer Federung. Die Chelex-Lösung kann über Jahre bei Umgebungsbedingungen gelagert werden. </li><li> Schnitten Stücke Whatman-Papier mit einer Breite kleiner als die Breite der Schnabel des Vogels zu prüfen. Die Länge des Papiers hängt von der Methode, die Probe zu nehmen: <ol><li> Mit einer Pinzette, sollte das Stück lange genug, um Probenentnahme ohne die Zange in die Schnabel des Vogels eingeführt ermöglichen. Alsgrobe Schätzung, für eine Schnabellänge von 0,5 cm ein Stück Papier mit der Länge von 1 cm sollte in Ordnung sein. </li><li> Wenn nicht mit einer Pinzette, muss das Stück länger sein, aber die Steifigkeit des Teils sollte noch Probenahme von Epithelzellen zu ermöglichen. </li></ol></li><li> Vorbereitung eines Aliquots der PCR-Vormischung für jede zu analysierende Probe. Für eine PCR in einem Gesamtvolumen von 25 &amp;mgr; l der Mischung enthält 0,18 mM dNTPs, 2 mM MgCl 2, 70 mM Tris-HCl, 17,25 mM Ammoniumsulfat, 0,1% Tween-20, 0,32 &amp;mgr; M Primer P2 (TCTGCATCGCTAAATCCTTT), 0,32 uM P8 Primer (CTCCCAAGGATGAGRAAYTG) 16 und 2 Einheiten Taq-Polymerase. Hausgemachte Taq-Polymerase 17 verwendet werden. Zusätzlich zu der maximalen Menge der DNA-Lösung zu ermöglichen, kann ein 6 &amp;mgr; l Premix hergestellt und bei -20 ° C gelagert werden, für mehrere Wochen. </li></ol> 2. Probenentnahme Das Tragen von Handschuhen ist nicht notwendig für die Aviäre Geschlechtsbestimmung, wie die PCR-Primer können nicht auf menschliche DNA anlagern. FürGenotypisierung andere Zwecke könnte es sinnvoll sein. <ol><li> Nehmen Sie den Vogel von Interesse und sanft halten sie in einer Hand, zB mit dem &quot;Ringergriff&quot; 18. Achten Sie darauf, den Vogel nicht zu drücken. </li><li> Halten Sie ein Stück Whatman-Papier mit einer Pinzette und streichen Sie es mehrmals über die Innenseite der Wangen, der Zunge und der Choane. Proben werden in der Regel in weniger als 30 Sekunden erreicht. <ol><li> Erwachsene Tiere: abhängig von der Art könnte es schwierig sein, den Vogel auf seinem Schnabel öffnen zu bekommen. Normalerweise berühren die Seite der Schnabel und mit leichtem Druck arbeiten. </li><li> Nestlings: Probenahme aus Jungtiere oder Nestlinge ist besonders einfach mit dieser Technik, da ihre Bettelverhalten bietet einfachen Zugang zum Inneren des Schnabels. Es könnte sogar möglich sein, die Probe ohne mit ihnen überhaupt zu erhalten, wie sie z. B. leicht zu bitten, wenn ihre Nistkasten geöffnet. </li></ol></li><li> Das Papier in einer vorbereiteten Reaktionsrohr Contai sofort speichernNing 200 ul 5% (w / w) Chelex-100-Lösung. </li></ol> Wenn Sie beabsichtigen auch / müssen, um die Küken zu kennzeichnen, tun Sie es jetzt, wie in Abschnitt 6 beschrieben. 3. Lagerung der Proben vor der DNA-Extraktion <ol><li> Wenn im Labor arbeiten, Lagerung von Proben bei -20 ° C Wenn dies bei Umgebungstemperaturen nicht möglich oder schwierig (z. B. auf dem Gebiet) Proben. </li><li> Proben für mehr als 3 Jahre bei Temperaturen im Bereich von Raumtemperatur bis -20 ° C gelagert werden </li></ol> 4. DNA-Extraktion <ol><li> Wenn die Probe eingefroren, aufgetaut bei Raumtemperatur. </li><li> Sicherzustellen, dass das Stück Papier, auf dem Boden des Rohrs in der Chelex-100-Lösung eingetaucht. </li><li> Proben für 15 min Inkubation bei 56 ° C. </li><li> Vortex kurz auf und drehen Sie den Inhalt des Rohres. </li><li> Die Proben für 8 min bei 100 ° C inkubieren </li><li> Drehen Sie die Proben bei 15.000 g für 3 min. </li><li> Verwenden Sie die supernatant für spätere Genotypisierung. </li></ol> 5. Molekulare Geschlechtsbestimmung <ol><li> Bereiten Sie ein PCR-Röhrchen mit 6 ul Vormischung pro Probe sowie zwei zusätzliche Rohre für die negative (obligatorisch) und Positivkontrolle (optional). Für Routinegeschlechtsbestimmung gehören eine Probe aus dem letzten erfolgreichen Geschlechtsbestimmung als positive Kontrolle. </li><li> Add 19 ul des Überstands aus der DNA-Extraktion zu dem PCR-Vormischung. Achten Sie darauf, von der Oberfläche der Lösung pipettieren, um Verschleppung von Chelex Perlen zu vermeiden. Dies ist entscheidend, wie Chelex ein Kationenaustauscher ist und somit alle enzymatischen Reaktionen stark hemmt. </li><li> Den folgenden PCR-Programm: Die Inkubation bei 94 ° C für 3 min, 45 Zyklen mit jeweils 30 sec Schmelzschritt 94 ° C, gefolgt von einem 30 Sekunden Annealing-Schritt bei 55 ° C, gefolgt von einem 45 Sekunden Verlängerung bei 72 ° C. In einem letzten Schritt vertreiben, werden die Reaktionen für 5 min bei 72 ° C inkubiert, </li><li> Bereiten Sie eine 2%-Standard TBE oder TAE agaro<html> se Gel auf der PCR-Produkte zu trennen. </li><li> Führen Sie die Agarose-Gel mit entsprechenden Spannungseinstellungen. </li><li> Visualisieren Sie die Banden unter UV-Licht und ein Bild. Stellen Sie sicher, dass die beiden Bands in den Proben von Frauen stammen, sind gut voneinander getrennt. </li><li> Unterscheiden männlichen von den weiblichen Proben durch die Anwesenheit von einem (männlichen) oder zwei (weiblich) Bands. </li></ol> 6. Kennzeichnung Nestlings <ol><li> Überprüfen Nester für neu geschlüpften Küken auf einen Zeitplan für die entsprechenden Arten / Studie (zB tägliche Kontrollen in den Morgen wird empfohlen, da die meisten Küken schlüpfen dann). </li><li> Schneiden Sie die Daunenfedern jedes Küken in einem Nest an einem anderen charakteristischen Lage. In Zebrafinken Büschel Tiefen wachsen vier charakteristischen und unterschiedlichen Gebieten in der Nestlings Körper (Abbildung 4A). Für jedes Küken schneiden einem Bereich (4B). Wenn es mehr als vier Küken in einem Nest, die einzigartigen vier &quot;Haircuts&quot; können kombiniert werden. </li></ol>ove_content &quot;&gt; Für Zebrafinken: Bewerben Beinbänder um zehn Tage nach dem Schlüpfen, wenn Daunenfedern zu schwer zu erkennen und Nestlings Größe ermöglicht es klingelt.

<ol>
	<li>Russell, W. M. S., Burch, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+principles+of+humane+experimental+technique.">The principles of humane experimental technique.</a> , (1959).</li><li>Robertson, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+kakapo,+Strigops+habroptilus+Aves,+from+feces.">Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces.</a> Mol. Ecol. 8, 1349-1350 (1999).</li><li>Yannic, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Description+of+microsatellite+markers+and+genotyping+performances+using+feathers+and+buccal+swabs+for+the+Ivory+gull+(Pagophila+eburnea).">Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea).</a> Mol. Ecol. Resour. 11, 877-889 (2011).</li><li>Bello, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+feathers.">Isolation of genomic DNA from feathers.</a> J. Vet. Diagn. Invest. 13, 162-164 (2001).</li><li>Handel, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+buccal+swabs+for+sampling+DNA+from+nestling+and+adult+birds.">Use of buccal swabs for sampling DNA from nestling and adult birds.</a> Wildl. Soc. Bull. 34, 1094-1100 (2006).</li><li>Brubaker, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+noninvasive,+direct+real-time+PCR+method+for+sex+determination+in+multiple+avian+species.">A noninvasive, direct real-time PCR method for sex determination in multiple avian species.</a> Mol. Ecol. Resour. 11, 415-417 (2011).</li><li>Arima, H., Ohnishi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Usefulness+of+avian+buccal+cells+for+molecular+sexing.">Usefulness of avian buccal cells for molecular sexing.</a> Ornithological Science. 5, 139-143 (2006).</li><li>Seki, S. -. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+sexing+of+individual+Ryukyu+Robins+Erithacus+komadori+using+buccal+cells+as+a+non-invasive+source+of+DNA.">Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA.</a> Ornithological Science. 2, 135-137 (2003).</li><li>Wellbrock, A. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Buccal+swabs+as+a+reliable+source+of+DNA+for+sexing+young+and+adult+Common+Swifts+(Apus+apus).">Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus).</a> J. Ornithol. 153, 991-994 (2012).</li><li>Marion, W. R., Shamis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Annotated-Bibliography+of+Bird+Marking+Techniques.">Annotated-Bibliography of Bird Marking Techniques.</a> Bird Banding. 48, 42-61 (1977).</li><li>Scharff, C., Adam, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurogenetics+of+birdsong.">Neurogenetics of birdsong.</a> Curr. Opin. Neurobiol. , (2012).</li><li>Griffith, S. C., Buchanan, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Zebra+Finch:+the+ultimate+Australian+supermodel.">The Zebra Finch: the ultimate Australian supermodel.</a> Emu. 110, 5-12 (2010).</li><li>Fee, M. S., Scharff, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+songbird+as+a+model+for+the+generation+and+learning+of+complex+sequential+behaviors.">The songbird as a model for the generation and learning of complex sequential behaviors.</a> Ilar J. 51, 362-377 (2010).</li><li>Honarmand, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stressful+dieting:+nutritional+conditions+but+not+compensatory+growth+elevate+corticosterone+levels+in+zebra+finch+nestlings+and+fledglings.">Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings.</a> PLoS On. 5, (1371).</li><li>Krause, E. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zebra+finch+nestlings+beg+more+under+better+nutritional+conditions.">Zebra finch nestlings beg more under better nutritional conditions.</a> Behaviour. 148, 1239-1255 (2011).</li><li>Griffiths, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+DNA+test+to+sex+most+birds.">A DNA test to sex most birds.</a> Mol. Ecol. 7, 1071-1075 (1998).</li><li>Pluthero, F. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+purification+of+high-activity+Taq+DNA+polymerase.">Rapid purification of high-activity Taq DNA polymerase.</a> Nucleic Acids Res. 21, 4850-4851 (1993).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Joint+Working+Group+on+Refinement.+Laboratory+birds:+refinements+in+husbandry+and+procedures.+Fifth+report+of+BVAAWF/FRAME/RSPCA/UFAW+Joint+Working+Group+on+Refinement.">Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement.</a> Lab Anim. 35, 1-163 (2001).</li></ol>

Die Autoren haben nichts zu offenbaren.

Geschlechtsbestimmung von Mundschleimhautabstrichen mit Chelex zeigten eine extrem hohe Erfolgsquote. Daunenfedern Schneidjungtier ermöglichte Differenzierung zwischen Nestlinge, bis Bein Streifenbildung möglich war. Chelex-DNA-Extraktion aus Wangenschleimhautabstrichen ergab genug, um molekulare DNA Geschlechtsbestimmung erfolgreich durchzuführen. Geschlechtsbestimmung war 100% richtig, wie geschlechtsdimorphischen Gefieder validiert. Die Erfolgsrate hier berichtet wird, ist deutlich hö...

Individuelle Anerkennung, Geschlechtsbestimmung und Genotypisierung sind grundlegende Voraussetzungen in einer Vielzahl von experimentellen Studien. Gewinnung von DNA Lagermaterial und Kennzeichnung Themen eindeutig (auch in einem frühen Alter) sollte nur minimale Auswirkungen auf die Physiologie, das Verhalten und Überleben. Wann immer möglich, sollten invasive Verfahren nach dem Prinzip RRR 1 vermieden werden. Nicht-invasive Verfahren sind nicht nur nützlich für das Tier, sondern könnte auch die erhaltenen Daten zu verbessern, wie die Tiere weniger von den Behandlungen betroffen. Bei Vögeln können DNA-Geschlechtsbestimmung von einer Reihe von nicht-invasiv erhältlich Materialien wie Kot 2, Federn 3,4 oder Mundschleimhautabstrichen 3,5,9 durchgeführt werden. Unabhängig von Zustand und Alter Mundschleimhautabstrichen Subjekts sind die Methode der Wahl für die Vogel-Geschlechtsbestimmung, weil sie einfach durchzuführen sind, selten scheitern und die Behandlung ist kurz. So weit, DNA aus Mundschleimhautabstrichenwurde entweder mit kommerziell erhältlichen Kits 3,6 oder zeitaufwendig Standard-DNA-Extraktionsprotokolle 3,6-8 extrahiert. Kits sind nicht nur ziemlich teuer, aber ihre Protokolle können Herausforderungen für die Feldarbeit zu verhängen. Einige Verfahrensdetails, zB Trocknen und Inkubation von Proben, nicht praktikabel sind im Feld. Gerade in einer Umgebung, wo experimentelle Protokolle erfordern Geschlecht abhängig von der Behandlung so früh wie ein paar Minuten nach dem Schlüpfen, gibt es fordern für eine schnelle, nicht-invasive, sichere und einfache Methode, um Ergebnisse zu erhalten. Auf der Vogelgrippe Taxa eine erhebliche Toolbox zur Markierung Personen entwickelt worden 10. Die breite Palette an verfügbaren Techniken erklärt die Vielfalt der Forschungsziele, Arten und Budgets. Allerdings Kennzeichnung kleinen Nestlinge hat die Forscher mit weiteren Herausforderungen konfrontiert. Bei einigen Arten (zB Singvögel) Küken sind zu klein, um Beinbänder anzuwenden und erfordern alternative Verfahren, diekeine Eltern-Nachkommen Verhalten zu ändern. Da das Bewusstsein und Interesse an der Verbesserung des Tierschutzes und Techniken in der Feld-und Laborstudien wächst, ist die Verwendung von nicht-invasiven Techniken stark gefördert und bevorzugt. Dieses Protokoll bietet eine nicht-invasive, schnell, leicht erkennbar und anhaltende Methode, um individuell zu kennzeichnen sehr jungen Nestlinge vor der Anwendung Beinbänder möglich ist. Diese Markierungsmethode ist auf einer der wichtigsten Vogel-Labormodell Arten, die Zebra-Fink (Taeniopygia guttata) 11-13 eingeführt. Das Protokoll entspricht allen bisher veröffentlichten Ziele für die einzelnen Markierungstechniken 10 und wurde bereits erfolgreich angewendet 14,15.

<table border="0" cellpadding="0" cellspacing="0" width="702">
	<tbody>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">Whatman 3MM Chromatography paper</td>
			<td style="width:163px;">e.g. Fisher Scientific</td>
			<td style="width:269px;">No.:3030-153</td>
			<td style="width:80px;"></td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:191px;">Chelex 100 Resin</td>
			<td style="width:163px;">Biorad</td>
			<td style="width:269px;">#143-2832</td>
			<td></td>
		</tr>
		<tr height="50">
			<td height="50" style="height:50px;width:191px;">Taq polymerase</td>
			<td style="width:163px;">addgene</td>
			<td style="width:269px;">http://www.addgene.org/25712/</td>
			<td></td>
		</tr>
		<tr height="75">
			<td height="75" style="height:75px;width:191px;">leg band (Flexi number rings for birds, diameter 2,5 mm)</td>
			<td style="width:163px;">Horst Stengel &#38; Sohn</td>
			<td style="width:269px;"></td>
			<td></td>
		</tr>
	</tbody>
</table>

who is who? non-invasive methods to individually sex and mark altricial chicks

Viele Experimente erfordern frühzeitige Bestimmung der Nachwuchs das Geschlecht sowie frühe Kennzeichnung von Neugeborenen für individuelle Anerkennung. Laut Tierschutz-Richtlinien sollten nicht-invasive Techniken anwendbar, wenn bevorzugt werden. In unserer Gruppe arbeiten wir auf verschiedenen Arten von Singvögel im Labor und auf dem Feld, und wir erfolgreich nicht-invasiven Methoden anwenden, um Sex und individuell markieren Küken. Dieser Beitrag stellt eine umfassende nicht-invasive Tool-Box. Geschlechtsbestimmung Vögel vor dem Ausdruck der sekundären Geschlechtsmerkmale erfordert die Sammlung von DNA-Lagermaterial für die PCR. Wir haben eine schnelle und einfache Methode, um Sex Vögel jeden Alters (post Schraffur) durch Extraktion von DNA aus Mundschleimhautabstrichen. Die Ergebnisse können innerhalb von 3 Stunden erreicht werden. Für Daunenfedern individuellen Kennzeichnung Küken werden in spezifischen Mustern ermöglicht eine schnelle Identifikation innerhalb der Schraffur um getrimmt. Dieser Satz von Methoden ist leicht anwendbar in einem Standard ausgestattetes Labor und besonders geeignet für Workinzur Abtastung und Speicherung g in dem Feld ohne spezielle Ausrüstung erforderlich. Handhabung von Küken minimiert und Markierung und Geschlechtsbestimmung Techniken sind nicht-invasiv, wodurch die RRR-Prinzip der Tierschutz-Richtlinien unterstützen.

<html> Abstrichmaterial kann in einer Vielzahl von kleinen Vögeln verwendet, um DNA für die Geschlechtsbestimmung zu erhalten Kanaren (Serinus canaria), Bengalen Finken (Lonchura striata), Nachtigallen (Luscinia megarhynchos), Kohlmeisen (Parus major) und Amseln (Turdus - Proben wurden von Zebrafinken (5 Jahre Taeniopygia guttata, 99 Personen, Alter 0 Tage) gesammelt Merula) (für alle anderen Arten: Stichprobengröße 1-3, Alter u...

Watch this Scientific Journal Video about Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks at JoVE.com

Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Dieses Protokoll bietet eine bequeme Reihe von Methoden, die extrem schnelle, einfache, nicht-invasive, sichere und kostengünstige ermöglicht, molekulare Geschlechtsbestimmung der Vögel und ihrer nicht-invasiv, schnell, sicher und leicht erkennbare Kennzeichnung kurz nach dem Schlüpfen. Nur begrenzt Handhabung von Küken erforderlich. Diese praktische Toolbox von Methoden entspricht vollständig den RRR-Richtlinien.

Wer ist wer? Nicht-invasive Methoden zur Individuell Sex und Mark Nesthocker Chicks

Many experiments require early determination of offspring's sex as well as early marking of newborns for individual recognition. According to animal ...

who-is-who-non-invasive-methods-to-individually-sex-mark-altricial

Research

JoVE Journal

Biology

18.2K Aufrufe.  Freie Universität Berlin.  Dieses Protokoll bietet eine bequeme Reihe von Methoden, die extrem schnelle, einfache, nicht-invasive, sichere und kostengünstige ermöglicht, molekulare Geschlechtsbestimmung der Vögel und ihrer nicht-invasiv, schnell, sicher und leicht erkennbare Kennzeichnung kurz nach dem Schlüpfen. Nur begrenzt Handhabung von Küken erforderlich. Diese praktische Toolbox von Methoden entspricht vollständig den RRR-Richtlinien. 

Serie: Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks

Labeling hESCs and hMSCs with Iron Oxide Nanoparticles for Non-Invasive in vivo Tracking with MR Imaging

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative medicine. A non-invasive method to monitor the transplanted stem cells repeatedly in vivo would greatly enhance our ability to understand the mechanisms that control stem cell death and identify trophic factors and signaling pathways that improve stem cell engraftment. MR imaging has been proven to be an effective tool for the in vivo depiction of stem cells with near microscopic anatomical resolution. In order to detect stem cells with MR, the cells have to be labeled with cell specific MR contrast agents. For this purpose, iron oxide nanoparticles, such as superparamagnetic iron oxide particles (SPIO), are applied, because of their high sensitivity for cell detection and their excellent biocompatibility. SPIO particles are composed of an iron oxide core and a dextran, carboxydextran or starch coat, and function by creating local field inhomogeneities, that cause a decreased signal on T2-weighted MR images. This presentation will demonstrate techniques for labeling of stem cells with clinically applicable MR contrast agents for subsequent non-invasive in vivo tracking of the labeled cells with MR imaging.

For the evaluation of new stem cell therapies it is important to non-invasively track the injected cells in vivo. This video will show you how to label human mesenchymal and embryonic stem cells with iron oxide based contrast agents in vivo for subsequent MR imaging in vivo.

Labeling hESCs und hMSCs mit Eisenoxid-Nanopartikel für Non-Invasive in vivo-Tracking mit MR-Bildgebung

In recent years, stem cell research has led to a better understanding of developmental biology, various diseases and its potential impact on regenerative ...

Forschung

Biologie

Labeling Stem Cells with Fluorescent Dyes for non-invasive Detection with Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo labeling of stem cells with a fluorescent dye, subsequent intravenous injection of the labeled cells and visualization of their accumulation in specific target organs or pathologies. The presented technique demonstrates how we label human mesenchymal stem cells (hMSC) by simple incubation with the lipophilic fluorescent dye DiD (C67H103CIN2O3S) and how we label human embryonic stem cells (hESC) with the FDA approved fluorescent dye Indocyanine Green (ICG). The uptake mechanism is via adherence and diffusion of the lypophilic dye across the phospholipid cell membrane bilayer. The labeling efficiency is usually improved if the cells are incubated with the dye in serum-free media as opposed to incubation in serum-containing media. Furthermore, the addition of the transfection agent Protamine Sulfate significantly improves contrast agent uptake.

This video shows techniques for labeling of human embryonic stem cells and mesenchymal stem cells with fluorescent dyes. This technique can be used for an in vivo tracking of transplanted stem cells with optical imaging and for histopathological correlations with fluorescence microscopy.

Labeling Stammzellen mit fluoreszierenden Farbstoffen zur nicht-invasiven Detektion mit Optical Imaging

Optical imaging (OI) is an easy, fast and inexpensive tool for in vivo monitoring of new stem cell based therapies. The technique is based on ex vivo ...

Non-invasive 3D-Visualization with Sub-micron Resolution Using Synchrotron-X-ray-tomography

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard cuticle which makes it difficult to use protocols of classical histology. In addition, histological sectioning destroys the sample and can therefore not be used for unique material. Hence, a non-destructive method is desirable which allows to view inside small samples without the need of sectioning.
We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) in Grenoble (France) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows us to reconstruct the internal organization in its natural state without the artefacts produced by histological sectioning. These date can be used for quantitative morphology, landmarks, or for the visualization of animated movies to understand the structure of hidden body parts and to follow complete organ systems or tissues through the samples.

We used synchrotron X-ray tomography at the European Synchrotron Radiation Facility (ESRF) to non-invasively produce 3D tomographic datasets with a pixel-resolution of 0.7&micro;m. Using volume rendering software, this allows the reconstruction of internal structures in their natural state without the artefacts produced by histological sectioning.

Nicht-invasive 3D-Visualisierung mit Sub-Mikron-Auflösung mit Synchrotron-Röntgen-Tomographie

Little is known about the internal organization of many micro-arthropods with body sizes below 1 mm. The reasons for that are the small size and the hard ...

A Magnetic Tether System to Investigate Visual and Olfactory Mediated Flight Control in Drosophila

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. As such, visual stabilization of upwind tracking directly aids in odor tracking. But do olfactory signals directly influence visual tracking behavior independently from wind cues? Also, the recent deluge of research on the neurophysiology and neurobehavioral genetics of olfaction in Drosophila has motivated ever more technically sophisticated and quantitative behavioral assays. Here, we modified a magnetic tether system originally devised for vision experiments by equipping the arena with narrow laminar flow odor plumes. A fly is glued to a small steel pin and suspended in a magnetic field that enables it to yaw freely. Small diameter food odor plumes are directed downward over the fly s head, eliciting stable tracking by a hungry fly. Here we focus on the critical mechanics of tethering, aligning the magnets, devising the odor plume, and confirming stable odor tracking.

Here we describe how to tether a fly in an olfactory magnetic-tether (OMT) apparatus. We describe how to align the rare-earth magnets and odor ports, and how to set mass flow rates for both the stimulus delivery and vacuum suction to achieve optimal odor tracking.

A Magnetic Tether System zur visuellen und olfaktorischen Mediated Flight Control in Drosophila Untersuchen

It has been clear for many years that insects use visual cues to stabilize their heading in a wind stream. Many animals track odors carried in the wind. ...

Cell Block Preparation from Cytology Specimen with Predominance of Individually Scattered Cells

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually scattered cells and small cell groups. This technique uses HistoGel (Thermo Scientific) with conventional laboratory equipment.
The use of cell block sections is a valuable ancillary tool for evaluation of non-gynecologic cytology. They enable the cytopathologist to study additional morphologic specimen detail including the architecture of the lesion. Most importantly, they allow for the evaluation of ancillary studies such as immunocytochemistry, in-situ hybridization tests (FISH/CISH) and in-situ polymerase chain reaction (PCR). Traditional cell block preparation techniques have mostly been applied to non-gynecologic cytology specimens, typically for body fluid effusions and fine needle aspiration biopsies.
Liquid based cervicovaginal specimens are relatively less cellular than their non-gynecologic counterparts with many individual scattered cells. Because of this, adequate cellularity within the cell block sections is difficult to achieve. In addition, the histotechnologist sectioning the block cannot visualize the level at which the cells are at the highest concentration. Therefore, it is difficult to monitor the appropriate level at which sections can be selected to be transferred to the glass slides for testing. As a result, the area of the cell block with the cells of interest may be missed, either by cutting past or not cutting deep enough. Current protocol for Shidham's method addresses these issues. Although this protocol is standardized and reported for gynecologic liquid based cytology specimens, it can also be applied to non-gynecologic specimens such as effusion fluids, FNA, brushings, cyst contents etc for improved quality of diagnostic material in cell block sections.

Shidham's method for preparation of cell blocks with AV-marker from cytology specimens containing individually scattered cells and small cell groups.

Cell Block Vorbereitung von Zytologie Probe mit Vorherrschaft von Individuell verstreuten Zellen

This video demonstrates Shidham's method for preparation of cell blocks from liquid based cervicovaginal cytology specimens containing individually ...

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing and adult tissue. An advance in this concept is Genetic Inducible Fate Mapping (GIFM), linking gene expression, cell fate, and cell behaviors in vivo, to create fate maps based on genetic lineage.
GIFM exploits X-CreER lines where X is a gene or set of gene regulatory elements that confers spatial expression of a modified bacteriophage protein, Cre recombinase (CreERT). CreERT contains a modified estrogen receptor ligand binding domain which renders CreERT sequestered in the cytoplasm in the absence of the drug tamoxifen. The binding of tamoxifen releases CreERT, which translocates to the nucleus and mediates recombination between DNA sequences flanked by loxP sites. In GIFM, recombination typically occurs between a loxP flanked Stop cassette preceding a reporter gene such as GFP.
Mice are bred to contain either a region- or cell type-specific CreER and a conditional reporter allele. Untreated mice will not have marking because the Stop cassette in the reporter prevents further transcription of the reporter gene. We administer tamoxifen by oral gavage to timed-pregnant females, which provides temporal control of CreERT release and subsequent translocation to the nucleus removing the Stop cassette from the reporter. Following recombination, the reporter allele is constitutively and heritably expressed. This series of events marks cells such that their genetic history is indelibly recorded. The recombined reporter thus serves as a high fidelity genetic lineage tracer that, once on, is uncoupled from the gene expression initially used to drive CreERT.
We apply GIFM in mouse to study normal development and ascertain the contribution of genetic lineages to adult cell types and tissues. We also use GIFM to follow cells on mutant genetic backgrounds to better understand complex phenotypes that mimic salient features of human genetic disorders.
This video article guides researchers through experimental methods to successfully apply GIFM. We demonstrate the method using our well characterized Wnt1-CreERT;mGFP mice by administering tamoxifen at embryonic day (E)8.5 via oral gavage followed by dissection at E12.5 and analysis by epifluorescence stereomicroscopy. We also demonstrate how to micro-dissect fate mapped domains for explant preparation or FACS analysis and dissect adult fate-mapped brains for whole mount fluorescent imaging. Collectively, these procedures allow researchers to address critical questions in developmental biology and disease models.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark and Track Cells In Vivo

Genetic Inducible Fate Mapping (GIFM) marks and tracks cells with fine spatial and temporal control in vivo and elucidates how cells from a specific genetic lineage contribute to developing and adult tissues. Demonstrated here are the techniques required to fate map E12.5 mouse embryos for epifluorescent and explant analysis.

A Practical Approach to Genetic Inducible Fate Mapping: A Visual Guide to Mark und Track Cells In Vivo</em

Fate maps are generated by marking and tracking cells in vivo to determine how progenitors contribute to specific structures and cell types in developing ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

Eine reversible, nicht-invasive Methode für Airway Resistance-Messungen und bronchoalveolären Lavage Sampling in Mäuse

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Fecal Glucocorticoid Analysis: Non-invasive Adrenal Monitoring in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, corticotrophin releasing hormone (CRH) is released from the hypothalamus in the brain. This stimulates the release of adrenocorticotrophic hormone (ACTH) from the pituitary gland, which in turn stimulates release of glucocorticoids from the adrenal gland. In horses the glucocorticoid corticosterone is responsible for several adaptations needed to support equine flight behaviour and subsequent removal from the aversive situation. Corticosterone metabolites can be detected in the feces of horses and assessment offers a non-invasive option to evaluate long term patterns of adrenal activity. Fecal assessment offers advantages over other techniques that monitor adrenal activity including blood plasma and saliva analysis. The non-invasive nature of the method avoids sampling stress which can confound results. It also allows the opportunity for repeated sampling over time and is ideal for studies in free ranging horses. This protocol describes the enzyme linked immunoassay (EIA) used to assess feces for corticosterone, in addition to the associated biochemical validation.

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. The method offers a non-invasive option to assess long term patterns in both domestic and free ranging horses. This protocol describes the enzyme linked immunoassay involved and the associated biochemical validation.

Fecal Glucocorticoid-Analyse: Nicht-invasive Monitoring-Adrenal in Equids

Adrenal activity can be assessed in the equine species by analysis of feces for corticosterone metabolites. During a potentially aversive situation, ...

Methods to Discover Alternative Promoter Usage and Transcriptional Regulation of Murine Bcrp1

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually untranslated &#8212; first exons. Bcrp1 (Abcg2), the murine orthologue of the ABC transporter Breast Cancer Resistance Protein (BCRP, ABCG2), has at least four alternative promoters that are designated by the corresponding four alternative first exons produced: E1U, E1A, E1B, and E1C. Herein, in-silico protocols are presented to predict alternative promoter usage for Bcrp1. Furthermore, reporter assay methods are described to produce reporter constructs for alternative promoters and to determine the functionality of putative promoters upstream of the alternative first exons that are identified.

With the murine ABC transporter Bcrp1 (Abcg2) as an example, in-silico protocols are presented to detect alternative promoter usage in genes expressed in mouse tissues, and to evaluate the functionality of the alternative promoters identified using reporter assays.

Methoden Alternative Promoter Verwendung und Transkriptions-Verordnung von Murine Bcrp1 zu entdecken

Gene expression in different tissues is often controlled by alternative promoters that result in the synthesis of mRNA with unique &#8212; usually ...

Methods to Classify Cytoplasmic Foci as Mammalian Stress Granules

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to stress conditions, are implicated in various aspects of cell metabolism and survival. SGs modulate cellular signaling pathways, post-transcriptional gene expression, and stress response programs. The formation of these mRNA-containing granules is directly connected to cellular translation. SG assembly is triggered by inhibited translation initiation, and SG disassembly is promoted by translation activation or by inhibited translation elongation. This relationship is further highlighted by SG composition. Core SG components are stalled translation pre-initiation complexes, mRNA, and selected RNA-binding Proteins (RBPs). The purpose of SG assembly is to conserve cellular energy by sequestering translationally stalled housekeeping mRNAs, allowing for the enhanced translation of stress-responsive proteins. In addition to the core constituents, such as stalled translation preinitiation complexes, SGs contain a plethora of other proteins and signaling molecules. Defects in SG formation can impair cellular adaptation to stress and can thus promote cell death. SGs and similar RNA-containing granules have been linked to a number of human diseases, including neurodegenerative disorders and cancer, leading to the recent interest in classifying and defining RNA granule subtypes. This protocol describes assays to characterize and quantify mammalian SGs.

Stress Granules (SGs) are nonmembranous cytoplasmic structures that form in cells exposed to a variety of stresses. SGs contain mRNAs, RNA-binding proteins, small ribosomal subunits, translation-related factors, and various cell signaling proteins. This protocol describes a workflow that uses several experimental approaches to detect, characterize, and quantify bona fide SGs.

Methoden zur Klassifizierung von zytoplasmatischen Foci als Säugetier-Stressgranulat

Cells are often challenged by sudden environmental changes. Stress Granules (SGs), cytoplasmic ribonucleoprotein complexes that form in cells exposed to ...