This work was supported by grants provided by the National Institutes of Health (NIH), R01 CA200669 to JF and R01 CA121107 to GRJT, and by a postdoctoral fellowship grant from Susan G. Komen for the Cure to IK (PDF12229484).

1. Synthese von Aspirin-Fumarat Prodrug GTCpFE <ol><li> Unter Verwendung eines Kunststoff-Kolbenspritze, messen 0,81 ml (20 mmol) Methanol und mischen Sie es in Wasser (10 ml) in einem Rundkolben. Kühlen der erhaltenen Mischung auf 0 ° C, indem der Kolben in einem Eis-Wasserbad platzieren. In 4-Hydroxybenzylalkohol (2,48 mg, 20 mmol) und rührt das Reaktionsgemisch, bis die Lösung klar ist. </li><li> Eine Lösung aus O -acetylsalicyloyl Chlorid (3,77 mg, 19 mmol) in wasserfreiem Toluol (10 ml) , indem die gewünschte Menge an O -acetylsalicyloyl Chlorid Wiege- und es in dem Lösungsmittel in einem getrennten Kolben gelöst wird . Unter Verwendung eines Kunststoff-Kolbenspritze, fügen Sie diese Lösung zu der Mischung, hergestellt in Schritt 1.1, und lassen Sie die Reaktion bei 0 ° C gerührt. </li><li> Überwachen Sie die Reaktion unter Verwendung von Dünnschichtchromatographie (TLC). Die TLC-Platten sollten Silica als stationäre Phase aufweisen. <ol><li> Bereiten Sie eine mobile Phase, bestehend aus 20:80 Ethylacetat (AcOEt) / Hexan. In einer DC-Kammer(Oder kleine Behälter) werden 5 ml der mobilen Phase den Boden der Kammer zu bedecken. HINWEIS: Die Menge der mobilen Phase hängt von der gewählten Kammer. Fügen Sie immer genug, um den Boden zu bedecken, aber sobald die TLC nach innen gesetzt ist, wird die Lösungsmittelleitung sollte nicht die Höhe übertreffen, wo die Verbindungen entdeckt werden. </li><li> Nehmen Sie eine Probe der Reaktion mit einer Spritze (0,2 ml), legen Sie sie in einem kleinen Fläschchen, und verdünnen Sie es mit Ethylacetat (2-3 Tropfen). Mit einem Spotter TLC, nehmen Sie vorsichtig eine Probe des verdünnten Reaktionsmischung und vor Ort in der TLC. HINWEIS: Die Punkte 1-2 mm sein sollte, und dies sollte am unteren 1/4 Zoll von der DC-Platte durchgeführt werden. </li><li> Auf der gleichen TLC, legen einen Punkt einer Lösung von O-acetylsalicyloyl Chlorid (0,2 mg in 0,5 ml Ethylacetat) als Vergleich. Sobald die Flecken trocken sind, legen Sie sie in der Kammer und laufen lassen, bis die Lösungsmittelfront hat fast die Spitze des TLC erreicht. </li><li> Nehmen Sie die TLC aus, trocknen lassen und zu visualisieren, es unter einer UV-Lampe. Die Reaktion ist abgeschlossen , wenn die O -acetylsalicyloyl Chlorid Stelle aus dem Reaktionsgemisch verschwindet. </li><li> Wenn die Reaktion abgeschlossen ist, entfernen Sie das Eis-Wasser-Bad, und lassen Sie die Reaktion für 20 Stunden bei Raumtemperatur rühren. </li></ol></li><li> Filtriere den Niederschlag eines Büchner-Trichters mit einem Frittenscheibe von mittlerer Porosität verwendet wird. Setzen Sie den Feststoff in einer Szintillationsphiole, und lassen Sie die Verbindung im Vakuum über Nacht in einem Exsikkator bei Raumtemperatur. Verwenden Phosphorpentoxid (P 2 O 5) als Trocknungsmittel. </li><li> Trocknen Sie einen Rundkolben, indem sie sie in einem Ofen bei 80 ° C für mindestens zwei Tage platzieren, bevor diese Reaktion einrichten. Alternativ Der Kolben wird mit einem Septum und durchdringen es mit einer Nadel, die an eine Vakuumpumpe angeschlossen ist. Schalten Sie die Vakuumpumpe auf und trocknen Sie den Kolben unter Verwendung einer Heizpistole. Abkühlen lassen, und wiederholen Sie diesen Schritt 2 weitere Male. </li><li> Dieser Ballon wird Argongas verwendet, und schließen Sie es an eine Plastikspritze (dessen Kolben hwie wurde mit einer Nadel entfernt). Schalten Sie die Vakuumpumpe aus und entfernen Sie die Nadel, um es angebracht, die in dem nun getrockneten Rundkolben eingeführt wurde. Führen Sie die Nadel in die Argonballon durch das Septum verbunden, um den Rundkolben abgedichtet wird. <ol><li> Hinzufügen 4-hydroxymethylphenol Ester von 2-Acetyloxybenzoesäure (100 mg, 0,349 mmol), 4-Dimethylaminopyridin (4 mg, 0,033 mmol) und Triethylamin (53 mg, 0,523 mmol) in einen separaten Kolben, gelöst sie dann in wasserfreiem Tetrahydrofuran (5 ml). Mit einer Plastikspritze mit einer Nadel befestigt, fügen Sie diese Lösung auf den Rundkolben abgedichtet. Man kühlt die Mischung auf 0 ° C, indem der Kolben in einem Eiswasserbad platzieren. </li></ol></li><li> Zur vorhergehenden Mischung wurde eine Lösung von Ethyl Fumarsäuredichlorid Chlorid hinzu (68 mg, 0,419 mmol) in wasserfreiem Tetrahydrofuran (5 ml), tropfenweise über einen Zeitraum von 10 min. Rühre das erhaltene Lösung bei 0-5 ° C für 2-4 Std. </li><li> Extrahieren der Reaktionsmischung mit Ethylacetat (100 ml) und Salzlösung (50 ml). &lt;br /&gt; Anmerkung: Brine eine gesättigte Lösung von Natriumchlorid (NaCl). Um es vorzubereiten, legen Sie 200 ml Wasser in einem sauberen Glasbehälter dann NaCl beginnen Zugabe (unter Rühren), bis es nicht mehr auflöst. <ol><li> Nach der Extraktion, entfernen Sie die wässrige Phase und wiederholen Sie den letzteren Schritt zwei weitere Male. </li><li> Trocknen der Mischung durch Natriumsulfat zu der organischen Phase Zugabe, bis der Feststoff nicht auf nicht verklumpen, wenn die Glaswaren gerührt. Unter Verwendung eines anderen Buchner-Trichter mit einem Frittenscheibe, filtriert man die Mischung in einen Kolben mit rundem Boden um das Natriumsulfat zu entfernen, dann zur Trockne eingedampft unter Verwendung eines Rotationsverdampfers bei einer Temperatur von 40 ° C eingestellt. </li></ol></li><li> Mit Hilfe eines TLC, bestimmen eine richtige mobile Phase in der Säulenchromatographie verwendet werden. HINWEIS: Für dieses Experiment wurde ein Gradient von 20:80 AcOEt / Hexan verwendet wurde. </li><li> Bereiten Sie eine Säule mit Kieselgel und dem entsprechenden Lösungsmittelphase. Sobald die Verbindung hinzugefügt wurde, fügen Sie eine Schicht aus Natriumsulfat (oder Sand) zu protect die Säule als Lösungsmittel zugegeben. <ol><li> Da die Säule läuft, überwacht das Eluat durch TLC. Beschmutzen jede andere Teströhrchen, wie sie aus der Säule gesammelt werden. Wenn das Produkt von Interesse eluierte, mischen Sie alle Proben reines Produkt in einem großen Rundkolben, und trocknen Sie sie mit der Badtemperatur am Rotationsverdampfer bei 40 ° C eingestellt. HINWEIS: Das Produkt als weißer Feststoff erscheinen soll. </li></ol></li><li> Um die Struktur GTCpFE bestätigen, sammeln Protonen- und Kohlenstoff (1 H und 13 C, respectively) Kernspinresonanz (NMR) -Spektren gemäß den Anweisungen des Herstellers. HINWEIS: In dieser Studie wurde ein 400 MHz FT - NMR - Spektrometer verwendet wurde , die 1 H- und 13 C - Spektren zu sammeln. Führen Sie mindestens 25 Scans bei Raumtemperatur genügend Daten Auflösung zu erhalten. Die NMR - Peaks beobachtet wurden die folgenden, 1 H NMR (CDCl 3): δ 1,29 (t, 3 H, 3 J = 7,0 Hz, CH 3); 2,31 (s, 3 H, CH 3); 4,26 (q, 2 H, 3J = 7,0 Hz, COOCH 2); 5,25 (s, 2 H, OCH 2); 6,89 (s, 2 H, HC = CH); 7,19 (m, 3 H, Ar); 7,42 (m, 3 H, Ar); 7,65 (m, 1 H, Ar); 8,22 (dd, 1H, 3J = 7,8, 4 J = 1,2 Hz, Ar). 13 C - NMR (CDCl 3): 169,70, 164,86, 164,75, 162,89, 151,28, 150,69, 134,76, 134,32, 133,26, 133,16, 132,25, 129,81, 126,26, 124,11, 122,47, 122,04, 66,40, 61,43, 21,05, 14,15. </li><li> Darüber hinaus sammeln Anweisungen, um ein Massenspektrum hoher Auflösung unter Verwendung von Flüssigchromatographie-Massenspektrometrie in Kombination mit Ionenfalle und Flugzeittechnik (LCMS-IT-TOF) für eine genaue Massenmessungen gemäß Hersteller. HINWEIS: In dieser Studie (M + NH 4 +) berechnet: 430,1496; beobachtet: 430,1477. </li></ol> 2. GTCPFE Hemmt die NFĸB Aktivität in Brustkrebszellen <ol><li> Zellkulturbedingungen <ol><li> Pflegen Sie die menschliche Brustkrebs-Zelllinien, MCF-7 und MDA-MB-231 gemäß dem Standardzelle culture Techniken und 2 mit 5% CO bei 37 ° C in einem befeuchteten Inkubator fortzupflanzen. <ol><li> Bereiten MCF-7-Zellmedium aus Roswell Park Memorial Institute (RPMI) 1640-Medium mit Phenolrot mit 10% fötalem Rinderserum (FBS) ergänzt, 1% nicht-essentiellen Aminosäuren, 2 mM L-Glutamin, 1% Antibiotika Penicillin-Streptomycin und 6 ng / ml Insulin. Bereiten Sie MDA-MB-231 Zellmedium von einer verbesserten Minimum Essential Medium (IMEM), ergänzt mit 5% FBS, 1% nicht-essentielle Aminosäuren, 2 mM L-Glutamin und 1% Antibiotika Penicillin-Streptomycin. </li></ol></li></ol></li><li> NFkB-RE Luciferase Reporter Assay <ol><li> Trypsinize Brustkrebs MCF 7-Zellen 0,25% Trypsin für 5 min bei 37 ° C unter Verwendung zählen manuell ein Hämozytometer und Samen in 24-Well-Platten bei 90.000 Zellen pro Well Dichte verwendet wird. </li><li> Am folgenden Tag, Co-transfizieren Zellen mit Plasmid-DNA eines NFkB-Response-Element (NFkB-RE) Luciferase-Konstrukt, 1 ug / Vertiefung, alOng mit dem promotor Renilla-Luciferase-Konstrukt, 0,2 ug / Vertiefung. Führen Sie Transfektionen für jede Behandlungsgruppe in dreifacher Ausfertigung. <ol><li> Wasche die Zellen zweimal mit PBS und Inkubieren mit Mischungen von Plasmid - DNA und 1 &amp; mgr; l pro Vertiefung von Transfektionsreagenz (zB Lipofectamin) in serumfreien Medien. Nach 6 Stunden, ändern Sie das Medium zu 1 ml regelmäßigen Medium (ohne Antibiotika Penicillin und Streptomycin). </li></ol></li><li> Nach 16 Stunden, fügen 1 ul Fahrzeug oder verschiedene Stammlösungen der GTCpFE oder ASA Medikamente zu jeder Vertiefung. Löse Droge Stammlösungen (100, 50, 20, 10 und 1 mM) in Dimethylsulfoxid bei 1,000x Konzentration. Nachdem die Medikamente Zugabe inkubieren Zellen für 2 h bei 37 ° C. </li><li> Um den NFkB Signalweg aktivieren, fügen Sie die pro-inflammatorischen Zytokins TNF (10 ug / ml Stammlösung) in jede Vertiefung für eine endgültige Konzentration von 10 ng / ml und Inkubation für 4 Stunden. Fügen Sie eine TNFa allein Kontrolle. Saugen Sie das Medium und speichern Sie die Zelles bei -80 ° C. </li><li> Messung der Luciferase eine Luciferase-Reporter-Assay-System nach den Anweisungen des Herstellers. HINWEIS: Wenn die Luciferase Assay System (zB Dual - Luciferase - Assaysystem) zum ersten Mal, um eine Lösung der Luciferase - Assay - Reagens herzustellen , indem man es in 10 ml Puffer erneut suspendiert und bei -80 ° C in 1 ml Aliquoten lagern. <ol><li> Bereiten Sie Puffer 1x Lyse durch 5x Stammpuffer mit Wasser verdünnt wird. Lysieren Zellen in jeder Vertiefung unter Verwendung von 100 &amp; mgr; l 1x Lysepuffer. Inkubiere die Platten auf einem Orbitalschüttler für 15 min, bei mittlerer Geschwindigkeit. </li><li> Beschriften Sie ein 1,5-ml-Röhrchen pro Probe. Thaw Luciferase-Assay-Reagenz auf Raumtemperatur (50 &amp; mgr; l pro Probe werden benötigt) und halten Sie in der Folie. Bereiten 1x Quenching-Reagenz in einem Glasfläschchen, 01.49 Verdünnung in Puffer und vortex es (50 ul pro Probe benötigt werden). </li><li> Zugabe von 10 &amp; mgr; l Zelllysat mit einem markierten Mikrozentrifugenröhrchen. Dann fügen Sie 50 ul Luciferase-Nachweisreagens undsanft Wirbel. Unmittelbar danach wird das Reagenzglas in einem Halter und messen die Lumineszenz über das Dual-Luciferase-Programm im Luminometer. Wählen Sie und drücken Sie die folgenden Schritte aus: Run Promega Protokolle → Dual-Glo → OK. </li><li> Je 50 ul der Quenching-Reagenz in das Teströhrchen und vorsichtig vortexen. Messen Sie die Lumineszenz. Wiederholen Sie diese Schritte für jede Probe. </li><li> Analysieren von Daten unter Verwendung von Tabellenkalkulations durch Normalisierung NFkB-RE an die Renilla interne Kontrolle (NFkB-RE / Renilla). Vergleichen Inhibitor Daten zu TNFa nur Steuerung (TNFa wird nur auf 100% gesetzt). </li></ol></li></ol></li><li> NFkB-Ziel Gentranskription <ol><li> Seed MCF-7-Zellen in 6-Well-Platten bei 250.000 Zellen pro Vertiefung in 2 ml Medium Volumen hergestellt, wie in Abschnitt 2.1 beschrieben. </li><li> Am folgenden Tag, fügen 2 ul verschiedener GTCpFE 1,000x Bestände (100, 50, 20, 10 und 1 mM) für 2 Stunden vor der Zugabe von TNF &amp; agr; 10 ng / ml für weitere 2 Std. Führen Sie jede Behandlungin dreifacher Ausführung. Fügen Sie Fahrzeug und allein Kontrollen TNFa. </li><li> Isolieren RNA das Guanidiniumthiocyanat-Phenol-Chloroform - Extraktionsverfahren unter Verwendung von nach den Anweisungen des Herstellers 22. Bestimmen Sie RNA-Konzentration (in Diethylpyrocarbonat (DEPC) behandeltem Wasser) und RNA-Reinheit mit einem Spektralphotometer. Halten Sie RNA-Proben auf Eis oder bei -80 ° C. Verwenden Sie nur RNase-freie Spitzen Barriere, wenn RNA-Handling. </li><li> Revers transkribieren 0,5 &amp; mgr; g Gesamt-RNA eines kommerziell erhältlichen Kits von Moloney Murine Leukemia Virus (M-MLV) Reverse Transkriptase verwendet wird. HINWEIS: Der Kit enthält 5x Puffer und Dithiothreitol (DTT), zusammen mit dNTP-Mischung und zufälligen Hexameren Mischung. <ol><li> Mit 0,5 &amp; mgr; g RNA auf 200 Einheiten M-MLV, 0,5 mM dNTPs, 100 ng zufälligen Hexameren, 10 mM DTT, 1x Puffer und DEPC-Wasser auf ein endgültiges 10 ul Reaktionsvolumen. Durchführung der reversen Transkriptase-Reaktion eine PCR-Cycler für 50 min bei 37 ° C und dann 15 min bei 70 unter Verwendung von &amp;# 176; C, um das Enzym zu inaktivieren wärme. </li></ol></li><li> Verdünne die resultierende cDNA Produkt auf 100 ul mit doppelt destilliertem Wasser und mit 2 &amp; mgr; l für jede nachfolgende quantitative Polymerase-Kettenreaktion (PCR) -Reaktion. <ol><li> Mix Vorwärts- und Rückwärts-Primer, die für das Gen von Interesse bei 1,25 &amp; mgr; M Konzentration jeder. Vorbereiten eines Master-Mix mit 2 &amp; mgr; l doppelt destilliertem Wasser, 1 &amp; mgr; l 1,25 &amp; mgr; M Primer-Mix und 5 ul 2x des Farbstoffes Erkennung der doppelsträngigen DNA zu ermöglichen. Legen Sie die 2 ul cDNA und 8 ul Master-Mix in 96-Well-PCR-Platten. </li></ol></li><li> Führen Sie die quantitative PCR eine Echtzeit-PCR-System (40 Zyklen, 95-60 ° C) entsprechend den Anweisungen des Herstellers und die Daten manuell analysieren. HINWEIS: Alle verwendeten PCR - Primer wurden validiert und zuvor 23 berichtet. </li><li> Berechnen Genexpression fache Veränderung über die ΔΔCt Methode unter Verwendung von Tabellenkalkulationsprogramm, mit ribosomale Protein 36B4 mRNA als interne Kontrolle dienen 23. </li></ol></li></ol> 3. GTCpFE Hemmt Brustkrebs-Stammzellen in vitro <ol><li> Mammosphere Formation Assay <ol><li> Bereiten mammosphere (MS) -Medium von Dulbeccos modifiziertem Eagle Medium ergänzt: Nutrient Mixture F-12 (DMEM / F12) Phenolrot-freiem Medium mit 1% Methylcellulose. Nach dem Auflösen von sanft über Nacht bei 4 ° C schütteln. Filter sterilisieren, das Medium und Ergänzung mit B27 1x, 1% Penicillin und Streptomycin, 5 ug / ml Insulin, 1 &amp; mgr; g / ml Hydrocortison und 20 ng / ml rekombinantem humanen epidermalen Wachstumsfaktor. </li><li> Bereiten Sie einzelne Zellen von MDA-MB-231 Zelllinie durch Verdauung Trypsin (Trypsin 0,25% für 5 min bei 37 ° C) von Monolayer-Kulturen und filtriert durch die Siebe. zählen manuell einzelne dissoziierten Zellen und die Platte in 96-Well-Ultra-Low-Befestigungsplatten bei einer Dichte von 400 Zellen / Vertiefung. Am nächsten Tag, fügen verschiedene Konzentrationen von AEBFE (beispielsweise endgültige GTCpFE Konzentrationen: 1, 10, 20, 50 &amp; mgr; M) bis zu einem Endvolumen von 100 &amp; mgr; l. jede Behandlung in dreifacher Ausführung durchführen. </li><li> Nach 7 Tagen Kultur im Inkubator, erwerben Bilder über eine Imaging-Software ein umgekehrtes Mikroskop. zählen manuell die Anzahl MS&gt; 75 &amp; mgr; m im Durchmesser. Vergleichen Sie die medikamentöse Behandlung zur Fahrzeugsteuerung. HINWEIS: Der Durchmesser der MS&gt; 75 &amp; mgr; m bestimmt wird, um die Imaging-Software. </li></ol></li><li> CD44 + CD24 - CSC Immunophänotyp <ol><li> Trypsinize MDA-MB-231-Zellen mit 0,25% Trypsin für 5 min bei 37 ° C. Graf mit einem Hämozytometer und Samen in 10 cm-Schalen auf 3 Millionen Zellen pro Schale in 10 ml Medium, wie in Abschnitt 2.1 beschrieben. In Fahrzeug (10 &amp; mgr; l Dimethylsulfoxid) oder GTCpFE (10 &amp; mgr; l von 50 mM Lager) zu den Zellen für 72 Stunden. </li><li> Für Fahrzeug oder GTCpFE Behandlungsgruppen, trypsinize Zellen (wie in Schritt 3.2.1) und zu verteilen 1 Million Zellen in &quot;Test &amp; #39; oder &#39;Control&#39; 5 ml Polystyrolröhrchen, das 2 ml 1x Hanks Balanced Salt Solution (HBSS) Puffer mit 2% FBS supplementiert. </li><li> Zum Anfärben für den Oberflächenmarker CD44 und CD24, Spin Zellen nach unten und füge 20 ul jeder konjugierten Antikörper und HBSS + 2% FBS Röhrchen für eine endgültige 100 &amp; mgr; l Gesamtvolumen in Test (1: 5-Verdünnung). 100 l HBSS + 2% FBS Rohre zu steuern. Fügen Sie CD44-APC konjugierte Antikörper und CD24-PE Antikörper einzigen Fleck Kontrollen oder die IgG immunoisotype Kontrollen. </li><li> Inkubiere Zellen im Dunkeln bei 4 ° C für 30 min. Spin-down Zellen 5 min bei 400 xg und Rekonstitution in 200 &amp; mgr; l HBSS-Puffer mit 2% FBS. Halten Zellen auf Eis in der Dunkelheit. </li><li> Führen fluoreszenzaktivierte Zellsortierung (FACS) von lebenden Zellen eines FACS-Analysator Instrument gemäß den Anweisungen des Herstellers. Sammeln Sie mindestens 50.000 Veranstaltungen für jedes Röhrchen. Führen Sie Behandlungen in dreifacher Ausfertigung. HINWEIS: Gating basiert auf Kontrollen von keiner Färbung (Control Rohr), IgG immunoisotypes und die CD44-APC und CD24-PE einzelne Flecken. </li><li> Analysieren Sie Daten ein verfügbares Durchflusszytometrie-Software. HINWEIS: Der prozentuale Anteil der GTCpFE behandelten Zelle mit dem CD44 + CD24 - Immunophänotyp wird geschätzt , und im Vergleich zu Fahrzeugsteuerung. </li></ol></li></ol>

<ol>
	<li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Cuzick, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspirin+and+non-steroidal+anti-inflammatory+drugs+for+cancer+prevention:+an+international+consensus+statement.">Aspirin and non-steroidal anti-inflammatory drugs for cancer prevention: an international consensus statement.</a> Lancet Oncol. 10, 501-507 (2009).</li><li>Terry, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+frequency+and+duration+of+aspirin+use+and+hormone+receptor+status+with+breast+cancer+risk.">Association of frequency and duration of aspirin use and hormone receptor status with breast cancer risk.</a> JAMA. 291, 2433-2440 (2004).</li><li>Wang, D., Dubois, R. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cyclooxygenase-2:+a+potential+target+in+breast+cancer.">Cyclooxygenase-2: a potential target in breast cancer.</a> Semin Oncol. 31, 64-73 (2004).</li><li>Howe, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammation+and+breast+cancer.+Cyclooxygenase/prostaglandin+signaling+and+breast+cancer.">Inflammation and breast cancer. Cyclooxygenase/prostaglandin signaling and breast cancer.</a> Breast Cancer Res. 9. 9, 210 (2007).</li><li>Kopp, E., Ghosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+NF-kappa+B+by+sodium+salicylate+and+aspirin.">Inhibition of NF-kappa B by sodium salicylate and aspirin.</a> Science. 265, 956-959 (1994).</li><li>Yin, M. J., Yamamoto, Y., Gaynor, R. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+anti-inflammatory+agents+aspirin+and+salicylate+inhibit+the+activity+of+I(kappa)B+kinase-beta.">The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta.</a> Nature. 396, 77-80 (1998).</li><li>Pierce, J. W., Read, M. A., Ding, H., Luscinskas, F. W., Collins, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salicylates+inhibit+I+kappa+B-alpha+phosphorylation,+endothelial-leukocyte+adhesion+molecule+expression,+and+neutrophil+transmigration.">Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration.</a> J Immunol. 156, 3961-3969 (1996).</li><li>Frasor, J., El-Shennawy, L., Stender, J. D., Kastrati, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NFkappaB+affects+estrogen+receptor+expression+and+activity+in+breast+cancer+through+multiple+mechanisms.">NFkappaB affects estrogen receptor expression and activity in breast cancer through multiple mechanisms.</a> Mol Cell Endocrinol. 418, 235-239 (2014).</li><li>Perkins, N. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+diverse+and+complex+roles+of+NF-kappaB+subunits+in+cancer.">The diverse and complex roles of NF-kappaB subunits in cancer.</a> Nat Rev Cancer. 12, 121-132 (2012).</li><li>DiDonato, J. A., Mercurio, F., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NF-kappaB+and+the+link+between+inflammation+and+cancer.">NF-kappaB and the link between inflammation and cancer.</a> Immunol Rev. 246, 379-400 (2012).</li><li>Scarpignato, C., Hunt, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonsteroidal+antiinflammatory+drug-related+injury+to+the+gastrointestinal+tract:+clinical+picture,+pathogenesis,+and+prevention.">Nonsteroidal antiinflammatory drug-related injury to the gastrointestinal tract: clinical picture, pathogenesis, and prevention.</a> Gastroenterol Clin North Am. 39, 433-464 (2010).</li><li>Sostres, C., Gargallo, C. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastrointestinal+lesions+and+complications+of+low-dose+aspirin+in+the+gastrointestinal+tract.">Gastrointestinal lesions and complications of low-dose aspirin in the gastrointestinal tract.</a> Best Pract Res Clin Gastroenterol. 26, 141-151 (2012).</li><li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethyl+Fumarate+Inhibits+the+Nuclear+Factor+kappaB+Pathway+in+Breast+Cancer+Cells+by+Covalent+Modification+of+p65+Protein.">Dimethyl Fumarate Inhibits the Nuclear Factor kappaB Pathway in Breast Cancer Cells by Covalent Modification of p65 Protein.</a> J Biol Chem. 291, 3639-3647 (2016).</li><li>Kastrati, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+aspirin+prodrug+inhibits+NFkappaB+activity+and+breast+cancer+stem+cell+properties.">A novel aspirin prodrug inhibits NFkappaB activity and breast cancer stem cell properties.</a> BMC Cancer. 15, 845 (2015).</li><li>Cao, Y., Luo, J. L., Karin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IkappaB+kinase+alpha+kinase+activity+is+required+for+self-renewal+of+ErbB2/Her2-transformed+mammary+tumor-initiating+cells.">IkappaB kinase alpha kinase activity is required for self-renewal of ErbB2/Her2-transformed mammary tumor-initiating cells.</a> Proc Natl Acad Sci U S A. 104, 15852-15857 (2007).</li><li>Liu, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+canonical+NF-kappaB+pathway+governs+mammary+tumorigenesis+in+transgenic+mice+and+tumor+stem+cell+expansion.">The canonical NF-kappaB pathway governs mammary tumorigenesis in transgenic mice and tumor stem cell expansion.</a> Cancer Res. 70, 10464-10473 (2010).</li><li>Korkaya, H., Liu, S., Wicha, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+cancer+stem+cells+by+cytokine+networks:+attacking+cancer's+inflammatory+roots.">Regulation of cancer stem cells by cytokine networks: attacking cancer's inflammatory roots.</a> Clin Cancer Res. 17, 6125-6129 (2011).</li><li>Hinohara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ErbB+receptor+tyrosine+kinase/NF-kappaB+signaling+controls+mammosphere+formation+in+human+breast+cancer.">ErbB receptor tyrosine kinase/NF-kappaB signaling controls mammosphere formation in human breast cancer.</a> Proc Natl Acad Sci U S A. 109, 6584-6589 (2012).</li><li>Kendellen, M. F., Bradford, J. W., Lawrence, C. L., Clark, K. S., Baldwin, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Canonical+and+non-canonical+NF-kappaB+signaling+promotes+breast+cancer+tumor-initiating+cells.">Canonical and non-canonical NF-kappaB signaling promotes breast cancer tumor-initiating cells.</a> Oncogene. 33, 1297-1305 (2014).</li><li>Yamamoto, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NF-kappaB+non-cell-autonomously+regulates+cancer+stem+cell+populations+in+the+basal-like+breast+cancer+subtype.">NF-kappaB non-cell-autonomously regulates cancer stem cell populations in the basal-like breast cancer subtype.</a> Nat Commun. 4, 2299 (2013).</li><li>Rio, D. C., Ares, M., Hannon, G. J., Nilsen, T. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+RNA+using+TRIzol+(TRI+reagent).">Purification of RNA using TRIzol (TRI reagent).</a> Cold Spring Harb Protoc. , (2010).</li><li>Frasor, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Positive+cross-talk+between+estrogen+receptor+and+NF-kappaB+in+breast+cancer.">Positive cross-talk between estrogen receptor and NF-kappaB in breast cancer.</a> Cancer Res. 69, 8918-8925 (2009).</li><li>Al-Hajj, M., Wicha, M. S., Benito-Hernandez, A., Morrison, S. J., Clarke, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+identification+of+tumorigenic+breast+cancer+cells.">Prospective identification of tumorigenic breast cancer cells.</a> Proc Natl Acad Sci U S A. 100, 3983-3988 (2003).</li><li>Vandermeeren, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+is+an+inhibitor+of+cytokine-induced+nuclear+translocation+of+NF-kappa+B1,+but+not+RelA+in+normal+human+dermal+fibroblast+cells.">Dimethylfumarate is an inhibitor of cytokine-induced nuclear translocation of NF-kappa B1, but not RelA in normal human dermal fibroblast cells.</a> J Invest Dermatol. 116, 124-130 (2001).</li><li>Loewe, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+TNF-induced+nuclear+entry+of+NF-kappa+B/p65+in+human+endothelial+cells.">Dimethylfumarate inhibits TNF-induced nuclear entry of NF-kappa B/p65 in human endothelial cells.</a> J Immunol. 168, 4781-4787 (2002).</li><li>Seidel, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+NF-{kappa}B+function+at+multiple+levels+to+limit+airway+smooth+muscle+cell+cytokine+secretion.">Dimethylfumarate inhibits NF-{kappa}B function at multiple levels to limit airway smooth muscle cell cytokine secretion.</a> Am J Physiol Lung Cell Mol Physiol. 297, L326-L339 (2009).</li><li>Wilms, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethylfumarate+inhibits+microglial+and+astrocytic+inflammation+by+suppressing+the+synthesis+of+nitric+oxide,+IL-1beta,+TNF-alpha+and+IL-6+in+an+in-vitro+model+of+brain+inflammation.">Dimethylfumarate inhibits microglial and astrocytic inflammation by suppressing the synthesis of nitric oxide, IL-1beta, TNF-alpha and IL-6 in an in-vitro model of brain inflammation.</a> J Neuroinflammation. 7, 30 (2010).</li><li>Peng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimethyl+fumarate+inhibits+dendritic+cell+maturation+via+nuclear+factor+kappaB+(NF-kappaB)+and+extracellular+signal-regulated+kinase+1+and+2+(ERK1/2)+and+mitogen+stress-activated+kinase+1+(MSK1)+signaling.">Dimethyl fumarate inhibits dendritic cell maturation via nuclear factor kappaB (NF-kappaB) and extracellular signal-regulated kinase 1 and 2 (ERK1/2) and mitogen stress-activated kinase 1 (MSK1) signaling.</a> J Biol Chem. 287, 28017-28026 (2012).</li><li>Li, H. J., Reinhardt, F., Herschman, H. R., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer-stimulated+mesenchymal+stem+cells+create+a+carcinoma+stem+cell+niche+via+prostaglandin+E2+signaling.">Cancer-stimulated mesenchymal stem cells create a carcinoma stem cell niche via prostaglandin E2 signaling.</a> Cancer Discov. 2, 840-855 (2012).</li><li>Li, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+resistance+of+tumorigenic+breast+cancer+cells+to+chemotherapy.">Intrinsic resistance of tumorigenic breast cancer cells to chemotherapy.</a> J Natl Cancer Inst. 100, 672-679 (2008).</li><li>Diehn, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Association+of+reactive+oxygen+species+levels+and+radioresistance+in+cancer+stem+cells.">Association of reactive oxygen species levels and radioresistance in cancer stem cells.</a> Nature. 458, 780-783 (2009).</li><li>Hollier, B. G., Evans, K., Mani, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-to-mesenchymal+transition+and+cancer+stem+cells:+a+coalition+against+cancer+therapies.">The epithelial-to-mesenchymal transition and cancer stem cells: a coalition against cancer therapies.</a> J Mammary Gland Biol Neoplasia. 14, 29-43 (2009).</li><li>Velasco-Velazquez, M. A., Popov, V. M., Lisanti, M. P., Pestell, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+breast+cancer+stem+cells+in+metastasis+and+therapeutic+implications.">The role of breast cancer stem cells in metastasis and therapeutic implications.</a> Am J Pathol. 179, 2-11 (2011).</li><li>Dontu, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+propagation+and+transcriptional+profiling+of+human+mammary+stem/progenitor+cells.">In vitro propagation and transcriptional profiling of human mammary stem/progenitor cells.</a> Genes Dev. 17, 1253-1270 (2003).</li><li>Charafe-Jauffret, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+in+breast:+current+opinion+and+future+challenges.">Cancer stem cells in breast: current opinion and future challenges.</a> Pathobiology. 75, 75-84 (2008).</li><li>Clayton, H., Titley, I., Vivanco, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+differentiation+of+progenitor/stem+cells+derived+from+the+human+mammary+gland.">Growth and differentiation of progenitor/stem cells derived from the human mammary gland.</a> Exp Cell Res. 297, 444-460 (2004).</li><li>Ginestier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ALDH1+is+a+marker+of+normal+and+malignant+human+mammary+stem+cells+and+a+predictor+of+poor+clinical+outcome.">ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome.</a> Cell Stem Cell. 1, 555-567 (2007).</li><li>Rosen, J. M., Jordan, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+increasing+complexity+of+the+cancer+stem+cell+paradigm.">The increasing complexity of the cancer stem cell paradigm.</a> Science. 324, 1670-1673 (2009).</li><li>Visvader, J. E., Lindeman, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+stem+cells+in+solid+tumours:+accumulating+evidence+and+unresolved+questions.">Cancer stem cells in solid tumours: accumulating evidence and unresolved questions.</a> Nat Rev Cancer. 8, 755-768 (2008).</li></ol>

The authors have nothing to disclose.

In this protocol, we demonstrated the synthesis of an ASA prodrug, GTCpFE, where the fumarate pharmacophore was incorporated to improve the anti-NF&#312;B activity in breast cancer cells. GTCpFE is an effective NF&#312;B inhibitor, whereas ASA itself is not, even at much higher concentrations. The fumarate moiety has anti-inflammatory properties as shown by its ability to inhibit NF&#312;B signaling in a variety of cell lines and tissues14,25-29. The prodrug strategy described herein, is amendable to other mal...

Die Entzündung ist ein Markenzeichen , die mehrere Aspekte der Tumorentstehung, wie Häufigkeit und Förderung, und schließlich Progression zur Metastasierung 1 zugrunde liegt. Bei Brustkrebs wird diese weiter durch epidemiologische Beobachtungen gestützt, dass die regelmäßige Anwendung des klassischen nicht-steroidale entzündungshemmende Medikament Aspirin (Acetylsalicylsäure, ASS) zeigt, die mit einer Senkung sowohl der Brustkrebs-Inzidenz und Risiko von Metastasen und Rezidiv assoziiert ist 2,3. ASA wirkt primär durch Cyclooxygenase-2 - inhibierende Aktivität, die oft in Brustkrebs 4,5 aufreguliert wird. Die Anti-Krebs - Wirkungen von ASA auch durch Unterdrückung aberrant nuclear factor &amp; kgr; B (NFKB) Signalisierungs 6-8 jedoch vermittelt werden kann. Dies ist wichtig , weil eine deregulierte NFKB Stoffwechselweg Überleben von Tumorzellen fördert, Proliferation, Migration, Invasion, Angiogenese und Therapieresistenz 9-11. NFKB Signalweg-Aktivierung ist auch entscheidend für die Montageeiner Immunantwort. Daher ist für Anti-Krebs-Therapie, wo verlängerte NFKB Hemmung erforderlich ist, muß man die nachteiligen Nebenwirkungen beteiligt lang anhaltende Immunsuppression berücksichtigen. Daher kann ASA für therapeutische Optimierung als ein guter Ausgangspunkt dienen. Eine Einschränkung für ASA - Anwendung in der Krebstherapie ist die erhöhte Dosen für Cyclooxygenase 2 erforderlich und NFKB - Hemmung, die mit Magen - Darm - Toxizität assoziiert sind, wie Magengeschwüre und Magen 12,13 Blutungen. Allerdings ASA in als Ester-Prodrug Umwandlung kann ASA Magen-Darm-Toxizität verringern. Zur weiteren Verbesserung der Wirksamkeit und / oder fügen Sie Funktionalität, zusätzliche strukturelle Elemente oder Neben Pharmacophore können auch in Ester-Prodrug-Design integriert werden. Eine solche Pharmakophormodell hinzugefügt ASA Potenz zu verbessern gegen die NFkB Weg Fumarat ist, die wir zuvor für NFkB Signalweg Hemmung 14,15 wichtig zu sein gezeigt. 15, GTCpFE, und die Hypothese aufgestellt , dass eine solche Hybridmolekül noch potent sicher sein würde gegen den NFkB Weg. Wir testeten ihre anti-NFKB - Aktivität in Brustkrebszellen und ihre Fähigkeit , Brustkrebs Stammzellen (KSZ) 15, die auf NFKB Signalgebung für das Überleben und das Wachstum 16-21 verlassen zu blockieren. Wir finden , dass die Wirksamkeit von GTCpFE gegen den NFkB Weg deutlich über ASA 15 verbessert. Darüber hinaus GTCpFE Blöcke mammosphere Bildung und dämpft die Oberflächenmarker CD44 CSC + CD24 - Immunophänotyp, was darauf hinweist , dass GTCpFE fähig ist CSCs auszurotten 15. Diese Ergebnisse stellen die Aspirin-Fumarat Prodrug als ein wirksames entzündungshemmendes Mittel, das auch Brust CSCs ausrichten können. In Bezug auf die Brustkrebstherapie kann GTCpFE das Potenzial haben, aggressive und tödliche Krankheit zu behandeln.

<table border="0" cellpadding="0" cellspacing="0" width="663">
	<tbody>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">RPMI 1640 Red Medium</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">11875-093</td>
			<td style="width:205px;">Warm up to 37&#176;C before use</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">IMEM</td>
			<td style="width:123px;">Corning</td>
			<td style="width:119px;">10-024-CV</td>
			<td style="width:205px;">Warm up to 37&#176;C before use</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">DMEM / F12 Medium</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">21041-025</td>
			<td style="width:205px;">Warm up to 37&#176;C before use</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">MEM NEAA 10mM 100X</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">11140</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Penicillin Streptomycin</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">15140-122</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">L-Glutamine 100X</td>
			<td style="width:123px;">Life Technologies&#160;</td>
			<td style="width:119px;">25030-081</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Insulin</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">I-1882</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Fetal Bovine Serum&#160;</td>
			<td style="width:123px;">Atlanta Biologicals</td>
			<td style="width:119px;">S11150</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Trypsin 2.5% 10X</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">15090046</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Methyl Cellulose</td>
			<td style="width:123px;">Sigma&#160;</td>
			<td style="width:119px;">M0262</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">B27 Supplement 50X</td>
			<td style="width:123px;">Gibco</td>
			<td style="width:119px;">17504-044</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">EGF</td>
			<td style="width:123px;">Gibco</td>
			<td style="width:119px;">PHG0311L</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">NF&#954;B-RE Luciferase Construct&#160;</td>
			<td>Clontech&#160;</td>
			<td style="width:119px;">pGL4.32</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Renilla Luciferase Construct&#160;</td>
			<td style="width:123px;">Promega</td>
			<td style="width:119px;">pGL4.70</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Lipofectamine 2000</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">11668-019</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Dual-Luciferase Reporter Assay&#160;</td>
			<td style="width:123px;">Promega</td>
			<td style="width:119px;">120000032</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">NanoDrop Spectrophotometer</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Eppendorf Mastercycler&#160;</td>
			<td style="width:123px;">Eppendorf</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">StepOne Real Time PCR System</td>
			<td style="width:123px;">Thermo Scientific</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Eclipse Microscope</td>
			<td style="width:123px;">Nikon</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">CyAn ADP Analyzer&#160;</td>
			<td style="width:123px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">QCapture Software</td>
			<td style="width:123px;">QImaging</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">Summit Software</td>
			<td style="width:123px;">Beckman Coulter</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;">GraphPad Software</td>
			<td style="width:123px;">Prism</td>
			<td style="width:119px;"></td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">TRIzol</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">15596-018</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">M-MLV Reverse Transcriptase</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">28025-013</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">100 mM dNTP Set</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">10297-018</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Random Hexamers&#160;</td>
			<td style="width:123px;">Invitrogen</td>
			<td style="width:119px;">48190-011</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Fast SYBR Green Master Mix</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">4385612</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Costar 96W, ultra low attachment&#160;</td>
			<td style="width:123px;">Corning</td>
			<td style="width:119px;">3474</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">HBSS, 1X</td>
			<td style="width:123px;">ThermoFisher</td>
			<td style="width:119px;">14025134</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CD44-APC conjugated antibody&#160;</td>
			<td style="width:123px;">BD Pharmingen</td>
			<td style="width:119px;">560990</td>
			<td style="width:205px;">Store at 4&#176;C, protect from light</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CD24-PE antibody</td>
			<td style="width:123px;">BD Pharmingen</td>
			<td style="width:119px;">560991</td>
			<td style="width:205px;">Store at 4&#176;C, protect from light</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Recombinant Human TNF&#945;</td>
			<td style="width:123px;">Fisher</td>
			<td style="width:119px;">210TA100&#160;</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CCL2 Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">AGAATCACCAGCAGCAAGTGTCC</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">CCL2 Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">TCCTGAACCCACTTCTGCTTGG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">ICAM1 Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">TGACGAAGCCAGAGGTCTCAG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">ICAM1 Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">AGCGTCACCTTGGCTCTAGG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">TNF Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">AAGGGTGACCGACTCAGCG</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">TNF Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">ATCCCAAAGTAGACCTGCCCA</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">36B4 Primer Forward Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">GTGTTCGACAATGGCAGCAT</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">36B4 Primer Reverse Sequence</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">GACACCCTCCAGGAAGCGA</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Sodium Hydroxide</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">S5881-500G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">4-Hydroxybenzyl Alcohol</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">20806-10G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">O-Acetylsalicyloyl Chloride</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">165190-5G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Phosphorous Pentoxide</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">79610-100G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Ethyl Fumaroyl Chloride</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">669695-1G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Sodium Sulfate</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">246980-500G</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">4-Dimethylaminopyridine</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">714844-100ML</td>
			<td style="width:205px;">0.5&#160;M in tetrahydrofuran</td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Triethylamine</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">T0886-100ML</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Toluene</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">244511-100ML</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Ethyl Acetate</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">270989-100ML</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:216px;">Tetrahydrofuran</td>
			<td style="width:123px;">Sigma-Aldrich</td>
			<td style="width:119px;">401757-2L</td>
			<td style="width:205px;"></td>
		</tr>
		<tr height="60">
			<td height="60" style="height:60px;width:216px;">400 MHz FT NMR spectrometer&#160;</td>
			<td style="width:123px;"></td>
			<td style="width:119px;"></td>
			<td style="width:205px;">See Bruker&#8217;s Avance User&#8217;s Manual, version 000822 for details</td>
		</tr>
	</tbody>
</table>

synthesis and characterization of an aspirin-fumarate prodrug that inhibits nf&#954;b activity and breast cancer stem cells

Die Entzündung ist ein Krebs Markenzeichen, die Inzidenz von Krebserkrankungen und Förderung, und schließlich Progression zur Metastasierung zugrunde liegt. Daher ist ein entzündungshemmendes Medikament Zugabe zu Standard-Krebs Regimenter kann der Behandlungserfolg verbessern. Ein solches Medikament, Aspirin (Acetylsalicylsäure, ASA), wurde für die Krebschemoprävention und Antitumoraktivität untersucht. Neben Hemmung haben die Cyclooxygenase 2-Prostaglandin-Achse, ASA Anti-Krebs-Aktivitäten auch auf den Kernfaktor ĸB (NFĸB) Hemmung zugeschrieben worden. Da längere ASA Verwendung kann Magen-Darm-Toxizität verursachen, ein Prodrug Strategie wurde erfolgreich umgesetzt. In diesem Prodrug entwerfen die Carbonsäure von ASA maskiert und zusätzliche Pharmacophore eingebaut werden. Dieses Protokoll beschreibt, wie man ein Aspirin-Fumarat Prodrug synthetisiert, GTCpFE und charakterisiert seine Hemmung der NFĸB Stoffwechselweg in Brustkrebszellen und Abschwächung des Krebsstielartigen richtigenKrawatten, ein wichtiger NFĸB abhängigen Phänotyp. GTCpFE hemmt wirksam die NFĸB Stoffwechselweg in Brustkrebszelllinien, während ASA irgendeine inhibitorische Aktivität fehlt, was darauf hinweist, dass das Hinzufügen Fumarat wesentlich zu ASA Struktur seiner Aktivität beiträgt. Zusätzlich zeigt GTCpFE signifikante Aktivität Stammzellen anti-Krebs durch mammosphere Bildung blockiert und die Krebsstammzellen CD44 + CD24 assoziiert Abschwächen - Immunphänotyp. Diese Ergebnisse schaffen eine tragfähige Strategie verbesserte entzündungshemmende Medikamente zu entwickeln, für die Chemoprävention und Krebstherapie.

In Figur 1 ist die chemische Struktur der Aspirin-Fumarat Prodrug, GTCpFE und ihre Hemmwirkung auf die Zytokinproduktion NFĸB Stoffwechselweg in Brustkrebszellen induziert sind angegeben. GTCpFE hemmt sowohl NFĸB Endpunkte NFĸB-RE - Luciferase - Aktivität (1B) und die Expression von NFĸB Zielgene, wie beispielsweise intercellular adhesion molecule 1 (ICAM1), Chemokine CC Motif Ligand 2 (CCL2) und Tumornekrosefaktor (TNF) (Abbildung 1C)</stro...

Watch this Scientific Journal Video about Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFÃŽÂºB Activity and Breast Cancer Stem Cells at JoVE.com

Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NF&#954;B Activity and Breast Cancer Stem Cells

This procedure will demonstrate how we synthesized and characterized the anti-NF&#954;B and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

Synthese und Charakterisierung eines Aspirin-Fumarat Prodrug, die NFkB-Aktivität hemmt und Brustkrebs-Stammzellen

Inflammation is a cancer hallmark that underlies cancer incidence and promotion, and eventually progression to metastasis. Therefore, adding an ...

synthesis-characterization-an-aspirin-fumarate-prodrug-that-inhibits

Research

JoVE Journal

Cancer Research

12.2K Aufrufe.  University of Illinois at Chicago. This procedure will demonstrate how we synthesized and characterized the anti-NFκB and anti-cancer stem cell activity of an aspirin-fumarate prodrug.

Serie: Synthesis and Characterization of an Aspirin-fumarate Prodrug that Inhibits NFκB Activity and Breast Cancer Stem Cells

Modeling Osteosarcoma Using Li-Fraumeni Syndrome Patient-derived Induced Pluripotent Stem Cells

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including osteosarcoma--one of the most frequent primary non-hematologic malignancies in the childhood and adolescence. Therefore, LFS provides an ideal model to study this malignancy. Taking advantage of iPSC methodologies, LFS-associated osteosarcoma can be successfully modeled by differentiating LFS patient iPSCs to mesenchymal stem cells (MSCs), and then to osteoblasts--the cells of origin for osteosarcomas. These LFS osteoblasts recapitulate oncogenic properties of osteosarcoma, providing an attractive model system for delineating the pathogenesis of osteosarcoma. This manuscript demonstrates a protocol for the generation of iPSCs from LFS patient fibroblasts, differentiation of iPSCs to MSCs, differentiation of MSCs to osteoblasts, and in vivo tumorigenesis using LFS osteoblasts. This iPSC disease model can be extended to identify potential biomarkers or therapeutic targets for LFS-associated osteosarcoma.

Here, we present a protocol for the generation of induced pluripotent Stem Cells (iPSCs) from Li-Fraumeni Syndrome (LFS) patient derived fibroblasts, differentiation of iPSCs via mesenchymal stem cells (MSCs) to osteoblasts, and modeling in vivo tumorigenesis using LFS patient-derived osteoblasts.

Modellierung von Osteosarkom mit Li-Fraumeni-Syndrom, die Patienten abgeleitet induzierten pluripotenten Stammzellen

Li-Fraumeni syndrome (LFS) is an autosomal dominant hereditary cancer disorder. Patients with LFS are predisposed to a various type of tumors, including ...

Forschung

Krebsforschung

Synthesis and Characterization of Placental Chondroitin Sulfate A (plCSA)-Targeting Lipid-Polymer Nanoparticles

An effective cancer therapeutic method reduces and eliminates tumors with minimal systemic toxicity. Actively targeting nanoparticles offer a promising approach to cancer therapy. The glycosaminoglycan placental chondroitin sulfate A (plCSA) is expressed on a wide range of cancer cells and placental trophoblasts, and malarial protein VAR2CSA can specifically bind to plCSA. A reported placental chondroitin sulfate A binding peptide (plCSA-BP), derived from malarial protein VAR2CSA, can also specifically bind to plCSA on cancer cells and placental trophoblasts. Hence, plCSA-BP-conjugated nanoparticles could be used as a tool for targeted drug delivery to human cancers and placental trophoblasts. In this protocol, we describe a method to synthesize plCSA-BP-conjugated lipid-polymer nanoparticles loaded with doxorubicin (plCSA-DNPs); the method consists of a single sonication step and bioconjugate techniques. In addition, several methods for characterizing plCSA-DNPs, including determining their physicochemical properties and cellular uptake by placental choriocarcinoma (JEG3) cells, are described.

Synthesis and Characterization of Placental Chondroitin Sulfate A plCSA-Targeting Lipid-Polymer Nanoparticles

Here, we present a protocol for the synthesis of placental chondroitin sulfate A binding peptide (plCSA-BP)-conjugated lipid-polymer nanoparticles via single-step sonication and bioconjugate techniques. These particles constitute a novel tool for the targeted delivery of therapeutics to most human tumors and placental trophoblasts to treat cancers and placental disorders.

Synthese und Charakterisierung von Plazenta Chondroitin Sulfat (PlCSA) - Targeting Lipid - Polymer Nanopartikel

An effective cancer therapeutic method reduces and eliminates tumors with minimal systemic toxicity. Actively targeting nanoparticles offer a promising ...

Flow Cytometric Detection of Newly-formed Breast Cancer Stem Cell-like Cells After Apoptosis Reversal

Cancer recurrence has long been studied by oncologists while the underlying mechanisms remain unclear. Recently, we and others found that a phenomenon named apoptosis reversal leads to increased tumorigenicity in various cell models under different stimuli. Previous studies have been focused on tracking this process in vitro and in vivo; however, the isolation of real reversed cells has yet to be achieved, which limits our understanding on the consequences of apoptosis reversal. Here, we take advantage of a Caspase-3/7 Green Detection dye to label cells with activated caspases after apoptotic induction. Cells with positive signals are further sorted out by fluorescence-activated cell sorting (FACS) for recovery. Morphological examination under confocal microscopy helps confirm the apoptotic status before FACS. An increase in tumorigenicity can often be attributed to the elevation in the percentage of cancer stem cell (CSC)-like cells. Also, given the heterogeneity of breast cancer, identifying the origin of these CSC-like cells would be critical to cancer treatment. Thus, we prepare breast non-stem cancer cells before triggering apoptosis, isolating caspase-activated cells and performing the apoptosis reversal procedure. Flow cytometry analysis reveals that breast CSC-like cells re-appear in the reversed group, indicating breast CSC-like cells are transited from breast non-stem cancer cells during apoptosis reversal. In summary, this protocol includes the isolation of apoptotic breast cancer cells and detection of changes in CSC percentage in reversed cells by flow cytometry.

Here, we present a protocol to isolate apoptotic breast cancer cells by fluorescence-activated cell sorting and further detect the transition of breast non-stem cancer cells to breast cancer stem cell-like cells after apoptosis reversal by flow cytometry.

Flow durchflusszytometrischen Erkennung von neu gebildeten Stammzellen-wie Brustkrebszellen nach Apoptose Umkehr

Cancer recurrence has long been studied by oncologists while the underlying mechanisms remain unclear. Recently, we and others found that a phenomenon ...

Establishment and Characterization of Three Afatinib-resistant Lung Adenocarcinoma PC-9 Cell Lines Developed with Increasing Doses of Afatinib

Acquired resistance to molecular target inhibitors is a severe problem in cancer therapy. Lung cancer remains the leading cause of cancer-related death in most countries. The discovery of "oncogenic driver mutations," such as epidermal growth factor receptor (EGFR)-activating mutations, and subsequent development of molecular targeted agents of EGFR tyrosine kinase inhibitors (TKIs) (gefitinib, erlotinib, afatinib, dacomitinib, and osimertinib) have dramatically altered lung cancer treatment in recent decades. However, these drugs are still not effective in patients with non-small cell lung cancer (NSCLC) carrying EGFR-activating mutations. Following acquired resistance, the systemic progression of NSCLC remains a significant obstacle in treating patients with EGFR mutation-positive NSCLC. Here, we present a stepwise dose escalation method for establishing three independent acquired afatinib-resistant cell lines from NSCLC PC-9 cells harboring EGFR-activating mutations of 15-base pair deletions in EGFR exon 19. Methods for characterizing the three independent afatinib-resistance cell lines are briefly presented. The acquired resistance mechanisms to EGFR TKIs are heterogeneous. Therefore, multiple cell lines with acquired resistance to EGFR-TKIs must be examined. Ten to twelve months are required to obtain cell lines with acquired resistance using this stepwise dose escalation approach. The discovery of novel acquired resistance mechanisms will contribute to the development of more effective and safe therapeutic strategies.

A method for establishing afatinib-resistance cell lines from lung adenocarcinoma PC-9 cells was developed, and resistant cells were characterized. The resistant cells can be used to investigate epidermal growth factor receptor tyrosine kinase inhibitor-resistance mechanisms, applicable for patients with non-small cell lung cancer.

Etablierung und Charakterisierung von drei Afatinib-resistenten Lungenadenokarzinom PC-9 Zelllinien entwickelt mit zunehmenden Dosen von Afatinib

Acquired resistance to molecular target inhibitors is a severe problem in cancer therapy. Lung cancer remains the leading cause of cancer-related death in ...

Spatial and Temporal Control of Murine Melanoma Initiation from Mutant Melanocyte Stem Cells

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented with increasing depth, the incidence rate of cutaneous melanoma has shown a rapid and continuous increase during recent decades. In order to find effective preventative methods, it is important to understand the early steps of melanoma initiation in the skin. Previous data has demonstrated that follicular melanocyte stem cells (MCSCs) in the adult skin tissues can act as melanoma cells of origin when expressing oncogenic mutations and genetic alterations. Tumorigenesis arising from melanoma-prone MCSCs can be induced when MCSCs transition from a quiescent to active state. This transition in melanoma-prone MCSCs can be promoted by the modulation of either hair follicle stem cells&#39; activity state or through extrinsic environmental factors such as ultraviolet-B (UV-B). These factors can be artificially manipulated in the laboratory by chemical depilation, which causes transition of hair follicle stem cells and MCSCs from a quiescent to active state, and by UV-B exposure using a benchtop light. These methods provide successful spatial and temporal control of cutaneous melanoma initiation in the murine dorsal skin. Therefore, these in vivo model systems will be valuable to define the early steps of cutaneous melanoma initiation and could be used to test potential methods for tumor prevention.

The following procedure describes a method for spatial and temporal control of melanocytic tumor initiation in murine dorsal skin, using a genetically engineered mouse model. This protocol describes macroscopic as well as microscopic cutaneous melanoma initiation.

Räumliche und zeitweilige Kontrolle der Murine Melanom-Initiation aus Mutant Melanocyte Stammzellen

Cutaneous melanoma is well known as the most aggressive skin cancer. Although the risk factors and major genetic alterations continue to be documented ...

Obtaining Cancer Stem Cell Spheres from Gynecological and Breast Cancer Tumors

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and recurrent disease. This population can be identified by surface markers, enzymatic activity and a functional profile. These approaches per se are limited, due to phenotypic heterogeneity and CSC plasticity. Here, we update the sphere-forming protocol to obtain CSC spheres from breast and gynecological cancers, assessing functional properties, CSC markers and protein expression. The spheres are obtained with single-cell seeding at low density in suspension culture, using a semi-solid methylcellulose medium to avoid migration and aggregates. This profitable protocol can be used in cancer cell lines but also in primary tumors. The tridimensional non-adherent suspension culture thought to mimic the tumor microenvironment, particularly the CSC-niche, is supplemented with epidermal growth factor and basic fibroblast growth factor to ensure CSC signaling. Aiming for robust identification of CSC, we propose a complementary approach, combining functional and phenotypic evaluation. Sphere-forming capacity, self-renewal and sphere projection area establish CSC functional properties. Additionally, characterization comprises flow cytometry evaluation of the markers, represented by CD44+/CD24- and CD133, and Western blot, considering ALDH. The presented protocol was also optimized for primary tumor samples, following a sample digestion procedure, useful for translational research.

The aim of this methodology is to identify cancer stem cells (CSC) in cancer cell lines and primary human tumor samples with the sphere-forming protocol, in a robust manner, using functional assays and phenotypic characterization with flow cytometry and Western blot.

Beschaffung von Krebsstammzellkugeln aus gynäkologischen und Brustkrebstumoren

Cancer stem cells (CSC) are a small population with self-renewal and plasticity which are responsible for tumorigenesis, resistance to treatment and ...

Radiosensitivity of Cancer Stem Cells in Lung Cancer Cell Lines

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide clues to overcoming radioresistance. Voltage-gated calcium channel &#945;2&#948;1 subunit isoform 5 has been reported as a marker for radioresistant CSCs in non-small cell lung cancer (NSCLC) cell lines. Using calcium channel &#945;2&#948;1 subunit as an example of a CSC marker, methods to study the radiosensitivity of CSCs in NSCLC cell lines are presented. CSCs are sorted with putative markers by flow cytometry, and the self-renewal capacity of sorted cells is evaluated by sphere formation assay. Colony formation assay, which determines how many cells lose the ability to generate descendants forming the colony after a certain dose of radiation, is then performed to assess the radiosensitivity of sorted cells. This manuscript provides initial steps for studying the radiosensitivity of CSCs, which establishes the basis for further understanding of the underlying mechanisms.

The presence of cancer stem cells have been associated with relapse or poor outcomes after radiotherapy. This manuscript describes the methods to study the radiosensitivity of cancer stem cells in lung cancer cell lines.

Strahlenempfindlichkeit von Krebsstammzellen in Lungenkrebszelllinien

The presence of cancer stem cells (CSCs) has been associated with relapse or poor outcomes after radiotherapy. Studying radioresistant CSCs may provide ...

Differentiation of Mouse Breast Epithelial HC11 and EpH4 Cells

Cadherins play an important role in the regulation of cell differentiation as well as neoplasia. Here we describe the origins and methods of the induction of differentiation of two mouse breast epithelial cell lines, HC11 and EpH4, and their use to study complementary stages of mammary gland development and neoplastic transformation.
The HC11 mouse breast epithelial cell line originated from the mammary gland of a pregnant Balb/c mouse. It differentiates when grown to confluence attached to a plastic Petri dish surface in medium containing fetal calf serum and Hydrocortisone, Insulin and Prolactin (HIP medium). Under these conditions, HC11 cells produce the milk proteins &#946;-casein and whey acidic protein (WAP), similar to lactating mammary epithelial cells, and form rudimentary mammary gland-like structures termed &#34;domes&#34;.
The EpH4 cell line was derived from spontaneously immortalized mouse mammary gland epithelial cells isolated from a pregnant Balb/c mouse. Unlike HC11, EpH4 cells can fully differentiate into spheroids (also called mammospheres) when cultured under three-dimensional (3D) growth conditions in HIP medium. Cells are trypsinized, suspended in a 20% matrix consisting of a mixture of extracellular matrix proteins produced by Engelbreth-Holm-Swarm (EHS) mouse sarcoma cells, plated on top of a layer of concentrated matrix coating a plastic Petri dish or multiwell plate, and covered with a layer of 10% matrix-containing HIP medium. Under these conditions, EpH4 cells form hollow spheroids that exhibit apical-basal polarity, a hollow lumen, and produce &#946;-casein and WAP.
Using these techniques, our results demonstrated that the intensity of the cadherin/Rac signal is critical for the differentiation of HC11 cells. While Rac1 is necessary for differentiation and low levels of activated RacV12 increase differentiation, high RacV12 levels block differentiation while inducing neoplasia. In contrast, EpH4 cells represent an earlier stage in mammary epithelial differentiation, which is inhibited by even low levels of RacV12.

We describe techniques for differentiation induction of two breast epithelial lines, HC11 and EpH4. While both require fetal calf serum, insulin, and prolactin to produce milk proteins, EpH4 cells can fully differentiate into mammospheres in three-dimensional culture. These complementary models are useful for signal transduction studies of differentiation and neoplasia.

Differenzierung von Mausbrustepithel-HC11- und EpH4-Zellen

Cadherins play an important role in the regulation of cell differentiation as well as neoplasia. Here we describe the origins and methods of the induction ...

Studying Triple Negative Breast Cancer Using Orthotopic Breast Cancer Model

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less aggressive breast tumors, the 5-year survival rate of TNBC patients is 77% due to their characteristic drug-resistant phenotype and metastatic burden. Toward this end, murine models have been established aimed at identifying novel therapeutic strategies limiting TNBC tumor growth and metastatic spread. This work describes a practical guide for the TNBC orthotopic model where MDA-MB-231 breast cancer cells suspended in a basement membrane matrix are implanted in the fourth mammary fat pad, which closely mimics the cancer cell behavior in humans. Measurement of tumors by caliper, lung metastasis assessment via in vivo and ex vivo imaging, and molecular detection are discussed. This model provides an excellent platform to study therapeutic efficacy and is especially suitable for the study of the interaction between the primary tumor and distal metastatic sites.

This work presets an advanced protocol to accurately assess tumor loading by detection of green fluorescent protein and bioluminescence signals as well as the integration of quantitative molecular detection technique.

Studieren von dreifach negativem Brustkrebs mit orthotopischem Brustkrebsmodell

Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with limited therapeutic options. When compared to patients with less ...

Orthotopic Transplantation of Breast Tumors as Preclinical Models for Breast Cancer

Preclinical models that faithfully recapitulate tumor heterogeneity and therapeutic response are critical for translational breast cancer research. Immortalized cell lines are easy to grow and genetically modify to study molecular mechanisms, yet the selective pressure from cell culture often leads to genetic and epigenetic alterations over time. Patient-derived xenograft (PDX) models faithfully recapitulate the heterogeneity and drug response of human breast tumors. PDX models exhibit a relatively short latency after orthotopic transplantation that facilitates the investigation of breast tumor biology and drug response. The transplantable genetically engineered mouse models allow the study of breast tumor immunity. The current protocol describes the method to orthotopically transplant breast tumor fragments into the mammary fat pad followed by drug treatments. These preclinical models provide valuable approaches to investigate breast tumor biology, drug response, biomarker discovery and mechanisms of drug resistance.

Patient-derived xenograft (PDX) models and transplantable genetically engineered mouse models faithfully recapitulate human disease and are preferred models for basic and translational breast cancer research. Here, a method is described to orthotopically transplant breast tumor fragments into the mammary fat pad to study tumor biology and evaluate drug response.

Orthotope Transplantation von Brusttumoren als präklinische Modelle für Brustkrebs

Preclinical models that faithfully recapitulate tumor heterogeneity and therapeutic response are critical for translational breast cancer research. ...