Diese Arbeit wurde durch den deutschen Exzellenzinitiative (CellNetworks DFG-EXC 81) und eine Teilfinanzierung durch den Sonderforschungsbereich SFB638 vom deutschen Forschung Rat (DFG) finanziert.

<ol>
	<li>Scott, D. E., Bayly, A. R., Abell, C., Skidmore, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules,+big+targets:+drug+discovery+faces+the+protein-protein+interaction+challenge.">Small molecules, big targets: drug discovery faces the protein-protein interaction challenge.</a> Nat Rev Drug Discov. 15 (8), 533-550 (2016).</li><li>Roux, K. J., Kim, D. I., Raida, M., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+promiscuous+biotin+ligase+fusion+protein+identifies+proximal+and+interacting+proteins+in+mammalian+cells.">A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.</a> J Cell Biol. 196 (6), 801-810 (2012).</li><li>Lam, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+APEX2+for+electron+microscopy+and+proximity+labeling.">Directed evolution of APEX2 for electron microscopy and proximity labeling.</a> Nat Methods. 12 (1), 51-54 (2015).</li><li>Rhee, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+mapping+of+mitochondria+in+living+cells+via+spatially+restricted+enzymatic+tagging.">Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging.</a> Science. 339 (6125), 1328-1331 (2013).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+nuclear+pore+complex+architecture+with+proximity-dependent+biotinylation.">Probing nuclear pore complex architecture with proximity-dependent biotinylation.</a> P Natl Acad Sci USA. 111 (24), E2453-E2461 (2014).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+smaller+biotin+ligase+for+BioID+proximity+labeling.">An improved smaller biotin ligase for BioID proximity labeling.</a> Mol Biol Cell. 27 (8), 1188-1196 (2016).</li><li>Lambert, J. P., Tucholska, M., Go, C., Knight, J. D., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+biotinylation+and+affinity+purification+are+complementary+approaches+for+the+interactome+mapping+of+chromatin-associated+protein+complexes.">Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.</a> J Proteomics. 118, 81-94 (2015).</li><li>Morriswood, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+bilobe+components+in+Trypanosoma+brucei+identified+using+proximity-dependent+biotinylation.">Novel bilobe components in Trypanosoma brucei identified using proximity-dependent biotinylation.</a> Eukaryot Cell. 12 (2), 356-367 (2013).</li><li>Schopp, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID+a+conditional+proteomics+approach+to+monitor+the+composition+of+spatiotemporally+defined+protein+complexes.">Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes.</a> Nat Commun. 8, (2017).</li><li>B&#233;thune, J., Artus-Revel, C. G., Filipowicz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+reveals+successive+steps+leading+to+miRNA-mediated+silencing+in+mammalian+cells.">Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells.</a> EMBO Rep. 13 (8), 716-723 (2012).</li><li>Inoue, H., Nojima, H., Okayama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+efficiency+transformation+of+Escherichia+coli+with+plasmids.">High efficiency transformation of Escherichia coli with plasmids.</a> Gene. 96 (1), 23-28 (1990).</li><li>Weidenfeld, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+expression+of+coding+and+inhibitory+RNAs+from+retargetable+genomic+loci.">Inducible expression of coding and inhibitory RNAs from retargetable genomic loci.</a> Nucleic Acids Res. 37 (7), e50 (2009).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Jonas, S., Izaurralde, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+a+molecular+understanding+of+microRNA-mediated+gene+silencing.">Towards a molecular understanding of microRNA-mediated gene silencing.</a> Nat Rev Genet. 16 (7), 421-433 (2015).</li><li>MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reconstitution+of+the+human+RISC-loading+complex.">In vitro reconstitution of the human RISC-loading complex.</a> P Natl Acad Sci USA. 105 (2), 512-517 (2008).</li><li>Cox, J., Mann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MaxQuant+enables+high+peptide+identification+rates,+individualized+p.p.b.-range+mass+accuracies+and+proteome-wide+protein+quantification.">MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.</a> Nat Biotechnol. 26 (12), 1367-1372 (2008).</li><li>Tyanova, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Perseus+computational+platform+for+comprehensive+analysis+of+(prote)omics+data.">The Perseus computational platform for comprehensive analysis of (prote)omics data.</a> Nat Methods. 13 (9), 731-740 (2016).</li><li>Opitz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+the+Asc1p/Receptor+for+Activated+C+Kinase+1+(RACK1)+Microenvironment+at+the+Head+Region+of+the+40S+Ribosome+with+Quantitative+BioID+in+Yeast.">Capturing the Asc1p/Receptor for Activated C Kinase 1 (RACK1) Microenvironment at the Head Region of the 40S Ribosome with Quantitative BioID in Yeast.</a> Mol Cell Proteomics. 16 (12), 2199-2218 (2017).</li><li>Mackmull, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+nuclear+transport+receptor+cargo+specificity.">Landscape of nuclear transport receptor cargo specificity.</a> Mol Syst Biol. 13 (12), 962 (2017).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioSITe:+A+Method+for+Direct+Detection+and+Quantitation+of+Site-Specific+Biotinylation.">BioSITe: A Method for Direct Detection and Quantitation of Site-Specific Biotinylation.</a> J Proteome Res. , (2017).</li><li>Udeshi, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibodies+to+biotin+enable+large-scale+detection+of+biotinylation+sites+on+proteins.">Antibodies to biotin enable large-scale detection of biotinylation sites on proteins.</a> Nat Methods. 14 (12), 1167-1170 (2017).</li><li>Chapat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-binding+protein+4EHP+effects+translation+silencing+by+microRNAs.">Cap-binding protein 4EHP effects translation silencing by microRNAs.</a> P Natl Acad Sci USA. 114 (21), 5425-5430 (2017).</li><li>Luker, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+regulated+protein-protein+interactions+revealed+with+firefly+luciferase+complementation+imaging+in+cells+and+living+animals.">Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals.</a> P Natl Acad Sci USA. 101 (33), 12288-12293 (2004).</li><li>De Munter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID:+a+proximity+biotinylation+assay+for+dimerization-dependent+protein+interactions.">Split-BioID: a proximity biotinylation assay for dimerization-dependent protein interactions.</a> FEBS Lett. 591 (2), 415-424 (2017).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+fragment+complementation+of+APEX2+for+detection+of+specific+protein-protein+interactions+in+live+cells.">Optimizing the fragment complementation of APEX2 for detection of specific protein-protein interactions in live cells.</a> Sci Rep. 7 (1), 12039 (2017).</li><li>Branon, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+TurboID+for+efficient+proximity+labeling+in+living+cells+and+organisms.">Directed evolution of TurboID for efficient proximity labeling in living cells and organisms.</a> bioRxiv. , (2017).</li></ol>

Die Autoren haben nichts preisgeben.

Das skizzierte Verfahren beschreibt, wie Gene von Interesse in der Split-BioID Klonen Plasmide, wie Interaktion-induzierte biotinylierungen getestet und biotinylierte Proteine für Massenspektrometrie Analyse isolieren. Wir beschreiben hier die Prozedur beruht auf Transiente Transfektion. Während der Ausdruck die Fusionsproteine um den Betrag der Dox hinzugefügt, um das Medium angepasst werden kann, kann Transiente Transfektion zu inhomogenen Proteinexpression mit einigen Zellen führen, die grob die Fusionsproteine im Vergleich zu den endogenen overexpress Pendants. Dies kann zu Verzerrungen des entsprechenden Interactomes und PPI, die nicht treu die Interaktionen widerspiegeln, die die körpereigene Proteine beinhalten. Es empfiehlt sich also in der Regel zu stabilen Zelllinien zu konstruieren, nach Split-BioID mit dem transient System etabliert hat. Plasmide sind kompatibel mit dem Flp-vermittelten Rekombinationssystem und legen beide Gene von Interesse im Rahmen der Verordnung des gleichen Tet-responsive Elements. Bei Bedarf und bei Verwendung mit kompatiblen Säugerzellen, ermöglichen sie die einfache Erstellung von stabil induzierbaren Zelllinien. Zum Beispiel verwenden wir die HeLa-EM2-11-Linie, die drückt den RtTA Tetracyclin-aktivierte Transkription Aktivator und eine einzigartige Aktionsleisten genomischen Locus aus dem Tetracyclin-vermittelten Genexpression streng regulierte12sein kann. Mit dieser Zelllinie und Flp-vermittelten Rekombination, stabilen Zelllinien, die nur eine Kopie des Transgens enthalten innerhalb von zwei bis drei Wochen erhalten. Alternativ könnte man auch aktuelle Genom Schnitttechniken verwenden, einzuführen die BirA * Fragmente in den nativen genomic Loci der Gene von Interesse.
Wie in jedem Assay, das Tagging ein Protein angewiesen ist, muss man prüfen, ob die resultierende Fusionsproteine funktionsfähig sind. Verfügbare Daten in die interessierenden Proteine (z. B. mit GFP für bildgebenden Verfahren) markiert wurden und funktional getestet eignen sich zu entscheiden, ob die BirA * Fragmente werden sollte geklont stromaufwärts oder stromabwärts die Gene von Interesse. Wenn keine solchen Daten verfügbar sind, sollte man N-Terminal Testen oder C-Terminal Tag Proteine in eine funktionelle Assay. Beispielsweise kann die Aktivität der Schmelzverfahren Proteine in einer Zelllinie getestet werden, in denen das körpereigene Protein herausgetrennten und wurde im Vergleich zu Wildtyp. Wenn die Proteine des Interesses beide N und C-terminalen Tags vertragen, sollten beide getestet werden. In der Tat kann die Ausrichtung des Fusionsproteins in BioID Experimente, die Effizienz der Kennzeichnung22beeinflussen. Darüber hinaus haben wir beobachtet, dass wenn ein paar Proteine Split-BioID zuweisen, welche der beiden Proteine, entweder die NBirA angehängt wird * oder CBirA * fragment auch Einfluss die Effizienz der Beschriftung9. In den Split-BioID Plasmiden die 16 Aminosäuren lange Glycin/Serin Reich Linker Kopplung der interessierenden Proteine an die BirA * Fragmente wurden weitere PCA23 entnommen und für uns tätig sind, damit alle interagierenden Proteine haben wir bisher getestet. Allerdings sollte man bedenken, dass einige Protein-Paare mit kürzeren oder längeren Linker besser funktionieren könnte. Der letzte Hinweis wurde ein weiterer Test von Bollen Gruppe24beschrieben. In diesem Assay BirA * an einem anderen Standort (E140/Q141) als bei uns (E256/G257) gliedert. Wir haben beide Split-BioID Aromen Side-by-Side getestet und festgestellt, dass E256/G257, beschrieben in diesem Protokoll zu stärkeren Re-Aktivierung führt, wenn Sie an zwei interagierenden Proteine gekoppelt9.
Ein allgemeiner Nachteil dieser Methode ist die langsame Geschwindigkeit der Beschriftung. 6 bis 24 h Inkubationszeit mit Biotin ist normalerweise notwendig, spürbare biotinylierungen6, die Nutzung dieser Technik zur Untersuchung dynamischer Umbau von Proteinkomplexen ausschließt zu erhalten. Während dieser Assay teilweise diesem Vorbehalt befasst, da es nur aktiviert wird, wenn zwei Proteine interagieren, die langsame Geschwindigkeit der Kennzeichnung schließt seine Verwendung für das Studium als Reaktion auf sehr dynamische Prozesse oder kurzlebige Proteine zu analysieren. Veränderter Peroxidase bekanntermaßen APEX2 fördern effiziente Kennzeichnung der proximalen Proteine innerhalb von 1 min-3. Ein Partnerschafts-und Kooperationsabkommen basierend auf APEX2 könnte so die Grenzen der Kennzeichnung langsame BioID abgeleitet Assays einzugehen. Eine Proof of Principle Studie beschrieben so ein Split-APEX2 Assay25. Obwohl ein Homodimerizing Protein biotinylierte erfolgreich war, bleibt ob der Test auch verwendet werden kann, zu kennzeichnen und identifizieren Proteine, die zusammenbauen, um ein paar der interagierenden Proteine jedoch um nachgewiesen werden. Vor kurzem wurde gerichtete Evolution zur Erstellung TurboID und MiniTurbo, zwei Varianten der BirA * mit verstärkten Aktivität, die viel kürzer Kennzeichnung Zeitfenster, bis zu 10 min26zu ermöglichen. Anpassung der Split-BioID für diese neuen Varianten wird die Verwendung dieser Technik, um ein breiteres Anwendungsfeld weiter ausbauen.

Da die zelluläre Funktionen von Proteinen, die dynamisch, makromolekulare Komplexe durchgeführt werden zusammenbauen, ist die Identifizierung von Protein-Protein-Wechselwirkungen (PPI) eine große Bemühung in der biomedizinischen Forschung. In der Tat PPI sind oft bei Krankheit dereguliert und mögliche Ziele für Therapeutik1vertreten. Die am weitesten verbreitete Methode für die Identifizierung von PPI die Affinität Reinigung (AP) Ansatz in dem ist, nach Lyse der Zelle, ein Protein des Interesses wird speziell auf eine Matrix gereinigt und damit verbundenen Proteine werden anschließend durch Massenspektrometrie identifiziert (MS). AP-MS eine leistungsstarke Ansatz ist, wird in der Regel nicht ausgeführt auf schwerlösliche Proteinkomplexe, sehr flüchtigen Interaktionen oder PPI, die eine intakte subzelluläre Struktur erfordern. Darüber hinaus kann die Interpretation der Daten durch die dynamische Natur der PPI-Netzwerke, kompliziert werden, da ein einziges Protein oft mehrere verschiedene Proteinkomplexe gehört.
Nähe-Kennzeichnung Techniken wie BioID2 oder APEX23,4 wurden vor kurzem entwickelt, um einige der Einschränkungen der AP-MS Ansätze zu beheben. In BioID katalysiert das Enzym BirA * (entspricht eine G115R Variante des Enzyms Wildtyp E. Coli ) die Bildung von labiler Biotinyl-AMP (Bio-AMP), die mit primären Aminen reagieren kann. Im Gegensatz zu der Wildtyp-Enzym, das Bio-AMP in seinem aktiven Zentrum behält, löst BirA * Bio-AMP, so dass ihre Verbreitung auf die benachbarte Umgebung. Daher können beim verschmolzen zu einem Protein des Interesses und in Zellen exprimiert, proximalen Proteine biotinylierte innerhalb einer Schätzung von 10 nm5sein. Diese gekennzeichnet proximalen Proteine werden dann durch Streptavidin Pulldown isoliert und identifiziert durch MS. Im Gegensatz zu AP-MS erfordert BioID Ausdruck ein Fusionsprotein. Es kann also nur an Proteine angewendet werden deren Funktion durch die Kennzeichnung nicht behindert wird. Darüber hinaus die Kennzeichnung ist langsam, in der Regel 6 – 24 h2,6, machen die Erkennung von kurzlebigen Proteine herausfordernd. Jedoch im Vergleich zu AP-MS, BioID-MS bietet mehrere Vorteile: Erstens sein nehmen die Interaktionen in ihrer natürlichen zellulären Umgebung; zweite, beschriftete Proteine anstatt montierten Anlagen sind isoliert nach Lyse der Zelle; Drittens können Streptavidin Pulldowns mit Geruchsstoffen Puffer und harte Wäsche Bedingungen. Daher ist die Methode mehr empfindlich, um vorübergehende oder schwachen Wechselwirkungen7 oder Interaktionen, die auf ein bestimmtes auftreten und schwer zu isolieren, subzelluläre Struktur8.
Die meisten Proteine sind jedoch in der Regel Teil des größeren komplexen, die umgestalten können, laut zelluläre Signale oder die Funktion, die ausgeführt werden muss. Ein einziges Protein gehört daher in der Regel mehrere komplexe, entsprechend unterschiedlichen Funktionseinheiten, an denen unterschiedliche und/oder überlappende PPI. Beide Ansätze geben einen Überblick über alle Vereine, die ein gegebenes Protein haben kann, doch sie scheitern an den Kontext der einzelnen PPI. Um die Auflösung des letzteren zu erhöhen, haben wir einen PROTEINFRAGMENTE Ergänzung Assay (PCA) entwickelt, in welche zwei inaktive Fragmente von BirA * (NBirA *, die die katalytische Domäne enthält, und CBirA *, die wie die Re-Aktivierung-Domäne angezeigt werden können) können wieder in ein aktives Enzym, wenn in der Nähe von zwei brachte Interaktion Proteine9. Die daraus resultierende Split-BioID Assay Nähe-abhängige biotinylierungen konzentriert sich auf Proteine, die um ein paar der interagierenden Proteine versammeln und somit ermöglicht die Identifikation von Kontext abhängige Protein Baugruppen. Wir demonstriert vor kurzem die herausragende Auflösung macht der Split-BioID durch Lösen von zwei verschiedene Proteinkomplexe der MiRNA-vermittelten gen-silencing Weg9beteiligt.
Insgesamt kann in einem einheitlichen und einfachen Assay Split-BioID entdecken und speziell definierten funktionalen Einheiten, in denen ein gegebenen Proteins beteiligt, sofern eine zusätzliche interagierenden Proteins des entsprechenden Proteins komplexe bekannt ist, PPI zuweisen.

<table><tbody><tr><td>Acetic acid (glacial)</td><td>VWR</td><td>20104.298</td><td>To make TAE buffer</td></tr><tr><td>Agarose</td><td>Sigma</td><td>A9539</td><td>Take TAE-agarose gels for DNA analysis and extraction</td></tr><tr><td>Ammonia solution 25% NH&lt;sub&gt;3&lt;/sub&gt;</td><td>Bernd Kraft</td><td>6012</td><td>To dissolve biotin</td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9518</td><td>To select transformed bacteria</td></tr><tr><td>Bioruptor plus sonification device</td><td>Diagenode</td><td>B01020001</td><td>Other sonification devices are also ok</td></tr><tr><td>Biotin</td><td>Sigma</td><td>B4639</td><td>To be added to the growth medium to stimulate efficient biotinylation</td></tr><tr><td>Bovine serum albumin fraction V</td><td>Carl Roth</td><td>8076</td><td>Used in Western blot buffers and a protein standard in Bradford assays</td></tr><tr><td>Bradford Ultra reagent</td><td>Expedeon</td><td>BFU05L</td><td>Any other method/kit for protein determination is fine, this particular reagent is more tolerant to detergent than other Bradford reagents</td></tr><tr><td>Cell scrappers</td><td>TPP</td><td>99002</td><td>Any other model is also fine</td></tr><tr><td>ClaI</td><td>New England Biolabs</td><td>R0197</td><td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td></tr><tr><td>DMEM medium</td><td>Sigma</td><td>D6046</td><td>If using another cell line, use the corresponding optimal growth medium</td></tr><tr><td>DNA miniprep kit</td><td>Sigma</td><td>PLN350</td><td>Any other kit is also fine</td></tr><tr><td>Doxycycline</td><td>Applichem</td><td>A2951</td><td>Dox is light sensitive</td></tr><tr><td>DTT</td><td>Applichem</td><td>A2948</td><td>Make 1M stock solution, store at -20 &amp;deg;C and always use fresh</td></tr><tr><td>DyLight 680-conjugated streptavidin</td><td>Thermo scientific</td><td>21848</td><td>to use with a LiCor Western blot scanning device</td></tr><tr><td>Dynabeads MyOne Streptavidin C1</td><td>Invitrogen</td><td>65002</td><td>The C1 beads are not BSA coated which is preferable for downstream MS applications (no leakthrough of BSA in the final elution)</td></tr><tr><td>EDTA</td><td>Applichem</td><td>A5097</td><td>Make a 500 mM stock, adjust pH to 8 while dissolving the EDTA powder</td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205</td><td>Make a 70% stock solution in which Doxycycline can be dissolved at 10 mg.mL&lt;sup&gt;-1&lt;/sup&gt;</td></tr><tr><td>Fastgene Gel/PCR DNA Extraction Kit</td><td>Nippon Genetics</td><td>FG-91302</td><td>Any other kit is also fine</td></tr><tr><td>HCl 37%</td><td>Merck</td><td>1.00317.1000</td><td>To adjust pH of biotin stock solution</td></tr><tr><td>HEPES</td><td>Carl Roth</td><td>6763</td><td>Make a 500 mM stock solution, adjust the pH to 7.4</td></tr><tr><td>Immobilon-FL PVDF membrane, 0.45&amp;nbsp;&amp;micro;m</td><td>Millipore</td><td>IPFL00010</td><td>This membrane shows minimal autofluorescence when used with a LiCor Western blot scanning device</td></tr><tr><td>LiCl</td><td>Gr&amp;uuml;ssing GmbH</td><td>12083</td><td>Make a 5M stock solution</td></tr><tr><td>Odyssey CLx imaging system</td><td>LI-COR</td><td>N/A</td><td>To scan Western blot membrane decorated with fluorophore-labeled antibody</td></tr><tr><td>Linear polyethylenimine (PEI)</td><td>Polysciences</td><td>23966-2</td><td>Any other transfection reagent is also fine</td></tr><tr><td>Milk powder</td><td>Carl Roth</td><td>T145</td><td>To block Western blot membranes</td></tr><tr><td>MluI-HF</td><td>New England Biolabs</td><td>R3198</td><td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td></tr><tr><td>Na-deoxycholate</td><td>Sigma</td><td>30970</td><td>Make a 10% (w/v) stock solution</td></tr><tr><td>NaCl</td><td>Sigma</td><td>31434</td><td>Make a 5M stock solution</td></tr><tr><td>NP-40 (Nonidet P40 substitute)</td><td>Sigma</td><td>74385</td><td>Make a 20% (v/v) stock solution</td></tr><tr><td>PacI</td><td>New England Biolabs</td><td>R0547</td><td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td></tr><tr><td>Phosphate buffer saline (PBS)</td><td>Sigma</td><td>806552</td><td>To wash cells before scrapping</td></tr><tr><td>PmeI</td><td>New England Biolabs</td><td>R0560</td><td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td></tr><tr><td>Protease inhibitor cocktail</td><td>Roche</td><td>4693132001</td><td>Added to the lysis buffer to prevent protein degradation</td></tr><tr><td>pSF3-Flag-CBir-FRB_Myc-NBir-FKBP</td><td>Addgene</td><td>90003</td><td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-CBir-FRB_FKBP-Myc-Nbir</td><td>Addgene</td><td>90004</td><td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP</td><td>Addgene</td><td>90008</td><td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir</td><td>Addgene</td><td>90009</td><td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>Q5 High-Fidelity PCR kit</td><td>New England Biolabs</td><td>E0555S</td><td>To amplify the ORF coding for the proteins to be tested. Any other thermostable DNA polymerase is fine.</td></tr><tr><td>Quick ligation kit</td><td>New England Biolabs</td><td>M2200S</td><td>To ligate DNA fragments into the split-BioID plasmids, any other DNA ligation system is fine.</td></tr><tr><td>RunBlue 4-20% SDS precast gels</td><td>Expedeon</td><td>BCG42012</td><td>To use when running samples for MS analysis</td></tr><tr><td>RunBlue LDS Sample Buffer</td><td>Expedeon</td><td>NXB31010</td><td>Running buffer for the RunBlue precast gels</td></tr><tr><td>SDS</td><td>Sigma</td><td>5030</td><td>Comes as a 20% stock solution</td></tr><tr><td>tet-free serum</td><td>Biowest</td><td>S181T</td><td>we use tet-free serum to minimize basal expression of the fusion proteins</td></tr><tr><td>Trans-Blot Turbo Transfer system</td><td>Bio-Rad</td><td>1704150</td><td>High speed Western blotting transfer system, any other transfer system is also fine</td></tr><tr><td>Tris</td><td>Carl Roth</td><td>4855</td><td>Make 1M stock solutions with adequate pH (7.4 and 8)</td></tr><tr><td>Triton X-100</td><td>Applichem</td><td>A4975</td><td>Make a 20% (v/v) stock solution</td></tr><tr><td>Tween-20</td><td>Carl Roth</td><td>9127</td><td>Used in Western blot buffers, Tween 20 leads to high background fluorescence and should be omitted in the blocking and last wash step</td></tr></tbody></table>

split-bioid &#8212; proteomic analysis of context-specific protein complexes in their native cellular environment

Ergänzend zur bestehenden Affinitätsreinigung (AP) nähert sich zur Identifizierung von Protein-Protein-Wechselwirkungen (PPI), Enzyme wurden eingeführt, die es ermöglichen die Nähe-abhängige Kennzeichnung der Proteine in lebenden Zellen. Ein solches Enzym, BirA * (verwendet in der BioID Ansatz), vermittelt die biotinylierungen der Proteine in einem Umkreis von ca. 10 nm. Daher können als zu einem Protein des Interesses verschmolzen und in Zellen exprimiert, die Kennzeichnung der proximalen Proteine in ihrer natürlichen Umgebung. Im Gegensatz zu AP, das stützt sich auf die Reinigung des montierten Proteinkomplexe, erkennt BioID Proteine, die gekennzeichnet worden sind, in den Zellen unabhängig davon, ob sie noch mit dem Protein von Interesse interagieren Wenn sie isoliert sind. Da es Biotinylates proximalen Proteine, man kann außerdem kapitalisieren die außergewöhnliche Affinität von Streptavidin für Biotin um sie sehr effizient zu isolieren. Während BioID besser als AP für identifizierende Transient oder schwachen Wechselwirkungen führt, bieten beide AP und BioID Mass Spectrometry Ansätze einen Überblick über alle möglichen Interaktionen, die ein gegebenes Protein haben kann. Jedoch bieten sie keine Informationen über den Kontext der einzelnen identifizierten PPI. In der Tat sind die meisten Proteine in der Regel Bestandteil mehrere komplexe, entsprechend unterschiedliche Reifung Schritte oder verschiedenen Funktionseinheiten. Um diese gemeinsamen Begrenzung beider Methoden zu lösen, haben wir einen PROTEINFRAGMENTE Ergänzung Assay basiert auf dem BirA * Enzym entwickelt. In diesem Test können zwei inaktive Fragmente von BirA * wieder zusammenbauen, in ein aktives Enzym, wenn in der Nähe von zwei interagierenden Proteine gebracht, die sie verschmolzen sind. Der daraus resultierende Split-BioID Test ermöglicht die Kennzeichnung der Proteine, die um ein paar der interagierenden Proteine zu montieren. Sofern diese beiden nur in einem bestimmten Kontext interagieren, ermöglicht Split-BioID dann die Analyse der spezifischen Kontext-abhängige Funktionseinheiten in ihrer natürlichen zellulären Umgebung. Hier bieten wir eine Schritt für Schritt-Protokoll zu testen und ein paar von interagierenden Proteine Split-BioID zuweisen.

Um zu veranschaulichen, wie diese Methode funktioniert, die open Reading Frames (ORFs) der Proteine Ago2, waren TNRC6C und Dicer (alle Beteiligten in der MiRNA-vermittelten gen-silencing Weg) in Split-BioID Plasmiden geklont. Ago2 ist bekannt, in einem MiRNA-induzierte stummschaltungs-Komplex (MiRISC), die Übersetzung unterdrückt mit TNRC6C interagieren und Zerfall des Ziels mRNAs14zu stimulieren. Vor dem montieren der MiRISC, Ago2 interagieren mit Dicer, das Enzym, das produziert Reifen MiRNAs, in einem Komplex, in dem es mit einem MiRNA15geladen werden kann. Daher wurde Split-BioID Ago2/Dicer Paar oder das Ago2/TNRC6C paar angewendet. Für jedes Paar von geprüften Proteinen war Ago2 entweder mit NBirA * oder CBirA * über unsere Split-BioID Plasmide (Abbildung 2) verschmolzen und Dicer und TNRC6C zu den entsprechenden cognate BirA * fragment. Darüber hinaus war jedes Protein mit CBirA * verschmolzen und gepaart mit einer NBirA *-GFP Fusion als Negativkontrolle. Dies führt zu testen vier Iterationen für jedes Paar von getesteten Protein (Tabelle 1).
Um zu testen ob Split-BioID auf das Zusammenspiel der beiden getesteten Proteine aktiviert ist, folgten wir das Schema in Abbildung 1dargestellt. Die Plasmide wurden vorübergehend in einer Tet-System kompatibel HeLa Zelllinie transfiziert. Der Ausdruck der Fusionsproteine mit Doxycyclin (Dox) induziert wurde und biotinylierungen wurde angeregt, indem das Wachstumsmedium überschüssiges Biotin hinzufügen. Nach einer Inkubationszeit von 20 h mit Dox und Biotin wurden Zellen lysiert und analysiert durch westliche Beflecken mit konjugierten Streptavidin biotinylierte Proteine erkennen. In Säugetierzellen zwei großen Bands werden in der Regel von der konjugierten Streptavidin im untransfected Beispiel (Abbildung 3, Sterne) erkannt und endogen biotinylierte Proteine (höchstwahrscheinlich mitochondriale Carboxylases) entsprechen. Diese beiden Bands sind vorhanden in allen Proben und können bequem als interne Belastung Steuerelemente verwendet werden, also die Erkennung eines Housekeeping Proteins, das Laden der gleichen Protein-Mengen zu kontrollieren ist überflüssig. Typisch für ein BioID/Split-BioID Experiment, sind die zusätzlichen großen Bands, die beobachtet werden können die Fusionsproteine, die selbst-biotinylierte bekam. Auch wenn kein anderer biotinylierte Protein zu sehen ist, zeigt biotinylierungen die Fusionsproteine bereits in diesem Stadium zu erkennen, dass die beiden getesteten Proteine in den Zellen interagiert. Im Experiment auf Abbildung 3dargestellt, es ist klar, dass ein NBirA *-Ago2 Fusionsproteins gepaart mit CBirA * Fusionen, TNRC6C oder Dicer ist effizienter als die gegenüberliegenden Kombinationen in der CBirA *-Ago2 paart sich zu NBirA * Fusionen der beiden anderen Proteine (Abbildung 3, obere Leiste vergleichen die Intensitäten der Fahrspuren 2-3 Bahnen 6-7). Darüber hinaus war die Aktivierung spezifisch, da keiner der Fusionen CBirA * NBirA * aktivieren konnte-GFP Kontrolle Schmelzverfahren Protein zu spürbaren Niveaus (Abbildung 3, vergleichen Bahnen 1, 4-5 auf Bahn 8, die untransfected Zellen entspricht). Da in unserem Plasmide NBirA * verfügt über ein Myc-Tag und CBirA * verfügt über ein FLAG-Tag (Abbildung 2), können die Ausdruck Ebenen der einzelnen Schmelzverfahren Protein mit Antikörpern gegen diese zwei Tags (Abbildung 3, Bodenplatte) analysiert werden.
Interaktion-induzierte biotinylierungen beobachtet wird, das Experiment kann hochskaliert werden, als die biotinylierte Proteine isoliert auf Streptavidin-gekoppelten Perlen wie in Ziffer 4 des Protokolls (Abbildung 4) angegeben. Wenn Sie die Isolierung zum ersten Mal durchführen, können alle Schritte der Reinigung durch Western Blot (Abbildung 5) analysiert werden. In der Regel sollte Bindung an die Perlen fast quantitative und praktisch kein Leck durch in den Waschungen beachtet werden. Vor der Verarbeitung der Proben für die Massenspektrometrie, empfehlen wir die Ausführung ein Western-Blot damit induzierte biotinylierungen arbeitete als erwartet und die Fusionsproteine zum Ausdruck gebracht wurden. Das Fehlen des Ausdrucks die Fusionsproteine ist aufgrund schlechter Transfektion Effizienz oder fehlerhafte Dox Induktion. Wenn die Fusionsproteine zum Ausdruck gebracht wurden, aber keine biotinylierungen beobachtet, überprüfen Sie, wenn überschüssiges Biotin (50 μM) tatsächlich auf das Medium hinzugefügt wurde und dass die Lager Biotin noch aktiv ist. Wenn der eluierten Material auf einem Coomassie gefärbt Protein Gel (Abbildung 6), in der Regel analysiert wurde, die stärkste Band zu beachten läuft bei etwa 17 kDa und Monomeren Streptavidin entspricht. Bands, die entsprechend der endogenen biotinylierte Proteine und die Fusionsproteine können auch beobachtet werden. Wir schneiden in der Regel Bereich der Probe Spur über dem Streptavidin-Band bis zu den Laden gut (Abbildung 6). Die ausgeschnittene Band kann in eine 1,5 mL-Tube gespeichert und an eine Massenspektrometrie-Anlage gesendet. Alternativ können gebundene Proteine auch an den Streptavidin-gekoppelten Perlen Trypsin verdaut und eluiert verdauten Peptide bilden die Spalte. Wir nutzen regelmäßig die MaxQuant Software16 (mit meist Standardparameter und Lysin biotinylierungen als eine mögliche Post-translationale Modifikation hinzufügen, finden Sie unter Referenz 9 für weitere Einzelheiten und typische MS-Ergebnisse), die MS-raw-Daten zu analysieren und die Perseus Suite17 für die anschließende statistische Analyse, beide sind freie Software. Beispiele sind in der Regel in drei biologische Wiederholungen ausgeführt. Verwendung von markierungsfreie Quantifizierung können speziell angereicherte Proteine über Kontrolle Bedingungen identifiziert werden. Um zu Filtern für endogen biotinylierte Proteine und Proteine, die nicht ausdrücklich durch das Enzym BirA * gekennzeichnet sind, betrachten wir nur Proteine, die deutlich über Hits aus sechs Datensätze generiert mit sechs unabhängigen Proteinen angereichert sind. Darüber hinaus berücksichtigen wir nur Hits, die über ein Split-BioID Dataset angereichert sind, wurden durch NBirA * NBirA * Fusionsproteine ersetzt-GFP. Andere Daten-Analyse-Strategien sind vor allem mit stabilen Isotopen Etikettierung mit Aminosäuren in der Zellkultur (SILAC) für quantitative Proteomik18vorgeschlagen worden. Darüber hinaus wurden verschiedene Strategien für die direkte Isolierung biotinylierte Peptide mit einer Streptavidin-Variante mit geschwächten Affinität zu Biotin18, spezielle Elution Bedingungen mit organischen Lösungsmitteln19 oder Biotin-spezifische beschrieben Antikörper-20,-21. Während nicht unbedingt führt zur Entdeckung von mehr Proteine, die Identifizierung von biotinylierungen Websites hinzufügen mehr Vertrauen hinsichtlich der Spezifität der Hits und ist nützlich, wenn Adressierung der Topologie einer Interaktion.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57479/57479fig1.jpg"> Abbildung 1: Überblick über das Split-BioID Verfahren. Eiweiß 1 interagiert mit Protein 2 im Rahmen der komplexen A oder Protein 3 als Teil der komplexen B. Um speziell die Zusammensetzung der Komplex A Sonde, kann Proteine 1 und 2 Split-BioID zugewiesen werden. Das Foto des Massenspektrometers ist unter einer Creative Commons Attribution-Share gleichermaßen 3.0 Unported Lizenz und wurde von https://commons.wikimedia.org mit Dateinamen von ThermoScientificOrbitrapElite.JPG heruntergeladen. <a href="/files/ftp_upload/57479/57479fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57479/57479fig2.jpg"> Abbildung 2: Split-BioID Plasmide Expressionskassetten. Wir bieten vier Plasmide um alle Kombinationen von NBirA * und CBirA * Fusionsproteine testen zu können. Die Plasmide und komplette Karten sind erhältlich bei addgene.org unter den angegebenen Nummern. Die Plasmide haben einen Tet-responsive Element (7 X TetO) und müssen in einer Zelllinie verwendet werden, die mit dem Tet-Ausdruck-System kompatibel ist. Beachten Sie auch, dass in allen Plasmiden ORFs FKBP und FRB zu NBirA verschmolzen * und CBirA * bzw. Fragmente. Diese beiden Proteine interagieren nur in Anwesenheit von Rapamycin und daher können Plasmide verwendet werden, um das System schnell in das Vorhandensein oder Fehlen von diesem chemischen9zu testen. Die angegebenen Restriktionsschnittstellen sind einzigartig. <a href="/files/ftp_upload/57479/57479fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57479/57479fig3.jpg"> Abbildung 3: typische Western-Blot für ein Split-BioID Experiment. Obere Leiste: Erkennung von biotinylierte Proteine mit Gewebekulturen beschrifteten Streptavidin. Untere Leiste: Erkennung von Fusionsproteinen mit Anti-Myc und Anti-FLAG Antikörper. Zwei Paare der Proteine wurden getestet: Ago2/TNRC6C und Ago2/Dicer. In Gassen, 2 & 3 war das CBirA * Fragment Ago2 angefügt. In Gassen 6 & 7 war das NBirA * Fragment Ago2 angefügt. Kein signifikantes Signal wurde beobachtet, wenn jede der drei Proteine mit NBirA * kombiniert wurden-GLP (Bahnen 1, 4-5). Die Sterne zeigen die Bänder entsprechend endogen biotinylierte Proteine, die als interne laden Kontrollen dienen können. Diese Zahl ist aus Abbildung 5 b von Schopp Et Al. adaptiert 9 unter einer Creative Commons Namensnennung 4.0 International-Lizenz. <a href="/files/ftp_upload/57479/57479fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57479/57479fig4.jpg"> Abbildung 4: Überblick über die Streptavidin-Pulldown-Verfahren. Wichtige Schritte für die Isolierung von biotinylierte Proteine für Massenspektrometrie Analyse werden dargestellt. <a href="/files/ftp_upload/57479/57479fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57479/57479fig5.jpg"> Abbildung 5: typische Western-Blot für ein Streptavidin-Pulldown-Experiment. Gleiche Volumina der angegebenen Samples auf ein SDS-Polyacrylamid-Gel geladen wurden. Nach Western blotting, wurden mit HRP-gekoppelte Streptavidin biotinylierte Proteine entdeckt. Bands, die entsprechenden NBirA *-TNRC6C und CBirA *-Ago2 angegeben. <a href="/files/ftp_upload/57479/57479fig5large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57479/57479fig6.jpg"> Abbildung 6: typische Coomassie gefärbt Protein Gel für Massenspektrometrie Analyse. Die eluierten Probe von Streptavidin-gekoppelten Perlen war auf einem vorgefertigten Protein Gel geladen und ausgeführt, bis die Probe Migrieren von 2-3 cm. Die großen Band gesehen bei etwa 17 kDa ist Streptavidin. Direkt oberhalb der Band ist ausgeschnitten und an einer Massenspektrometrie-Anlage gesendet. Bands, die entsprechenden NBirA *-TNRC6C und CBirA *-Ago2 angegeben. <a href="/files/ftp_upload/57479/57479fig6large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Transfektion Probe</td>
			<td colspan="3">Zustand geprüft</td>
		</tr>
<tr>
<td>1</td>
			<td colspan="3">NBirA *-protein1 / CBirA *-protein2</td>
		</tr>
<tr>
<td>2</td>
			<td colspan="3">CBirA *-protein1 / NBirA *-protein2</td>
		</tr>
<tr>
<td>3</td>
			<td colspan="3">NBirA *-GLP / CBirA *-protein1</td>
		</tr>
<tr>
<td>4</td>
			<td colspan="3">NBirA *-GLP / CBirA *-protein2</td>
		</tr>
<tr>
<td>5</td>
			<td colspan="3">keine Transfektion</td>
		</tr>
</tbody></table>Tabelle 1: In der Regel getestet Bedingungen beim Split-BioID anwenden auf zwei Proteine.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Sequenzierung Grundierung</td>
			<td>Sequenz</td>
		</tr>
<tr>
<td>Kassette 1 rückwärts-Primer (CBirA * Fusion)</td>
			<td>TATACTTTCTAGAGAATAGGAAC</td>
		</tr>
<tr>
<td>Kassette 2 rückwärts-Primer (NBirA * Fusion)</td>
			<td>GTGGTTTGTCCAAACTCATC</td>
		</tr>
</tbody></table>Tabelle 2: Sequenzierung Primer für die Split-BioID Plasmide.

Watch this Scientific Journal Video about Split-BioID â€” Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Wir bieten eine schrittweise Protokoll für Split-BioID, ein Protein-Fragmente-Ergänzung-Assay basiert auf der Nähe-labeling Technik BioID. Auf das Zusammenspiel der zwei bestimmte Proteine aktiviert, ermöglicht es die Proteomik-Analyse der Kontext-abhängige Proteinkomplexe in ihrer natürlichen zellulären Umgebung. Die Methode ist einfach, kostengünstig und erfordert nur standard Laborgeräten.

Split-BioID — Proteomic Analyse der kontextspezifischen Proteinkomplexe in ihrer natürlichen zellulären Umgebung

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

split-bioid-proteomic-analysis-context-specific-protein-complexes

Research

JoVE Journal

Biochemistry

19.6K Aufrufe.  Heidelberg University. Wir bieten eine schrittweise Protokoll für Split-BioID, ein Protein-Fragmente-Ergänzung-Assay basiert auf der Nähe-labeling Technik BioID. Auf das Zusammenspiel der zwei bestimmte Proteine aktiviert, ermöglicht es die Proteomik-Analyse der Kontext-abhängige Proteinkomplexe in ihrer natürlichen zellulären Umgebung. Die Methode ist einfach, kostengünstig und erfordert nur standard Laborgeräten.

Serie: Split-BioID — Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Multimer-PAGE: A Method for Capturing and Resolving Protein Complexes in Biological Samples

There are many well-developed methods for purifying and studying single proteins and peptides. However, most cellular functions are carried out by networks of interacting protein complexes, which are often difficult to investigate because their binding is non-covalent and easily perturbed by purification techniques. This work describes a method of stabilizing and separating native protein complexes from unmodified tissue using two-dimensional polyacrylamide gel electrophoresis. Tissue lysate is loaded onto a non-denaturing blue-native polyacrylamide gel, then an electric current is applied until the protein migrates a short distance into the gel. The gel strip containing the migrated protein is then excised and incubated with the amine-reactive cross-linking reagent dithiobis(succinimidyl propionate), which covalently stabilizes protein complexes. The gel strip containing cross-linked complexes is then cast into a sodium dodecyl sulfate polyacrylamide gel, and the complexes are separated completely. The method relies on techniques and materials familiar to most molecular biologists, meaning it is inexpensive and easy to learn. While it is limited in its ability to adequately separate extremely large complexes, and has not been universally successful, the method was able to capture a wide variety of well-studied complexes, and is likely applicable to many systems of interest.

A method for stabilizing and separating native protein complexes from unmodified tissue lysate using an amine-reactive protein cross-linker coupled to a novel two-dimensional polyacrylamide gel electrophoresis (PAGE) system is presented.

Multimer-PAGE: Ein Verfahren zum Erfassen und Auflösen von Proteinkomplexen in biologischen Proben

There are many well-developed methods for purifying and studying single proteins and peptides. However, most cellular functions are carried out by ...

Forschung

Biochemie

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological processes. Affinity purification coupled to mass spectrometry (AP-MS) has become the method of choice for identifying protein-protein interactions. However, conventional AP-MS studies provide information on protein interactions, but the organizational information is lost. To address this issue, we developed a strategy to unravel the distinct functional assemblies a protein might be involved in, by resolving affinity-purified protein complexes prior to their characterization by mass spectrometry. Protein complexes isolated through affinity purification of a bait protein using an epitope tag and competitive elution are separated through blue native electrophoresis. Comparison of protein migration profiles through correlation profiling using quantitative mass spectrometry allows assignment of interacting proteins to distinct molecular entities. This method is able to resolve protein complexes of close molecular weights that might not be resolved by traditional chromatographic techniques such as gel filtration. With little more work than conventional AP-geLC-MS/MS, we demonstrate this strategy may in many cases be adequate for obtaining protein complex topological information concomitantly to identifying protein interactions.

Here we present protocols for affinity purification of protein complexes and their separation by blue native PAGE, followed by protein correlation profiling using label free quantitative mass spectrometry. This method is useful to resolve interactomes into distinct protein complexes.

Auflösen von Affinity Purified Protein-Komplexen von Blue native PAGE und Protein Correlation Profilieren

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Analyzing Dynamic Protein Complexes Assembled On and Released From Biolayer Interferometry Biosensor Using Mass Spectrometry and Electron Microscopy

In vivo, proteins are often part of large macromolecular complexes where binding specificity and dynamics ultimately dictate functional outputs. In this work, the pre-endosomal anthrax toxin is assembled and transitioned into the endosomal complex. First, the N-terminal domain of a cysteine mutant lethal factor (LFN) is attached to a biolayer interferometry (BLI) biosensor through disulfide coupling in an optimal orientation, allowing protective antigen (PA) prepore to bind (Kd 1 nM). The optimally oriented LFN-PAprepore complex then binds to soluble capillary morphogenic gene-2 (CMG2) cell surface receptor (Kd 170 pM), resulting in a representative anthrax pre-endosomal complex, stable at pH 7.5. This assembled complex is then subjected to acidification (pH 5.0) representative of the late endosome environment to transition the PAprepore into the membrane inserted pore state. This PApore state results in a weakened binding between the CMG2 receptor and the LFN-PApore and a substantial dissociation of CMG2 from the transition pore. The thio-attachment of LFN to the biosensor surface is easily reversed by dithiothreitol. Reduction on the BLI biosensor surface releases the LFN-PAprepore-CMG2 ternary complex or the acid transitioned LFN-PApore complexes into microliter volumes. Released complexes are then visualized and identified using electron microscopy and mass spectrometry. These experiments demonstrate how to monitor the kinetic assembly/disassembly of specific protein complexes using label-free BLI methodologies and evaluate the structure and identity of these BLI assembled complexes by electron microscopy and mass spectrometry, respectively, using easy-to-replicate sequential procedures.

Here we present a protocol to monitor the assembly and disassembly of the anthrax toxin using biolayer interferometry (BLI). Following assembly/disassembly on the biosensor surface, the large protein complexes are released from the surface for visualization and identification of components of the complexes using electron microscopy and mass spectrometry, respectively.

Analyse dynamischer Proteinkomplexe montiert auf und befreit Biolayer Interferometrie Biosensor mit Massenspektrometrie und Elektronenmikroskopie

In vivo, proteins are often part of large macromolecular complexes where binding specificity and dynamics ultimately dictate functional outputs. In this ...

Identification of protein complexes with quantitative proteomics in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as important intracellular signalling molecules. However, unlike proteins, lipids are small hydrophobic molecules that traffic primarily by poorly described nonvesicular routes, which are hypothesized to occur at membrane contact sites (MCSs). MCSs are regions where the endoplasmic reticulum (ER) makes direct physical contact with a partnering organelle, e.g., plasma membrane (PM). The ER portion of ER-PM MCSs is enriched in lipid-synthesizing enzymes, suggesting that lipid synthesis is directed to these sites and implying that MCSs are important for lipid traffic. Yeast is an ideal model to study ER-PM MCSs because of their abundance, with over 1000 contacts per cell, and their conserved nature in all eukaryotes. Uncovering the proteins that constitute MCSs is critical to understanding how lipids traffic is accomplished in cells, and how they act as signaling molecules. We have found that an ER called Scs2p localize to ER-PM MCSs and is important for their formation. We are focused on uncovering the molecular partners of Scs2p. Identification of protein complexes traditionally relies on first resolving purified protein samples by gel electrophoresis, followed by in-gel digestion of protein bands and analysis of peptides by mass spectrometry. This often limits the study to a small subset of proteins. Also, protein complexes are exposed to denaturing or non-physiological conditions during the procedure. To circumvent these problems, we have implemented a large-scale quantitative proteomics technique to extract unbiased and quantified data. We use stable isotope labeling with amino acids in cell culture (SILAC) to incorporate staple isotope nuclei in proteins in an untagged control strain. Equal volumes of tagged culture and untagged, SILAC-labeled culture are mixed together and lysed by grinding in liquid nitrogen. We then carry out an affinity purification procedure to pull down protein complexes. Finally, we precipitate the protein sample, which is ready for analysis by high-performance liquid chromatography/ tandem mass spectrometry. Most importantly, proteins in the control strain are labeled by the heavy isotope and will produce a mass/ charge shift that can be quantified against the unlabeled proteins in the bait strain. Therefore, contaminants, or unspecific binding can be easily eliminated. By using this approach, we have identified several novel proteins that localize to ER-PM MCSs. Here we present a detailed description of our approach. 

Here we describe a new quantitative proteomics technique for identifying protein complexes in Saccharomyces cerevisiae. In this study, we have used the SILAC method together with affinity purification followed by tandem mass spectrometry to identify with high specificity the binding partners of an ER protein, Scs2p.

Identifizierung von Protein-Komplexen mit der quantitativen Proteomik in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as ...

Biologie

High-Resolution Complexome Profiling by Cryoslicing BN-MS Analysis

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed complexes. The latter can be elegantly resolved according to molecular size using native polyacrylamide gel electrophoresis (BN-PAGE). Coupling of such separations to sensitive mass spectrometry (BN-MS) has been well-established and theoretically allows for exhaustive assessment of the extractable complexome in biological samples. However, this approach is rather laborious and provides limited complex size resolution and sensitivity. Also, its application has remained restricted to abundant mitochondrial and plastid proteins. Thus, for a majority of proteins, information regarding integration into stable protein complexes is still lacking. Presented here is an optimized approach for complexome profiling comprising preparative-scale BN-PAGE separation, sub-millimeter sampling of broad gel lanes by cryomicrotome slicing, and mass spectrometric analysis with label-free protein quantification. The procedures and tools for critical steps are described in detail. As an application, the report describes complexome analysis of a solubilized endosome-enriched membrane fraction from mouse kidneys, with 2,545 proteins profiled in total. The results demonstrate identification of uniform, low-abundance membrane proteins such as intracellular ion channels as well as high resolution, complex protein assembly patterns, including glycosylation isoforms. The results are in agreement with independent biochemical analyses. In summary, this methodology allows for comprehensive and unbiased identification of protein (super)complexes and their subunit composition, providing a basis for investigating stoichiometry, assembly, and interaction dynamics of protein complexes in any biological system.

A versatile cryoslicing BN-MS protocol using a microtome is presented for high-resolution complexome profiling.

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed ...

JUMPn: A Streamlined Application for Protein Co-Expression Clustering and Network Analysis in Proteomics

With recent advances in mass spectrometry-based proteomics technologies, deep profiling of hundreds of proteomes has become increasingly feasible. However, deriving biological insights from such valuable datasets is challenging. Here we introduce a systems biology-based software JUMPn, and its associated protocol to organize the proteome into protein co-expression clusters across samples and protein-protein interaction (PPI) networks connected by modules (e.g., protein complexes). Using the R/Shiny platform, the JUMPn software streamlines the analysis of co-expression clustering, pathway enrichment, and PPI module detection, with integrated data visualization and a user-friendly interface. The main steps of the protocol include installation of the JUMPn software, the definition of differentially expressed proteins or the (dys)regulated proteome, determination of meaningful co-expression clusters and PPI modules, and result visualization. While the protocol is demonstrated using an isobaric labeling-based proteome profile, JUMPn is generally applicable to a wide range of quantitative datasets (e.g., label-free proteomics). The JUMPn software and protocol thus provide a powerful tool to facilitate biological interpretation in quantitative proteomics.

We present a systems biology tool JUMPn to perform and visualize network analysis for quantitative proteomics data, with a detailed protocol including data pre-processing, co-expression clustering, pathway enrichment, and protein-protein interaction network analysis.

JUMPn: Eine optimierte Anwendung für Protein-Co-Expressions-Clustering und Netzwerkanalyse in der Proteomik

With recent advances in mass spectrometry-based proteomics technologies, deep profiling of hundreds of proteomes has become increasingly feasible. ...

Isolation of Labile Multi-protein Complexes by in vivo Controlled Cellular Cross-Linking and Immuno-magnetic Affinity Chromatography

The dynamic nature of cellular machineries is frequently built on transient and/or weak protein associations. These low affinity interactions preclude stringent methods for the isolation and identification of protein networks around a protein of interest. The use of chemical crosslinkers allows the selective stabilization of labile interactions, thus bypassing biochemical limitations for purification. Here we present a protocol amenable for cells in culture that uses a homobifunctional crosslinker with a spacer arm of 12 &Aring;, dithiobis-(succinimidyl proprionate) (DSP). DSP is cleaved by reduction of a disulphide bond present in the molecule. Cross-linking combined with immunoaffinity chromatography of proteins of interest with magnetic beads allows the isolation of protein complexes that otherwise would not withstand purification. This protocol is compatible with regular western blot techniques and it can be scaled up for protein identification by mass spectrometry1.
Stephanie A. Zlatic and Pearl V. Ryder contributed equally to this work.

Isolation of Labile Multi-protein Complexes by in vivo Controlled Cellular Cross-Linking and Immuno-magnetic Affinity Chromatography

The cell permeable crosslinker DSP [dithiobis-(succinimidyl propionate)] stabilizes transient and labile interactions in vivo, which allows their isolation using stringent protein complex purification techniques. Here we present a technique for crosslinking cells grown in culture followed by isolation of protein complexes by immunoprecipitation.

Isolierung von Labile Multi-Protein-Komplexe durch In vivo Kontrollierte Cellular Cross-Linking und Immuno-magnetische Affinitätschromatographie

The dynamic nature of cellular machineries is frequently built on transient and/or weak protein associations. These low affinity interactions preclude ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Sezieren Signalisierung Multi-Protein-komplexe durch eine Bimolekulare Ergänzung Affinitätsreinigung (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

Immunologie und Infektion

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).
Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

Identifizierung von Protein-Komplexen in<em&gt; Escherichia coli</em&gt; Mit Sequential Peptide Affinity Purification in Kombination mit Tandem-Massenspektrometrie

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry

The introduced protocol provides a tool for the analysis of multiprotein complexes in the thylakoid membrane, by revealing insights into complex composition under different conditions. In this protocol the approach is demonstrated by comparing the composition of the protein complex responsible for cyclic electron flow (CEF) in Chlamydomonas reinhardtii, isolated from genetically different strains. The procedure comprises the isolation of thylakoid membranes, followed by their separation into multiprotein complexes by sucrose density gradient centrifugation, SDS-PAGE, immunodetection and comparative, quantitative mass spectrometry (MS) based on differential metabolic labeling (14N/15N) of the analyzed strains. Detergent solubilized thylakoid membranes are loaded on sucrose density gradients at equal chlorophyll concentration. After ultracentrifugation, the gradients are separated into fractions, which are analyzed by mass-spectrometry based on equal volume. This approach allows the investigation of the composition within the gradient fractions and moreover to analyze the migration behavior of different proteins, especially focusing on ANR1, CAS, and PGRL1. Furthermore, this method is demonstrated by confirming the results with immunoblotting and additionally by supporting the findings from previous studies (the identification and PSI-dependent migration of proteins that were previously described to be part of the CEF-supercomplex such as PGRL1, FNR, and cyt f). Notably, this approach is applicable to address a broad range of questions for which this protocol can be adopted and e.g. used for comparative analyses of multiprotein complex composition isolated from distinct environmental conditions.

A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry

The described comparative, quantitative proteomic approach aims at obtaining insights into the composition of multiprotein complexes&#160;under different conditions and is demonstrated by comparing genetically different strains. For quantitative analysis equal volumes of different fractions from a sucrose density gradient are mixed and analyzed by mass spectrometry.

Ein neuer Ansatz für die vergleichende Analyse von Multiproteinkomplexen Basierend auf<sup&gt; 15</sup&gt; N Metabolische Markierung und quantitative Massenspektrometrie

Split-BioID — Proteomic Analyse der kontextspezifischen Proteinkomplexe in ihrer natürlichen zellulären Umgebung

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video