Este trabajo ha sido posible gracias a las subvenciones a JK de los Centros de Excelencia de Ontario y el Fondo de Investigación de Ontario. Nos gustaría dar las gracias a Siddika Pardhan y el Dr. Peter Ferguson para la asistencia técnica durante el rodaje.

NOTA: El siguiente protocolo fue diseñado para su uso con células adherentes. Se requieren modificaciones para aplicar el método a las células no adherentes cultivadas en suspensión. Los experimentos CAM descritos en el protocolo están diseñados para su uso con las células que expresan un marcador fluorescente (por ejemplo, GFP, RFP, etc.). Nueve días embriones de pollo de edad se requieren en el día 2 del protocolo experimental para los experimentos CAM. 1. Preparación y transfección de células tumorales con oligonucleótidos antisentido (ASO) <ol><li> Aspirar medio de T75 frasco (s) que contiene células de interés, lavar con 1XPBS, y añadir 2 ml de 0,25% de tripsina / EDTA. Añadir 10 ml de medio de crecimiento completo a cada matraz y transferir las células en solución a un tubo de 50 ml. Contar las células y ajustar el volumen de forma que la concentración final es 1.0x10 5 células por ml. </li><li> Etiqueta dos grupos de matraces T25: un grupo se contienen ocho frascos etiquetados, 1-8, y estarán used para el tiempo real experimento de medición del metabolismo; y el segundo grupo también contendrá 8 matraces y será utilizado para el experimento CAM de embrión de pollo. Añadir 2 ml de células en solución a cada matraz y el lugar en la incubadora (37 ° C, 5% de CO 2 O / N). </li><li> A la mañana siguiente (día 0, Tiempo 0), la etiqueta de tres tubos de 5 ml de la siguiente manera: control (no de metas de ASO o siRNA), &quot;diana de interés&quot; (es decir, la orientación ASO o siRNA) y Lipofectamine 2000 (o similar reactivo de transfección). Diluir las soluciones de stock ASO a la concentración apropiada con medio libre de suero en el tubo apropiado. <ol><li> Añadir la cantidad requerida de reactivo de transfección en el tubo apropiado y se incuban en medio libre de suero durante 5 min. Añadir la solución de reactivo de transfección a los tubos de ASO y se incuba durante 20 min. </li></ol></li><li> Añadir 250 l de solución de control reactivo de transfección ASO a cada uno de los matraces 1-4 en cada grupo, y 250l de solución de reactivo de transfección &#39;diana de interés&#39; ASO a cada uno de los matraces 5-8 en cada grupo. Incubar durante 4 horas (37 ᵒC, 5% de CO 2). <ol><li> Durante la incubación, llevar a cabo los pasos descritos en la sección 2.1. Después de la incubación, añadir 3 ml de medio completo a cada matraz en el grupo experimento CAM y volver a la incubadora de O / N (37 ᵒC, 5% de CO 2). Procesar el grupo experimento metabolismo según la descripción en el apartado 2.2. Procesar el experimento CAM establecerá según la descripción en la sección 4. </li></ol></li></ol> 2. Biosensor Preparación Chip y la siembra de células <ol><li> En un entorno estéril, lavar cuidadosamente seis chips biosensores con 400 l de PBS. Esterilizar los chips con 400 l de etanol al 70% durante 20 min. Lavar tres veces con 400 l de PBS. <ol><li> Coloque los chips dentro cultur tejido estérile platos para evitar la contaminación. Coloque tres fichas en un plato llamado &#39;el control&#39;, y tres en un plato llamado &#39;blanco de interés&#39;. </li></ol></li><li> Etiquetar dos tubos de 50 ml como &#39;control&#39; y &#39;blanco de interés&#39;. Lavar las células con PBS y añadir un volumen apropiado de 0,25% de tripsina / EDTA. Espere hasta que los separa en monocapa y recoger las células de cada matraz. Depositar la solución en el tubo apropiado. <ol><li> Contar las células y ajustar el volumen de forma que la concentración final es 6.0x10 5 células / ml. Centrifugar y resuspender las células si la concentración inicial es demasiado baja. </li></ol></li><li> Añadir 250 l de la solución de células para cada chip biosensor en el grupo apropiado (para un total de 1.25x10 5 células por chip). Realice este un grupo de tareas a la vez para minimizar el riesgo de confundir las fichas. Colocar los recipientes estériles que contienen las fichas dentro de una cámara de humedad para evitar la evaporación, y colocar las cha humedadmber en la incubadora O / N (37 ᵒC, 5% de CO 2). </li><li> A la mañana siguiente (día 1), aspirar cuidadosamente el medio de cada chip y reemplazarla con 250 l de medio de crecimiento suplementado con suero bovino fetal 0,2% (FBS) y 1x penicilina y estreptomicina (P / S). Incubar durante 4 horas (37 ᵒC, 5% de CO 2). </li></ol> 3. Metabolismo Medición de preparación del sistema y Preparación de la solución <ol><li> Durante la incubación, preparar las soluciones necesarias de drogas y el sistema de medición del metabolismo para el próximo ensayo. NOTA: El sistema de medición del metabolismo contiene un total de seis módulos. Cada módulo tiene capacidad para un chip por experimento. <ol><li> Subdividir el ensayo en los siguientes grupos experimentales: una ficha de cada uno de los &#39;control&#39; y &#39;objetivo de interés&#39; grupos para recibir vehículo durante la duración del ensayo; dos chips de cada grupo para recibir tratamiento contra las drogas por un período definido de tiempo durante el assay, seguido de vehículo durante el período de lavado. </li><li> Para estudios de sensibilización de drogas, modificar la duración, el tiempo, y la concentración de tratamiento de drogas para adaptarse a la droga en cuestión. NOTA: Para el cisplatino, los siguientes pasos se determinaron empíricamente con células A549, y puede variar dependiendo de la línea celular. Realice todas las etapas con el caudal predeterminado de 4 l / min. 6 h de crecimiento medio + 0,2% de SFB y 1x P / S 24 h de 6 micras cisplatino en medio + 0,2% de SFB 1x P / S 24 h de crecimiento medio + 0,2% de SFB y 1x P / S 18 h de crecimiento medio + 0,2% de SFB y 1x P / S 4 h de 0,1% Triton X- NOTA: Las desviaciones de estos pasos requerirán cálculo para determinar el volumen necesario de soluciones de mediano y medicina basada en el caudal deseado y la duración del experimento. En las secciones siguientes se basan en los pasos descritos anteriormente. </li></ol></li><li> Etiqueta y llenar catorce tubos de 50 ml con 50 ml de medio de crecimiento + 0,2% FBS unad 1x P / S. Coloque las seis de una medición metabolismo bastidor de tubo de sistema, seis en otro, y los dos restantes en un tercer bastidor de tubo que contiene también tubos con cisplatino. Sellar los dos primeros bastidores con una membrana permeable al aire para evitar la evaporación. </li><li> Preparar una solución de 6 micras cisplatino (del volumen apropiado) en medio de + 0,2% de SFB con 1x P / S. Dispensar el volumen requerido de solución de cisplatino en cuatro tubos de 50 ml marcados. <ol><li> Colocar los tubos en las cuatro ranuras restantes en el bastidor de tubo de medición tercera metabolismo. Asegúrese de que los tubos se colocan en las ranuras correspondientes que corresponden a los biomodules deseados. Sellar los tubos con una membrana permeable al aire. </li></ol></li><li> Preparar y etiquetar seis tubos de 50 ml y llenarlos con 20 ml cada una de 0,1% de solución de Triton-X en el medio. La solución de Triton-X se lisar las células restantes y proporcionar un valor &quot;cero&quot; para cada chip. Colocar los tubos en un bastidor de tubo unidad de medición Cuarta metabolismo y sellar ingenioh una membrana permable de aire para evitar la evaporación excesiva. </li><li> Cargar las fichas en las biomodules e iniciar el experimento. </li></ol> 4. Experimento CAM Tratamiento de Drogas y Inyección NOTA: Los pasos y el procedimiento para la preparación de embriones de pollo para un experimento de CAM se describe en otra parte 19 <ol><li> Iniciar la tramitación de la CAM experimento de 48 horas después de la transfección (Día 2). Sub-dividir el &#39;control&#39; y &#39;objetivo de interés&#39; grupos en dos matraces de vehículo, y dos para el cisplatino. Aspirar el medio de los matraces y reponer, ya sea con 3 ml de medio fresco, o 6 mu M de cisplatino. Incubar durante 6 horas (37 ᵒC, 5% de CO 2). </li><li> Aspirar el medio, luego lavar y trypsinize las células; recoger las células tratadas con tripsina en solución en cuatro debidamente etiquetados tubos de 15 ml. <ol><li> Centrifugar y lavar las células tres veces con PBS. Vuelva a suspender el sedimento celular en 5 ml de PBS unad contar las células. </li><li> Ajuste el volumen para que la concentración final de células es 1.0x10 6 células / ml. Transferir la solución de células en la etiqueta tubos de 5 ml para inyección, y colocar en hielo. Invertir suavemente los tubos antes de la inyección para asegurar que las células estén bien mezclados. </li></ol></li><li> Ponga a un lado un total de 24 embriones de pollo (9 días de edad) para la inyección (6 por grupo). Realizar la inyección usando una aguja de vidrio unida a un tubo flexible conectado a una jeringa de 1 ml. La persona que realiza la inyección debe ser cegado al grupo de tratamiento. <ol><li> Utilizando un microscopio estéreo, inyectar 1.0x10 5 células en un volumen de 100 l en la circulación venosa de la CAM. Utilice una técnica pulsante lenta para inyectar el volumen completo de las células. Frote suavemente la zona de inyección con una toallita suave para detener el flujo de sangre y absorber cualquier derrame. Etiqueta cada envase embrión adecuadamente después de cada inyección. </li></ol></li><li> Confirmar la presencia y distribución de células fluorescentes en la vasculatura de la CAM después de la inyección mediante la visualización de ellos usando un microscopio fluorescente. Tome nota de los embriones en el que el número de células tumorales parece baja, o la distribución sea pobre. </li><li> Coloca los embriones de pollo en una cámara de humedad y almacenarlos en una incubadora (37 ° C, 60% de humedad). Espere 7-9 días antes de la enumeración de los focos metastásicos. </li></ol> 5. metastásico Focus Enumeración <ol><li> Durante el periodo de incubación de 7-9 días, seguimiento de los embriones y descartar los muertos. Asegúrese de que la cámara de humedad permanece húmedo en todo momento durante el período de incubación. </li><li> Utilizando un microscopio fluorescente estéreo de 20 aumentos, escanear toda la superficie superior de la CAM de embriones en un patrón regular, en forma de rejilla. </li><li> Cuente el número de focos metastásicos en cada campo de visión, y luego contar el número de un total definitivo por embrión. Si lo hace, para los seis embriones en cada grupo proporcionará un número o mediaf focos metastásicos por tratamiento. </li></ol>

<ol>
	<li>Bouwman, P., Jonkers, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+deregulated+DNA+damage+signalling+on+cancer+chemotherapy+response+and+resistance.">The effects of deregulated DNA damage signalling on cancer chemotherapy response and resistance.</a> Nat Rev Cancer. 12, 587-598 (2012).</li><li>Bozic, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionary+dynamics+of+cancer+in+response+to+targeted+combination+therapy.">Evolutionary dynamics of cancer in response to targeted combination therapy.</a> Elife. 2, e00747 (2013).</li><li>Diaz, L. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+evolution+of+acquired+resistance+to+targeted+EGFR+blockade+in+colorectal+cancers.">The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers.</a> Nature. 486, 537-540 (2012).</li><li>Hanahan, D., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hallmarks+of+cancer:+the+next+generation.">Hallmarks of cancer: the next generation.</a> Cell. 144, 646-674 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+BRCA2+and+Thymidylate+Synthase+Creates+Multidrug+Sensitive+Tumor+Cells+via+the+Induction+of+Combined+'Complementary+Lethality'.">Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined 'Complementary Lethality'.</a> Mol Ther Nucleic Acids. 2, e78 (2013).</li><li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA+damage+response+and+cancer+therapy.">The DNA damage response and cancer therapy.</a> Nature. 481, 287-294 (2012).</li><li>Helleday, T., Petermann, E., Lundin, C., Hodgson, B., Sharma, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+repair+pathways+as+targets+for+cancer+therapy.">DNA repair pathways as targets for cancer therapy.</a> Nat Rev Cancer. 8, 193-204 (2008).</li><li>Shaheen, M., Allen, C., Nickoloff, J. A., Hromas, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+lethality:+exploiting+the+addiction+of+cancer+to+DNA+repair.">Synthetic lethality: exploiting the addiction of cancer to DNA repair.</a> Blood. 117, 6074-6082 (2011).</li><li>Green, S., Benedetti, J., Smith, A., Crowley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Clinical trials in oncology. 28, (2012).</li><li>Begley, C. G., Ellis, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drug+development:+Raise+standards+for+preclinical+cancer+research.">Drug development: Raise standards for preclinical cancer research.</a> Nature. 483, 531-533 (2012).</li><li>Galluzzi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+definitions+of+cell+death+subroutines:+recommendations+of+the+Nomenclature+Committee+on+Cell+Death+2012.">Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012.</a> Cell Death Differ. 19, 531-533 (2012).</li><li>Ruggeri, B. A., Camp, F., Miknyoczki, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+disease:+pre-clinical+animal+models+of+cancer+and+their+applications+and+utility+in+drug+discovery.">Animal models of disease: pre-clinical animal models of cancer and their applications and utility in drug discovery.</a> Biochem Pharmacol. 87, 150-161 (2014).</li><li>Kwon, M. C., Berns, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+for+lung+cancer.">Mouse models for lung cancer.</a> Mol Oncol. 7, 165-177 (2013).</li><li>Young, M., Ordonez, L., Clarke, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+are+the+best+routes+to+effectively+model+human+colorectal+cancer.">What are the best routes to effectively model human colorectal cancer.</a> Mol Oncol. 7, 178-189 (2013).</li><li>Sharma, S. V., Haber, D. A., Settleman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-based+platforms+to+evaluate+the+therapeutic+efficacy+of+candidate+anticancer+agents.">Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents.</a> Nat Rev Cancer. 10, 241-253 (2010).</li><li>Garnett, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+genomic+markers+of+drug+sensitivity+in+cancer+cells.">Systematic identification of genomic markers of drug sensitivity in cancer cells.</a> Nature. 483, 570-575 (2012).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+monitoring+of+cisplatin-induced+cell+death.">Real-time monitoring of cisplatin-induced cell death.</a> PLoS One. 6, e19714 (2011).</li><li>Cvetkovic, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KISS1R+induces+invasiveness+of+estrogen+receptor-negative+human+mammary+epithelial+and+breast+cancer+cells.">KISS1R induces invasiveness of estrogen receptor-negative human mammary epithelial and breast cancer cells.</a> Endocrinology. 154, 1999-2014 (2013).</li><li>Leong, H. S., Chambers, A. F., Lewis, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+cancer+cell+migration+and+metastatic+growth+in+vivo+in+the+chick+embryo+using+fluorescence+intravital+imaging.">Assessing cancer cell migration and metastatic growth in vivo in the chick embryo using fluorescence intravital imaging.</a> Methods Mol Biol. 872, 1-14 (2012).</li><li>Hung, Y. P., Albeck, J. G., Tantama, M., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+cytosolic+NADH-NAD(+)+redox+state+with+a+genetically+encoded+fluorescent+biosensor.">Imaging cytosolic NADH-NAD(+) redox state with a genetically encoded fluorescent biosensor.</a> Cell Metab. 14, 545-554 (2011).</li><li>Tantama, M., Hung, Y. P., Yellen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+intracellular+pH+in+live+cells+with+a+genetically+encoded+red+fluorescent+protein+sensor.">Imaging intracellular pH in live cells with a genetically encoded red fluorescent protein sensor.</a> J Am Chem Soc. 133, 10034-10037 (2011).</li><li>Rytelewski, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BRCA2+inhibition+enhances+cisplatin-mediated+alterations+in+tumor+cell+proliferation,+metabolism,+and+metastasis.">BRCA2 inhibition enhances cisplatin-mediated alterations in tumor cell proliferation, metabolism, and metastasis.</a> Mol. Onc. 8 (8), 1429-1440 (2014).</li></ol>

Los autores no tienen nada que revelar.

Debido al coste inherente y el riesgo asociado con los ensayos clínicos, hay una necesidad de desarrollar una mejor y más rigurosa metodología de prueba pre-clínica para evaluar adecuadamente los regímenes de tratamiento contra el cáncer novedosas. Las técnicas actuales de uso común todas las debilidades de exposición que pueden limitar su capacidad para discriminar entre objetivos / agentes terapéuticos potencialmente prometedoras, y aquellos que pueden ser menos eficaces. Hemos elaborado un protocolo para ev...

Resistencia al objetivo y / o el tratamiento del cáncer citotóxica es un problema clínico importante que puede conducir al fracaso del tratamiento, recaída adquirida, y el aumento de la mortalidad del paciente 1. Dado el alto nivel de heterogeneidad en la mayoría de los tumores, es una certeza matemática que un tumor del número de células suficientemente alto contendrá un subconjunto de células resistentes a las terapias simples o combinadas dirigidas a las vías moleculares en que dichas células dependen para su supervivencia 2,3. Tales células tumorales pueden ser seleccionados positivamente para durante el tratamiento, dando lugar a recurrencia de la enfermedad. Desarrollo de nuevas terapias que se dirigen simultáneamente diferentes mecanismos de supervivencia de células cancerosas, ya sea antes o después de la selección del tratamiento mediada, por lo tanto es clínicamente importante. Un alto nivel de inestabilidad del genoma y la mutación en los genomas tumorales es una característica fundamental que distingue a las células cancerosas de las células huésped no tumorales 4. En consecuencia, un useful estrategia para aumentar la eficacia de la quimioterapia que daña el ADN y para prevenir el desarrollo de resistencia es para inhibir activamente la reparación del ADN en las células tumorales 5. Este es un campo activo de investigación y una variedad de objetivos de reparación del ADN novedosas se están estudiando en un entorno pre-clínico. Una serie de pequeñas moléculas o inhibidores basados ​​en antisentido de estos objetivos se han desarrollado y están en fase de pruebas 6.8. El objetivo es identificar los candidatos pre-clínicas más prometedoras y evaluar su seguridad y eficacia en los ensayos clínicos. El alto costo de los ensayos clínicos y el riesgo de fracaso (para una variedad de razones, incluyendo la evaluación preclínica subóptima) son obstáculos formidables para progresar en el desarrollo de nuevas terapias 9. El uso de modelos apropiados y rigurosos pre-clínico para evaluar adecuadamente nuevas dianas terapéuticas y fármacos candidatos puede disminuir la alta tasa de fracaso de los ensayos clínicos 10 </sup&gt;. Algunos métodos de pre-clínicos utilizados comúnmente para evaluar la efectividad de los regímenes anti-cáncer novela son: a) medición de la capacidad para reducir la proliferación de células tumorales in vitro (ensayos de proliferación celular) b) reducción, inducida por el tratamiento en la capacidad de las células tumorales a colonias de cultivo de tejido forma (ensayos de formación de colonias), c) la reducción inducida por el tratamiento en la actividad metabólica de las células tumorales in vitro (conversión redox-dye), d) inducidos por la terapia de inducción de la muerte celular in vitro del tumor (apoptótico, necrótico, autophagic, asociado con la mitosis y otros) 11, y e) in vivo reducción del crecimiento o la ablación de humanos y de ratón xenoinjertos 12-14 terapia inducida. Una debilidad importante de los métodos enumerados in vitro es que ninguno de ellos proporciona una evaluación continua en tiempo real de los efectos de las terapias candidatos. Más bien, ellos proporcionan información sólo a los puntos de tiempo seleccionados, ampliamente separadas-durante el curso del tratamiento. Tales medidas han disminuido la capacidad de reflejar con exactitud la magnitud y el momento de las respuestas de células tumorales. En vivo modelos de xenoinjertos de ratón también están limitados por el alto costo, la duración de tiempo en completarse, y el riesgo de dosificación y tratamiento momento subóptimo (programación). Además, hay evidencia de que los modelos de xenoinjerto de roedores son predictores limitados de eficacia clínica en humanos, en comparación con la evaluación in vitro de las respuestas de las células tumorales humanas primarias y establecidas las líneas celulares tumorales humanas a candidatos intervenciones terapéuticas 15,16. Hemos ideado un nuevo protocolo de combinación para evaluar nuevas combinaciones de fármacos pre-clínica, de una manera que aborda las deficiencias de los procedimientos más comunes que se enumeran anteriormente. En lugar de la proliferación, la formación de colonias, o ensayos de conversión redox en colorantes, se utilizó una unidad de medición para analizar el metabolismo de la adhesión celular, la respiración, y la acidificación en tiempo realdurante todo el periodo de tratamiento de 17. Al mismo tiempo, se investigaron los efectos de la combinación de tratamiento in vivo mediante el uso de un embrión de pollo modelo corioalantoica membrana (CAM) de la invasión y la metástasis 18,19. Se utilizó estos métodos para evaluar la capacidad de un oligonucleótido antisentido (ASO) dirigidos BRCA2 para potenciar la eficacia del cisplatino fármaco quimioterapéutico comúnmente utilizado.

<table border="0" cellpadding="0" cellspacing="0" >
	<tbody>
		<tr >
			<td >Name of Material/ Equipment</td>
			<td >Company</td>
			<td >Catalog Number</td>
			<td >Comments/Description</td>
		</tr>
		<tr >
			<td >A549 cells</td>
			<td >ATCC</td>
			<td >CCL-185</td>
			<td>http://www.atcc.org/products/all/CCL-185.aspx</td>
		</tr>
		<tr >
			<td >AeraSeal film&#160;</td>
			<td >Carl Roth GmbH</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >AMEM</td>
			<td >Wisent Bioproducts</td>
			<td >210-011-QK</td>
			<td></td>
		</tr>
		<tr >
			<td >Antisense oligodeoxynucleotides</td>
			<td >Avecia</td>
			<td ></td>
			<td>BRCA2 target sequence: 5&#39; - UAAGGAACGUCAAGAGAUAC - 3&#39; (bases 7241-7259 )</td>
		</tr>
		<tr >
			<td >Axio Zoom V16 Microscope</td>
			<td >Carl Zeiss</td>
			<td ></td>
			<td>http://www.zeiss.ca/microscopy/en_ca/products/stereo-zoom-microscopes/axio-zoom-v16.html</td>
		</tr>
		<tr >
			<td >Bionas Biosensor Chips</td>
			<td >Bionas GmbH and Micronas GmbH</td>
			<td >BIS8001D</td>
			<td></td>
		</tr>
		<tr >
			<td >Bionas Discovery 2500 System&#160;</td>
			<td >Bionas GmbH</td>
			<td ></td>
			<td>http://www.bionas-discovery.com/prodservices/instruments/system2500/</td>
		</tr>
		<tr >
			<td >Cisplatin</td>
			<td >Sigma Aldrich</td>
			<td >479306</td>
			<td></td>
		</tr>
		<tr >
			<td >Fertilized chicken eggs</td>
			<td >Sourced locally</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Fetal bovine serum&#160;</td>
			<td >Gibco - Life Technologies</td>
			<td ></td>
			<td></td>
		</tr>
		<tr >
			<td >Lipofectamine 2000&#160;</td>
			<td >Invitrogen - Life Technologies&#160;</td>
			<td >12566014</td>
			<td>http://www.lifetechnologies.com/ca/en/home/life-science/protein-expression-and-analysis/transfection-selection/lipofectamine-2000.html</td>
		</tr>
		<tr >
			<td >PBS</td>
			<td >Wisent Bioproducts</td>
			<td >311-010-CL</td>
			<td></td>
		</tr>
		<tr >
			<td >Trypsin (0.25%)/EDTA</td>
			<td >Wisent Bioproducts</td>
			<td >325-043-CL</td>
			<td></td>
		</tr>
	</tbody>
</table>

evaluating the effectiveness of cancer drug sensitization in vitro and in vivo

Debido al alto nivel de heterogeneidad y las mutaciones inherentes en los cánceres humanos, las terapias con agentes individuales, o regímenes de combinación que se dirigen a la misma vía, son propensos a fallar. Se debe poner énfasis en la inhibición de las vías que son responsables de la resistencia intrínseca y / o de adaptación a la terapia. Un campo activo de investigación es el desarrollo y prueba de los inhibidores de reparación del ADN que promueven la acción de, y prevenir la resistencia a, comúnmente utilizado la quimioterapia y la radioterapia. Se utilizó un nuevo protocolo para evaluar la eficacia de la inhibición de BRCA2 como un medio para sensibilizar a las células tumorales al medicamento cisplatino que daña el ADN. Metabolismo de la célula tumoral (la acidificación y la respiración) se monitorizó en tiempo real por un período de 72 horas para delinear la efectividad del tratamiento en un minuto a minuto. En combinación, se realizó una evaluación de la frecuencia metastásica utilizando una membrana corioalantoidea de embrión de pollo (CAM) modelo de la extravasación y la invasión. Esteprotocolo aborda algunas de las debilidades de los comúnmente utilizados in vitro y métodos in vivo para evaluar los regímenes de terapia del cáncer novedosas. Se puede utilizar además de los métodos comunes tales como ensayos de proliferación celular, ensayos de muerte celular, y estudios in vivo de xenoinjertos murinos en, discriminar más estrechamente entre los objetivos de candidatos y agentes, y seleccionar sólo los candidatos más prometedores para el desarrollo futuro.

Resultados y cifras adaptadas con permiso de trabajo publicado 22. BRCA2 inhibición induce una disminución en la respiración en las células tumorales tratadas con cisplatino Las células del cáncer de pulmón humano A549 tratados con BRCA2 de metas ASO y cisplatino exhibido una disminución temprana e irreversible en la respiración, en comparación con las células que recibieron el control de ASO y cisplatino solo; después de 24 h de t...

Watch this Scientific Journal Video about Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo at JoVE.com

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics.

Evaluación de la efectividad del medicamento para el cáncer Sensibilización<em&gt; In Vitro</em&gt; Y<em&gt; En Vivo</em

Due to the high level of heterogeneity and mutations inherent in human cancers, single agent therapies, or combination regimens which target the same ...

evaluating-effectiveness-cancer-drug-sensitization-vitro

Research

JoVE Journal

Medicine

Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

8.2K vistas.  Western University. Here, real-time monitoring of tumor cell metabolism, combined with an in vivo chicken embryo chorio-allantoic membrane (CAM) model of metastasis, are used to evaluate novel anti-cancer targets/agents for their ability to sensitize tumor cells to DNA damaging chemotherapeutics. 

Video: Evaluating the Effectiveness of Cancer Drug Sensitization In Vitro and In Vivo

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent until many years after removal of the primary tumor and adjuvant therapy. A likely explanation of this phenomenon is that tumor cells have seeded metastatic sites, are resistant to conventional therapies, and remain dormant for long periods of time 1-4.
The existence of dormant cancer cells at secondary sites has been described previously as quiescent solitary cells that neither proliferate nor undergo apoptosis 5-7. Moreover, these solitary cells has been shown to disseminate from the primary tumor at an early stage of disease progression 8-10 and reside growth-arrested in the patients' bone marrow, blood and lymph nodes 1,4,11. Therefore, understanding mechanisms that regulate dormancy or the switch to a proliferative state is critical for discovering novel targets and interventions to prevent disease recurrence. However, unraveling the mechanisms regulating the switch from tumor dormancy to metastatic growth has been hampered by the lack of available model systems.
in vivo and ex vivo model systems to study metastatic progression of tumor cells have been described previously 1,12-14. However these model systems have not provided in real time and in a high throughput manner mechanistic insights into what triggers the emergence of solitary dormant tumor cells to proliferate as metastatic disease. We have recently developed a 3D in vitro system to model the in vivo growth characteristics of cells that exhibit either dormant (D2.OR, MCF7, K7M2-AS.46) or proliferative (D2A1, MDA-MB-231, K7M2) metastatic behavior in vivo . We demonstrated that tumor cells that exhibit dormancy in vivo at a metastatic site remain quiescent when cultured in a 3-dimension (3D) basement membrane extract (BME), whereas cells highly metastatic in vivo readily proliferate in 3D culture after variable, but relatively short periods of quiescence. Importantly by utilizing the 3D in vitro model system we demonstrated for the first time that the ECM composition plays an important role in regulating whether dormant tumor cells will switch to a proliferative state and have confirmed this in in vivo studies15-17. Hence, the model system described in this report provides an in vitro method to model tumor dormancy and study the transition to proliferative growth induced by the microenvironment.

An In Vitro System to Study Tumor Dormancy and the Switch to Metastatic Growth

A modified 3-D in vitro system is presented in which growth characteristics of several tumor cell lines in reconstituted basement membrane correlate with the dormant or proliferative behavior of the tumor cells at a metastatic secondary site in vivo.

Un In Vitro Sistema para el Estudio de latencia del tumor y el salto hacia el crecimiento metastásico

Recurrence of breast cancer often follows a long latent period in which there are no signs of cancer, and metastases may not become clinically apparent ...

Investigación

Medicina

Live Imaging of Drug Responses in the Tumor Microenvironment in Mouse Models of Breast Cancer

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional co-culture systems are frequently used to explicate tumor-stroma interactions, including their role in drug responses. However, many of the interactions that occur in vivo in the intact microenvironment cannot be completely replicated in these in vitro settings. Thus, direct visualization of these processes in real-time has become an important tool in understanding tumor responses to therapies and identifying the interactions between cancer cells and the stroma that can influence these responses. Here we provide a method for using spinning disk confocal microscopy of live, anesthetized mice to directly observe drug distribution, cancer cell responses and changes in tumor-stroma interactions following administration of systemic therapy in breast cancer models. We describe procedures for labeling different tumor components, treatment of animals for observing therapeutic responses, and the surgical procedure for exposing tumor tissues for imaging up to 40 hours. The results obtained from this protocol are time-lapse movies, in which such processes as drug infiltration, cancer cell death and stromal cell migration can be evaluated using image analysis software.

We describe a method for imaging response to anti-cancer treatment in vivo and at single cell resolution.

Imágenes en directo de las respuestas de drogas en el microambiente tumoral en modelos de ratón de cáncer de mama

The tumor microenvironment plays a pivotal role in tumor initiation, progression, metastasis, and the response to anti-cancer therapies. Three-dimensional ...

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these diseases. Chronic retinal diseases such as retinal oedema or neovascularization usually require multiple intraocular injections to effectively treat the condition. However, the risks associated with these injections increase with repeated delivery of the drug. Therefore, alternative delivery methods need to be established in order to minimize the risks of reinjection. Several other investigations have developed methods to deliver drugs over extended time, through materials capable of releasing chemicals slowly into the eye. In this investigation, we outline the use of Elvax 40W, a copolymer resin, to act as a vehicle for drug delivery to the adult rat retina. The resin is made and loaded with the drug. The drug-resin complex is then implanted into the vitreous cavity, where it will slowly release the drug over time. This method was tested using 2-amino-4-phosphonobutyrate (APB), a glutamate analogue that blocks the light response of the retina. It was demonstrated that the APB was slowly released from the resin, and was able to block the retinal response by 7 days after implantation. This indicates that slow-release drug delivery using this copolymer resin is effective for treating the retina, and could be used therapeutically with further testing.

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

De liberación lenta Drug Delivery través Elvax 40W a la Rata Retina: Implicaciones para el tratamiento de condiciones crónicas

Diseases of the retina are difficult to treat as the retina lies deep within the eye. Invasive methods of drug delivery are often needed to treat these ...

Carotid Artery Infusions for Pharmacokinetic and Pharmacodynamic Analysis of Taxanes in Mice

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study model. As the use of mouse models are often a vital step in preclinical drug discovery and drug development1-8, it is necessary to design a system to introduce drugs into mice in a uniform, reproducible manner. Ideally, the system should permit the collection of blood samples at regular intervals over a set time course. The ability to measure drug concentrations by mass-spectrometry, has allowed investigators to follow the changes in plasma drug levels over time in individual mice1, 9, 10. In this study, paclitaxel was introduced into transgenic mice as a continuous arterial infusion over three hours, while blood samples were simultaneously taken by retro-orbital bleeds at set time points. Carotid artery infusions are a potential alternative to jugular vein infusions, when factors such as mammary tumors or other obstructions make jugular infusions impractical. Using this technique, paclitaxel concentrations in plasma and tissue achieved similar levels as compared to jugular infusion. In this tutorial, we will demonstrate how to successfully catheterize the carotid artery by preparing an optimized catheter for the individual mouse model, then show how to insert and secure the catheter into the mouse carotid artery, thread the end of the catheter out through the back of the mouse&#8217;s neck, and hook the mouse to a pump to deliver a controlled rate of drug influx. Multiple low volume retro-orbital bleeds allow for analysis of plasma drug concentrations over time.

This method was developed with the goal of delivering a steady drug solution via the carotid artery, to assess the pharmacokinetics of novel drugs in mouse models.

Infusiones de la arteria carótida para farmacocinéticas y farmacodinámicas Análisis de taxanos en ratones

When proposing the use of a drug, drug combination, or drug delivery into a novel system, one must assess the pharmacokinetics of the drug in the study ...

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of women are alive 5 years after diagnosis. The omentum is a preferred site of HGSC metastasis formation. Despite the clinical importance of this microenvironment, the contribution of omental adipose tissue to ovarian cancer progression remains understudied. Omental adipose is unusual in that it contains structures known as milky spots, which are comprised of B, T, and NK cells, macrophages, and progenitor cells surrounding dense nests of vasculature. Milky spots play a key role in the physiologic functions of the omentum, which are required for peritoneal homeostasis. We have shown that milky spots also promote ovarian cancer metastatic colonization of peritoneal adipose, a key step in the development of peritoneal metastases. Here we describe the approaches we developed to evaluate and quantify milky spots in peritoneal adipose and study their functional contribution to ovarian cancer cell metastatic colonization of omental tissues both in vivo and ex vivo. These approaches are generalizable to additional mouse models and cell lines, thus enabling the study of ovarian cancer metastasis formation from initial localization of cells to milky spot structures to the development of widespread peritoneal metastases.

In Vivo and Ex Vivo Approaches to Study Ovarian Cancer Metastatic Colonization of Milky Spot Structures in Peritoneal Adipose

We outline a protocol that implements both in vivo and ex vivo approaches to study ovarian cancer colonization of peritoneal adipose tissues, particularly the omentum. Furthermore, we present a protocol to quantitate and analyze immune cell-structures in the omentum known as milky spots, which promote metastases of peritoneal adipose.

En vivo y ex vivo para estudiar Cáncer de ovario metastásico colonización de Estructuras Vía lugar en Peritoneal adiposo

High-grade serous ovarian cancer (HGSC), the cause of widespread peritoneal metastases, continues to have an extremely poor prognosis; fewer than 30% of ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor initiation, metastasis and resistance to radio- and chemotherapy. Here we describe a specific methodology for culturing primary human pancreatic CSCs as tumor spheres in anchorage-independent conditions. Cells are grown in serum-free, non-adherent conditions in order to enrich for CSCs while their more differentiated progenies do not survive and proliferate during the initial phase following seeding of single cells. This assay can be used to estimate the percentage of CSCs present in a population of tumor cells. Both size (which can range from 35 to 250 micrometers) and number of tumor spheres formed represents CSC activity harbored in either bulk populations of cultured cancer cells or freshly harvested and digested tumors 1,2. Using this assay, we recently found that metformin selectively ablates pancreatic CSCs; a finding that was subsequently further corroborated by demonstrating diminished expression of pluripotency-associated genes/surface markers and reduced in vivo tumorigenicity of metformin-treated cells. As the final step for preclinical development we treated mice bearing established tumors with metformin and found significantly prolonged survival. Clinical studies testing the use of metformin in patients with PDAC are currently underway (e.g., NCT01210911, NCT01167738, and NCT01488552). Mechanistically, we found that metformin induces a fatal energy crisis in CSCs by enhancing reactive oxygen species (ROS) production and reducing mitochondrial transmembrane potential. In contrast, non-CSCs were not eliminated by metformin treatment, but rather underwent reversible cell cycle arrest. Therefore, our study serves as a successful example for the potential of in vitro sphere formation as a screening tool to identify compounds that potentially target CSCs, but this technique will require further in vitro and in vivo validation to eliminate false discoveries.

Pancreatic cancer stem cells (CSCs) can be expanded in vitro using the anchorage-independent sphere culture technique, which represents a powerful tool to study CSC biology and can serve as the first step to develop novel CSC-targeting therapies. Here the methodology for expanding, analyzing and targeting of pancreatic CSCs is provided.

El estudio de cáncer de páncreas Tallo Características de las células para el desarrollo de nuevas estrategias de tratamiento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Depletion of Mouse Cells from Human Tumor Xenografts Significantly Improves Downstream Analysis of Target Cells

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic patient tumors in different assays1. Human tumor xenografts represent the gold standard with respect to tumor biology, drug discovery, and metastasis research 2-4. Tumor xenografts can be derived from different types of material like tumor cell lines, tumor tissue from primary patient tumors4 or serially transplanted tumors. When propagated in vivo, xenografted tissue is infiltrated and vascularized by cells of mouse origin. Multiple factors such as the tumor entity, the origin of xenografted material, growth rate and region of transplantation influence the composition and the amount of mouse cells present in tumor xenografts. However, even when these factors are kept constant, the degree of mouse cell contamination is highly variable.
Contaminating mouse cells significantly impair downstream analyses of human tumor xenografts. As mouse fibroblasts show high plating efficacies and proliferation rates, they tend to overgrow cultures of human tumor cells, especially slowly proliferating subpopulations. Mouse cell derived DNA, mRNA, and protein components can bias downstream gene expression analysis, next-generation sequencing, as well as proteome analysis 5. To overcome these limitations, we have developed a fast and easy method to isolate untouched human tumor cells from xenografted tumor tissue. This procedure is based on the comprehensive depletion of cells of mouse origin by combining automated tissue dissociation with the benchtop tissue dissociator and magnetic cell sorting. Here, we demonstrate that human target cells can be can be obtained with purities higher than 96% within less than 20 min independent of the tumor type.

Human tumor xenografts are vascularized and infiltrated by cells of mouse origin during the growth phase in vivo. To circumvent the bias caused by these contaminating cells during downstream analysis, we developed a method allowing for comprehensive depletion of all mouse cells by magnetic cell sorting.

El agotamiento de las células de ratón a partir de xenoinjertos de tumores humanos mejora significativamente análisis de aguas abajo de las células diana

The use of in vitro cell line models for cancer research has been a useful tool. However, it has been shown that these models fail to reliably mimic ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant CFTR channel in subjects with cystic fibrosis (CF). Identification of subjects that may benefit from these drugs is challenging because of the extensive heterogeneity of CFTR mutations, as well as other unknown factors that contribute to individual drug efficacy. Here, we describe a simple and relatively rapid assay for measuring individual CFTR function and response to CFTR modulators in vitro. Three dimensional (3D) epithelial organoids are grown from rectal biopsies in standard organoid medium. Once established, the organoids can be bio-banked for future analysis. For the assay, 30-80 organoids are seeded in 96-well plates in basement membrane matrix and are then exposed to drugs. One day later, the organoids are stained with calcein green, and forskolin-induced swelling is monitored by confocal live cell microscopy at 37 &#176;C. Forskolin-induced swelling is fully CFTR-dependent and is sufficiently sensitive and precise to allow for discrimination between the drug responses of individuals with different and even identical CFTR mutations. In vitro swell responses correlate with the clinical response to therapy. This assay provides a cost-effective approach for the identification of drug-responsive individuals, independent of their CFTR mutations. It may also be instrumental in the development of future CFTR modulators.

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

This protocol describes an assay for measuring CFTR function and CFTR modulator responses in cultured tissue from subjects with cystic fibrosis (CF). Biopsy-derived intestinal organoids swell in a cAMP-driven fashion, a response that is defective (or strongly reduced) in CF organoids and can be restored by exposure to CFTR modulators.

Inducida por la forskolina Hinchazón en organoides intestinal: Una<em&gt; In Vitro</em&gt; Ensayo para evaluar la respuesta de drogas en pacientes con fibrosis quística

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic study in the liver. Here, numerous assays are described to comprehensively measure the phenotype and parameters of hepatic steatosis in mouse and hepatocyte models. 
Combining the physiological, histological, and biochemical methods, this system can be used to assess the progress of hepatic steatosis. In vivo, the measurements of body weight and nuclear magnetic resonance (NMR) provide a general understanding of mice in a non-invasive manner. Hematoxylin and Eosin (H&amp;E) and Oil Red O staining determine the histological morphology and lipid deposition of liver tissue under nutrient overload conditions, such as high-fat diet feeding. Next, the total lipid contents are isolated by chloroform/methanol extraction, which are followed by a biochemical analysis for triglyceride and cholesterol. Moreover, mouse primary hepatocytes are treated with high glucose plus insulin to stimulate lipid accumulation, an efficient in vitro model to mimic diet-induced hyperglycemia and hyperinsulinemia in vivo. Then, the lipid deposition is measured by Oil Red O staining and chloroform/methanol extraction. Oil Red O staining determines intuitive hepatic steatotic phenotypes, while the lipid extraction analysis determines the parameters that can be analyzed statistically. The present protocols are of interest to scientists in the fields of fatty liver diseases, insulin resistance, and type 2 diabetes.

Optimized Analysis of In Vivo and In Vitro Hepatic Steatosis

Here, optimized methods to generate in vivo and in vitro models of hepatic steatosis and to analyze the steatotic phenotypes and related physiological parameters are described.

Análisis optimizada de<em&gt; En Vivo</em&gt; y<em&gt; In Vitro</em&gt; La esteatosis hepática

Establishing a system of procedures to qualitatively and quantitatively characterize in vivo and in vitro hepatic steatosis is important for metabolic ...

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the body, an additional extraction procedure is commonly required to release the active constituents from raw herbs. Water decoction is a classical extraction procedure that is still broadly used in the clinical settings. Here, we propose a detailed protocol for er-xian decoction (EXD) in order to apply herbal decoctions to experimental studies. The calculation of an animal-appropriate dose is described, as well as the four main steps of EXD: soaking, water decoction, filtration, and concentration. In addition, serum-containing EXD is introduced to rats as a means of in vitro validation. Here, rats were orally administered EXD for three days. Blood samples were then collected, inactivated, centrifuged, and filtered. The serum, diluted with the culture medium, can be utilized to treat cells or tissues in vitro. For example, EXD was applied to both in vivo and in vitro studies and demonstrated that EXD enhances osteogenesis. This protocol can be used as a reference for the preparation and application of herbal medicines.

Preparation of Herbal Medicine: Er-Xian Decoction and Er-Xian-containing Serum for In Vivo and In Vitro Experiments

Here, we present the preparation of an er-xian decoction (EXD) in four steps&#8212;soaking, decoction, filtration, and concentration&#8212;and demonstrate the administration of a prepared EXD-containing serum to rats. These methods are applicable to the in vivo and in vitro study of herbal decoctions such as traditional Chinese medicines.

Preparación de Herbal Medicine: Decocción de Er-Xian y suero que contiene Er-Xian para<em&gt; In Vivo</em&gt; Y<em&gt; In Vitro</em&gt; Experimentos

Traditional herbal medicine, an alternative medicine in the clinical setting, has received increased attention in recent years. Before delivery to the ...