Este estudio fue apoyado por una beca (2013R1A1A3005669) de la Fundación Nacional de Investigación de Corea y una subvención (HI13C0016) de la coreana Salud Tecnología Proyecto I + D del Ministerio de Salud y Bienestar Social.

1. Preparación de la sonda <ol><li> La amplificación por PCR de la sonda <ol><li> Para el P. sonda gingivalis específico de, amplificar un fragmento de ADN de 343 pb de P. gingivalis 16S rRNA mediante PCR utilizando el ADN genómico de P. gingivalis y los siguientes cebadores: 5&#39;-TGC AAC TTG CCT TAC AGA GG-3 &#39;y 5&#39; ACTUAR CGT ATC GCC CGT TAT TC-3 &#39;10. Realizar amplificaciones con las siguientes condiciones de ciclo: 35 ciclos a 95 ° C durante 30 seg, 60 ° C durante 30 seg, y 72 ° C durante 1 min 20 seg seguido por una extensión de 5 min a 72 ° C 10,11. </li><li> Amplificar la eubacteriana usando un 70-bp fragmento de ADN (5&#39;-CAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAG TCCCGCAACGAGCGCAACCC-3 &#39;) sintetizado como un oligonucleótido y los siguientes cebadores: 5&#39;-CTG CAG GTR CMT GGY-3&#39; y 5&#39;-AGG GTT GCG CTC GTT-3 &#39;11. Realizar amplificaciones con las siguientes condiciones de ciclo: 40 ciclos9 a 4 ° C durante 30 seg, 60 ° C durante 30 seg y 72 ° C durante 1 min 20 s, seguido de una extensión de 5 min a 72 ° C 11,12. </li><li> Precipitar los productos de PCR (≥500 mu l) mediante la adición de acetato de sodio 3 M (pH 5,2) y etanol 100% (a un 10: 1: 2 ratio) e incubando a -20 ° C durante 2 hr. </li><li> Centrifugar la mezcla a 14.000 xg durante 15 min, resuspender el precipitado en 100 l de tampón TE, y medir la concentración de ADN mediante densidad óptica a 260 nm. </li></ol></li><li> DIG etiquetado utilizando un kit de etiquetado y detección de ADN DIG <ol><li> Mezclar 3 g de la sonda con agua hasta un volumen final de 15 l. </li><li> Desnaturalizar el ADN a 95 ° C durante 10 minutos y enfriar rápidamente en hielo. </li><li> Añadir 2 l de 10x mezcla hexanucleotide, 2 l de mezcla de dNTP-etiquetado, y 1 l de enzima Klenow a 15 l de la DNA desnaturalizado. </li><li> Mezclar e incubar a 37 ° C durante 24 horas a 48 horas y detener la reacción por calentamiento a 65 ° C. </li></ol></li><li> Compruebe la sensibilidad de la sonda DIG-etiquetados utilizando un kit de etiquetado y detección de ADN DIG <ol><li> Cargar manualmente 1 l de diluciones seriadas de la sonda de control positivo en el kit y 1 ng de la sonda marcada con DIG en la membrana de nylon y seco durante 5 minutos a temperatura ambiente. </li><li> Brevemente empapar la membrana en tampón 2x ​​SSC (NaCl 0,3 M, citrato de sodio 30 mM, pH 7,0) y se incuba la membrana a 80 ° C durante 1 hora para inmovilizar el ADN. </li><li> Brevemente empapar la membrana en tampón de ácido maleico (MAB, 0,1 M de ácido maleico, NaCl 0,15 M, pH 7,5) y se incuba con anti-DIG fosfatasa alcalina (AP) conjugada con anticuerpo diluido (1: 5000) en 6 ml de solución de bloqueo proporcionado en el kit a TA durante 30 min. </li><li> Se lava la membrana con MABT (MAB que contiene 1% de Tween 20) y aplicar 40 l de la solución de NBT / BCIP mezclado con 2 ml de tampón de detección (0,1 M Tris-HCl, NaCl 0,1 M, 0,05 M MgCl 2, pH 9,5) en el membrana durante 1 min. Si la sensibilidad de la sonda marcada esno satisfactoria, repita los pasos de 1.1.3 a 1.3.4. </li><li> Medir la concentración de ADN de la sonda marcada (OD260) y ajustar la concentración a 100 ng l -1. </li></ol></li><li> Compruebe la especificidad de la sonda marcada con DIG <ol><li> Desnaturalizar muestras de ADN genómico (25 ng de 3 l -1 por cada muestra) a partir de diversas especies bacterianas, incluyendo la bacteria blanco de la sonda específica, a 95 ° C durante 10 min y enfriar rápidamente en hielo. </li><li> Cargar manualmente el ADN desnaturalizado en la membrana de nylon y seco durante 20 min a TA. </li><li> Brevemente empapar la membrana en tampón 2x ​​SSC y se incuba la membrana a 80 ° C durante 2 horas para inmovilizar el ADN. </li><li> Bloquear la membrana con una solución de bloqueo a TA durante 1 hr. </li><li> Diluir la sonda a 1 ng l -1 en tampón de hibridación, desnaturalizar las sondas diluidas, y aplicar sobre la membrana. </li><li> Incubar la membrana a 45 ° C durante 1 hr. </li><li> Lavar la membrana de tresveces con tampón SSC 2x. </li><li> Brevemente remojo la membrana en el MAB. </li><li> Incubar con el anticuerpo anti-DIG AP-conjugado diluido (1: 2000) en 6 ml de solución de bloqueo a TA durante 1 hr. </li><li> Se lava la membrana con MABT y aplicar 40 l de la solución de NBT / BCIP mezclado con 2 ml de tampón de detección. </li><li> Cuando la sonda no logra la especificidad esperada, aumentar la temperatura de hibridación hasta que se observa la especificidad. </li></ol></li></ol> 2. Hibridación in situ Nota: Para evitar el secado de las muestras y reactivos, realice todas las incubaciones en una cámara húmeda llena de toallas de papel húmedas. <ol><li> De-paraffinization y la rehidratación de secciones de tejido <ol><li> Preparar 4 micras secciones de tejidos gruesos de los bloques incluidos en parafina. Formalina, paraformaldehído y fijador a base de zinc son compatibles con este protocolo. </li><li> Preparar todos los reactivos con agua tratada con DEPC. </li><li> Diapositivas de calor en un horno seco a 60 ° C durante 30 min y Incubar los portaobjetos a TA durante 30 min. </li><li> Sumergir los portaobjetos en 100% xileno durante 5 minutos tres veces; utilizar xileno nuevo cada vez. Nota: Realice este procedimiento de-encerado en una campana de extracción química. </li><li> Sumergir los portaobjetos en etanol al 100% durante 5 min dos veces, el uso de etanol fresco cada vez, y rehidratar especímenes en serie 90%, 80% y 70% de soluciones de etanol durante 5 min cada uno. </li><li> Sumergir los portaobjetos en agua tratada con DEPC por 1 min y lavar los portaobjetos en PBS tratada con DEPC (pH 7,4) durante 6 min. </li></ol></li><li> Pretratamientos de secciones de tejido <ol><li> Sumergir los portaobjetos en ácido clorhídrico 0,1 N durante 20 minutos y lavar los portaobjetos en agua tratada con DEPC durante 30 segundos. </li><li> Dibuja una barrera hidrofóbica rodea especímenes utilizando un lápiz de cera. Nota: El tamaño de la barrera hidrofóbica depende del tamaño de las muestras. Por lo tanto, los volúmenes de reactivos utilizados en los siguientes pasos varían dependiendo del tamaño de las muestras, pero tienen que llenar el HYbarrera drophobic (50 l para los pequeños especímenes y 400 l de grandes ejemplares). </li><li> Tratar especímenes con 50 a 400 l de proteinasa K (1 a 10 mg ml -1 en PBS tratada con DEPC) en un horno seco a 37 ° C durante 30 min y lavar los portaobjetos en PBS tratada con DEPC 1x durante 1 min. </li><li> Remojar los portaobjetos en 4% de paraformaldehído en PBS tratada con DEPC durante 10 min, a continuación, lavar los portaobjetos en PBS tratada con DEPC por 1 min. </li><li> Remojar las diapositivas en 0,1 M de trietanolamina-HCl (pH 8,0) que contenía anhídrido acético 0,5% durante 20 min y lavar los portaobjetos en agua tratada con DEPC para 30 seg. </li></ol></li><li> La hibridación con la sonda y el lavado <ol><li> Sumergir los portaobjetos en tampón SSC 2x durante 20 min. </li><li> Diluir la sonda a 1 ng l -1 en tampón de hibridación (4x SSC, 50% [vol / vol] formamida, 1X solución de Denhardt, 10% [p / v] sulfato de dextrano, 0,1% [peso / vol] de dodecil sulfato de sodio, 0,4 mg ml -1 de ADN de esperma de salmón). Para los controles negativos, mezclar la sonda marcada conuna cantidad en exceso de 10 veces de sonda no marcada. </li><li> Desnaturalizar las sondas diluidas y aplicar 50 a 400 l en secciones de tejido. Coloque una hoja de la cubierta de la diapositiva y sellar con esmalte de uñas. </li><li> Diapositivas de calor en la máquina PCR a 90 ° C durante 10 minutos e incubar los portaobjetos en una cámara húmeda O / N a 45 ° C o temperatura óptima determinada en el paso 1.4.11. </li><li> Enfriar las diapositivas a 4 ° C durante 30 minutos, retire cubreobjetos, y sumergir los portaobjetos en un tampón SSC serie como followings: 4x SSC durante 10 minutos, precalentado (45 ° C) 2x SSC durante 20 minutos, 2x SSC durante 10 min, y 0,2x SSC durante 10 min. </li></ol></li><li> Detección con anticuerpo anti-DIG conjugado AP- <ol><li> Lave las diapositivas en MABT durante 5 min. </li><li> Bloque con 50 a 400 l de solución de bloqueo con 1% de Tween 20 durante 20 min. </li><li> Añadir 50 a 400 l de anticuerpo anti-DIG-AP diluidos en solución de bloqueo (1: 1000) anld incubar a 37 ° C durante 90 min. </li><li> Lave las diapositivas en MABT durante 10 min. </li> &lt;li&gt; Sumergir los portaobjetos en tampón de detección que contiene 1% de Tween 20 durante 5 min. </li><li> Tratar con 50 a 400 μ de levamisol 1 mM (en tampón de detección que contiene 1% de Tween 20) durante 5 min para inactivar la fosfatasa alcalina endógena. </li><li> Distribuir 50 a 400 l de la solución premezclada NBT / BCIP (diluido en tampón de detección a 1: 100) en cada muestra e incubar los portaobjetos en una cámara humidificada a temperatura ambiente durante 2 a 3 horas hasta que la señal desarrollado es satisfactoria. </li><li> Enjuagar portaobjetos con agua desionizada para detener la visualización y aplicar 50 a 400 l de 0,05% [peso / vol] verde de metilo como una mancha contador a 37 ° C durante 10 min. </li><li> Enjuague diapositivas con agua desionizada, se deshidratan en etanol al 100%, y sumergirse en xileno. </li><li> Aplique 80 l de solución de montaje en cada diapositiva y cubrir con cubreobjetos. </li></ol></li></ol>

<ol>
	<li>Takarada, H., Cattoni, M., Sugimoto, A., Rose, G. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+studies+of+human+gingiva.+II.+The+lower+part+of+the+pocket+epithelium+in+chronic+periodontitis.">Ultrastructural studies of human gingiva. II. The lower part of the pocket epithelium in chronic periodontitis.</a> J. Periodontol. 45 (3), 155-169 (1974).</li><li>Allenspach-Petrzilka, G. E., Guggenheim, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+invasion+of+the+periodontium;+an+important+factor+in+the+pathogenesis+of+periodontitis.">Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis.</a> J. Clin. Periodontol. 10 (6), 609-617 (1983).</li><li>Saglie, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+bacteria+in+the+oral+epithelium+in+periodontal+disease.+II.+Immunohistochemical+identification+of+bacteria.">The presence of bacteria in the oral epithelium in periodontal disease. II. Immunohistochemical identification of bacteria.</a> J. Periodontol. 57 (8), 492-500 (1986).</li><li>Christersson, L. A., Albini, B., Zambon, J. J., Wikesj&#246;, U. M., Genco, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+localization+of+Actinobacillus+actinomycetemcomitans.+in+human+periodontitis.+I.+Light,+immunofluorescence+and+electron+microscopic+studies.">Tissue localization of Actinobacillus actinomycetemcomitans. in human periodontitis. I. Light, immunofluorescence and electron microscopic studies.</a> J. Periodontol. 58 (8), 529-539 (1987).</li><li>Saglie, F. R., Pertuiset, J., Rezende, M. T., Nestor, M., Marfany, A., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+correlative+immuno-identification+of+mononuclear+infiltrates+and+invasive+bacteria+in+diseased+gingiva.">In situ. correlative immuno-identification of mononuclear infiltrates and invasive bacteria in diseased gingiva.</a> J. Periodontol. 59 (10), 688-696 (1988).</li><li>Rautemaa, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Porphyromonas+gingivalis.+thiol+proteinase+in+periodontal+tissues+of+chronic+periodontitis+patients.">Intracellular localization of Porphyromonas gingivalis. thiol proteinase in periodontal tissues of chronic periodontitis patients.</a> Oral Dis. 10 (5), 298-305 (2004).</li><li>Marttila, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Treponema+denticola.+chymotrypsin-like+proteinase+in+chronic+periodontitis.">Intracellular localization of Treponema denticola. chymotrypsin-like proteinase in chronic periodontitis.</a> J. Oral Microbiol. 6, (2014).</li><li>Colombo, A. V., da Silva, C. M., Haffajee, A., Colombo, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+oral+species+within+human+crevicular+epithelial+cells+from+subjects+with+chronic+periodontitis+by+fluorescence+in+situ.+hybridization.">Identification of intracellular oral species within human crevicular epithelial cells from subjects with chronic periodontitis by fluorescence in situ. hybridization.</a> J. Periodontal Res. 42 (3), 236-243 (2007).</li><li>Abrams, K., Caton, J., Polson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histologic+comparisons+of+interproximal+gingival+tissues+related+to+the+presence+or+absence+of+bleeding.">Histologic comparisons of interproximal gingival tissues related to the presence or absence of bleeding.</a> J. Periodontol. 55 (11), 629-632 (1984).</li><li>Kim, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presence+of+Porphyromonas+gingivalis.+and+plasma+cell+dominance+in+gingival+tissues+with+periodontitis.">Presence of Porphyromonas gingivalis. and plasma cell dominance in gingival tissues with periodontitis.</a> Oral Dis. 16 (4), 375-381 (2010).</li><li>Choi, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porphyromonas+gingivalis.+and+dextran+sodium+sulfate+induce+periodontitis+through+the+disruption+of+physical+barriers.">Porphyromonas gingivalis. and dextran sodium sulfate induce periodontitis through the disruption of physical barriers.</a> Eur. J. Inflammation. 10, 419-431 (2013).</li><li>Choi, Y. S., Kim, Y. C., Ji, S., Choi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+bacterial+invasion+and+differential+expression+of+tight+junction+proteins,+growth+factors,+and+growth+factor+receptors+in+periodontal+lesions.">Increased bacterial invasion and differential expression of tight junction proteins, growth factors, and growth factor receptors in periodontal lesions.</a> J. Periodontol. 85 (8), e313-e322 (2014).</li><li>Baker, G. C., Smith, J. J., Cowan, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+re-analysis+of+domain-specific+16S+primers.">Review and re-analysis of domain-specific 16S primers.</a> J. Microbiol. Methods. 55 (3), 541-555 (2003).</li><li>Hajishengallis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Low-abundance+biofilm+species+orchestrates+inflammatory+periodontal+disease+through+the+commensal+microbiota+and+the+complement.">A Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and the complement.</a> Cell Host Microbe. 10 (5), 497-506 (2011).</li><li>Axon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastric+cancer+and+Helicobacter+pylori.">Gastric cancer and Helicobacter pylori.</a> Aliment. Pharmacol. Ther. 16 (suppl. 4), 83-88 (2002).</li><li>Fenhalls, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+detection+of+Mycobacterium+tuberculosis+transcripts+in+human+lung+granulomas+reveals+differential+gene+expression+in+necrotic+lesions.">In situ. detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions.</a> Infect. Immun. 70 (11), 6330-6338 (2002).</li></ol>

Los autores no tienen nada que revelar.

Aquí un protocolo para localizar las bacterias dentro de los tejidos embebidos en parafina utilizando una sonda de ADN marcada con DIG que se ha descrito. La sonda se dirige a las moléculas de ADN o ARN de origen bacteriano gen 16S rRNA, y las sondas de ARNr 16S-direccionamiento puede ser diseñado como cualquiera de las especies-específico o universal. La hibridación específica de la P. sonda específico de gingivalis a P. gingivalis pero no a otras bacterias orales se ha demostrado prev...

Las bacterias desempeñan un papel en la etiología de diversas enfermedades orales tales como periodontitis, pulpitis, pericoronitis, celulitis, y osteomielitis. Con el fin de comprender el papel de las bacterias en la patogénesis de la enfermedad y para controlar el efecto de los tratamientos, la localización de las bacterias dentro del tejido es importante. La presencia de bacterias en el tejido gingival de pacientes con periodontitis se ha demostrado usando varios métodos, incluyendo microscopía electrónica de 1,2, inmunohistoquímica e inmunofluorescencia utilizando anticuerpos específicos de bacterias 3-7, y la hibridación fluorescente in situ (FISH) usando un 8 por fluorescencia sonda de oligonucleótido marcada orientación 16S rRNA. Sin embargo, estos métodos no son ampliamente utilizados debido a la limitación técnica o dificultades. En comparación con anticuerpos, sondas dirigidas a 16S rRNA son fáciles de producir y lograr especificidad de especie. FISH ha demostrado ser una excelente herramienta para la visualización de bacteria en sus entornos naturales como el biofilm de la placa. Sin embargo, la aplicación de FISH a las muestras de tejido es limitado debido a la autofluorescencia de los diversos componentes del tejido. Por ejemplo, el fuerte autofluorescencia de las células rojas de la sangre a menudo dificulta la aplicación de la tecnología de fluorescencia para los tejidos inflamados cuando implican sangrado 9. Con el fin de localizar las bacterias dentro de los tejidos gingivales inflamados, por lo tanto, un método de hibridación in situ utilizando un digoxigenina (DIG) sonda de ADN marcada con se ha desarrollado y aplicado con éxito 10,11. Aquí un protocolo detallado para la localización de las bacterias dentro de los tejidos incluidos en parafina utilizando P. gingivalis sondas específicos de eubacterial y universales se ha descrito. Se centra sobre todo en la estandarización del método de manera que resultados similares se pueden reproducir en otros laboratorios. Este protocolo permite la localización de las bacterias dentro de su contexto histológico y el results son altamente reproducible. El protocolo descrito se puede utilizar para localizar las bacterias ya sea de una manera específica de la especie o universal en varios tejidos. La sonda universal es especialmente útil para detectar bacterias en enfermedades polimicrobianas y para estudiar un posible papel de las bacterias en enfermedades en las que no se conoce el papel de las bacterias específicas.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Acetic anhydride</td>
			<td>Sigma</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr>
			<td>50% Dextran sulfate solution</td>
			<td>Millipore</td>
			<td>S4030</td>
			<td></td>
		</tr>
		<tr>
			<td>50X Denhardt&#8217;s solution</td>
			<td>Sigma</td>
			<td>D2532</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC</td>
			<td>Sigma</td>
			<td>P159220</td>
			<td></td>
		</tr>
		<tr>
			<td>DIG DNA labeling and detection kit</td>
			<td>Roche</td>
			<td>11 093 657 910</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Sigma</td>
			<td>F9037</td>
			<td></td>
		</tr>
		<tr>
			<td>ImmEdge&#8482; Pen</td>
			<td>Dako</td>
			<td>H-400</td>
			<td></td>
		</tr>
		<tr>
			<td>Levamisole</td>
			<td>Vector</td>
			<td>SP-5000</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride</td>
			<td>Sigma</td>
			<td>246964</td>
			<td></td>
		</tr>
		<tr>
			<td>Maleic acid</td>
			<td>Sigma</td>
			<td>M0375</td>
			<td></td>
		</tr>
		<tr>
			<td>Methyl green</td>
			<td>Sigma</td>
			<td>M6776</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde</td>
			<td>Sigma</td>
			<td>P1648</td>
			<td></td>
		</tr>
		<tr>
			<td>Permount</td>
			<td>Fisher</td>
			<td>SP15-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Salmon sperm DNA solution</td>
			<td>Invitrogen</td>
			<td>#15632-011</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Sigma</td>
			<td>S9625</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium citrate</td>
			<td>Duksan</td>
			<td>D1420</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium dodecyl sulfate</td>
			<td>Amresco</td>
			<td>227</td>
			<td></td>
		</tr>
		<tr>
			<td>Triethanolamine-HCl</td>
			<td>Sigma</td>
			<td>90279</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Research organics</td>
			<td>3098T</td>
			<td></td>
		</tr>
	</tbody>
</table>

in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been reported using various methods, including electron microscopy, immunohistochemistry or immunofluorescence using bacteria-specific antibodies, and fluorescent in situ hybridization (FISH) using a fluorescence-labeled oligonucleotide probe. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled DNA probes has been introduced. The paraffin-embedded tissues are the most common form of biopsy tissues available from pathology banks. Bacteria can be detected either in a species-specific or universal manner. Bacterial signals are detected as either discrete forms (coccus, rod, fusiform, and hairy form) of bacteria or dispersed forms. The technique allows other histological information to be obtained: the epithelia, connective tissue, inflammatory infiltrates, and blood vessels are well distinguished. This method can be used to study the role of bacteria in various diseases, such as periodontitis, cancers, and inflammatory immune diseases.

La Figura 1 muestra dot blotting de sondas marcadas con DIG en comparación con la sonda de control positivo proporcionado en el kit para determinar su sensibilidad. El 343 pb P. sonda específico de gingivalis es 25 veces más sensible que la sonda eubacterial 70 pb. La Figura 2 muestra la hibridación in situ de los tejidos gingivales obtenidas de pacientes con periodontitis crónica para la detección de P. gingivalis y eubacterias. Las señales ba...

Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

La detección in situ de las bacterias dentro de los tejidos embebidos en parafina utilizando un ADN sonda digoxina marcada focalización 16S rRNA

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been ...

in-situ-detection-bacteria-within-paraffin-embedded-tissues-using

Research

JoVE Journal

Immunology and Infection

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

10.9K vistas.  School of Dentistry and Dental Research Institute, Seoul National University. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

Video: In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in situ hybridization (FISH) for rapid culture-independent detection of Salmonella spp. Cell-charged tapes can also be placed face-down on selective agar for solid-phase enrichment prior to detection. Alternatively, low-volume liquid enrichments (liquid surface miniculture) can be performed on the surface of the tape in non-selective broth, followed by FISH and analysis via flow cytometry. To begin, sterile adhesive tape is brought into contact with fresh produce, gentle pressure is applied, and the tape is removed, physically extracting microbes present on these surfaces. Tapes are mounted sticky-side up onto glass microscope slides and the sampled cells are fixed with 10% formalin (30 min) and dehydrated using a graded ethanol series (50, 80, and 95%; 3 min each concentration). Next, cell-charged tapes are spotted with buffer containing a Salmonella-targeted DNA probe cocktail and hybridized for 15 - 30 min at 55&deg;C, followed by a brief rinse in a washing buffer to remove unbound probe. Adherent, FISH-labeled cells are then counterstained with the DNA dye 4',6-diamidino-2-phenylindole (DAPI) and results are viewed using fluorescence microscopy. For solid-phase enrichment, cell-charged tapes are placed face-down on a suitable selective agar surface and incubated to allow in situ growth of Salmonella microcolonies, followed by FISH and microscopy as described above. For liquid surface miniculture, cell-charged tapes are placed sticky side up and a silicone perfusion chamber is applied so that the tape and microscope slide form the bottom of a water-tight chamber into which a small volume (&le; 500 &mu;L) of Trypticase Soy Broth (TSB) is introduced. The inlet ports are sealed and the chambers are incubated at 35 - 37&deg;C, allowing growth-based amplification of tape-extracted microbes. Following incubation, inlet ports are unsealed, cells are detached and mixed with vigorous back and forth pipetting, harvested via centrifugation and fixed in 10% neutral buffered formalin. Finally, samples are hybridized and examined via flow cytometry to reveal the presence of Salmonella spp. As described here, our "tape-FISH" approach can provide simple and rapid sampling and detection of Salmonella on tomato surfaces. We have also used this approach for sampling other types of fresh produce, including spinach and jalape&ntilde;o peppers.

Combination of Adhesive-tape-based Sampling and Fluorescence in situ Hybridization for Rapid Detection of Salmonella on Fresh Produce

This protocol describes a simple adhesive-tape-based approach for sampling of tomato and other fresh produce surfaces, followed by rapid whole cell detection of Salmonella using fluorescence in situ hybridization (FISH).

Combinación de adhesivo basado en cinta de muestreo y de fluorescencia In situ La hibridación para la detección rápida de Salmonella En los productos frescos

This protocol describes a simple approach for adhesive-tape-based sampling of tomato and other fresh produce surfaces, followed by on-tape fluorescence in ...

Investigación

Inmunología e Infección

ampliPHOX Colorimetric Detection on a DNA Microarray for Influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5 For instance, many examples of the ability to type and subtype influenza virus have been demonstrated.6-11 The identification and subtyping of influenza on DNA microarrays has applications in both public health and the clinic for early detection, rapid intervention, and minimizing the impact of an influenza pandemic. Traditional fluorescence is currently the most commonly used microarray detection method. However, as microarray technology progresses towards clinical use,1 replacing expensive instrumentation with low cost detection technology exhibiting similar performance characteristics to fluorescence will make microarray assays more attractive and cost-effective.
The ampliPHOX colorimetric detection technology is intended for research applications, and has a limit of detection within one order of magnitude of traditional fluorescence11, with a main advantage being an approximate ten-fold lower instrument cost compared to the confocal microarray scanners required for fluorescence microarray detection. Another advantage is the compact size of the instrument which allows for portability and flexibility, unlike traditional fluorescence instruments. Because the polymerization technology is not as inherently linear as fluorescence detection, however, it is best suited for lower density microarray applications in which a yes/no answer for the presence of a certain sequence is desired, such as for pathogen detection arrays. Currently the maximum spot density compatible with ampliPHOX detection is &tilde;1800 spots/array. Because of the spot density limitations, higher density microarrays are not suitable for ampliPHOX detection.
Here, we present ampliPHOX colorimetric detection technology as a method of signal amplification on a low density microarray developed for the detection and characterization of influenza viruses (FluChip). Although this protocol uses the FluChip (a DNA microarray) as one specific application of ampliPHOX detection, any microarray incorporating biotinylated target can be labeled and detected in a similar manner. The microarray design and biotinylation of the target to be captured are the responsibility of the user. Once the biotinylated target has been captured on the array, ampliPHOX detection can be performed by first tagging the array with a streptavidin-label conjugate (ampliTAG). Upon light exposure using the ampliPHOX Reader instrument, polymerization of a monomer solution (ampliPHY) occurs only in regions containing ampliTAG-labeled targets. The polymer formed can be subsequently stained with a non-toxic solution to improve visual contrast, followed by imaging and analysis using a simple software package (ampliVIEW). The entire FluChip assay from un-extracted sample to result can be performed in about 6 hours, and the ampliPHOX detection steps described above can be completed in about 30 min.

ampliPHOX colorimetric detection technology is presented as an inexpensive alternative to fluorescence detection for microarrays. Based on photopolymerization, ampliPHOX produces solid polymer spots visible to the naked eye in just a few minutes. Results are then imaged and automatically interpreted with a simple yet powerful software package.

ampliPHOX colorimétrico de detección de un microarray de ADN para la influenza

DNA microarrays have emerged as a powerful tool for pathogen detection.1-5  For instance, many examples of the ability to type and subtype influenza virus ...

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Multiplex detección de bacterias en el complejo de muestras clínicas y ambientales utilizando oligonucleótidos de acoplamiento de microesferas fluorescentes

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

La detección de bacterias mediante ADNzimas fluorogénicos

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

Fluorescence in situ Hybridizations (FISH) for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells and can be further modified to visualize other components in the cell such as infection with viruses and bacteria. Spatial localization and visualization of viruses and bacteria during the infection process is an essential step that complements expression profiling experiments such as microarrays and RNAseq in response to different stimuli. Understanding the spatiotemporal infections with these agents complements biological experiments aimed at understanding their interaction with cellular components. Several techniques for visualizing viruses and bacteria such as reporter gene systems or immunohistochemical methods are time-consuming, and some are limited to work with model organisms&#160;and involve complex methodologies. FISH that targets RNA or DNA species in the cell is a relatively easy and fast method for studying spatiotemporal localization of genes and for diagnostic purposes. This method can be robust and relatively easy to implement when the protocols employ short hybridizing, commercially-purchased probes, which are not expensive. This is particularly robust when sample preparation, fixation, hybridization, and microscopic visualization do not involve complex steps. Here we describe a protocol for localization of bacteria and viruses in insect and plant tissues. The method is based on simple preparation, fixation, and hybridization of insect whole mounts and dissected organs or hand-made plant sections, with 20 base pairs short DNA probes conjugated to fluorescent dyes on their 5&#39; or 3&#39; ends. This protocol has been successfully applied to a number of insect and plant tissues, and can be used to analyze expression of mRNAs or other RNA or DNA species in the cell.

Fluorescence in situ Hybridizations FISH for the Localization of Viruses and Endosymbiotic Bacteria in Plant and Insect Tissues

We describe here a simple fluorescence in situ hybridization (FISH) method for the localization of viruses and bacteria in insect and plant tissues. This protocol can be extended for the visualization of mRNA in whole mount and microscopic sections.

Fluorescencia<em&gt; In situ</em&gt; Las hibridaciones (FISH) para la localización de los virus y las bacterias endosimbióticas en plantas e insectos tejidos

Fluorescence in situ hybridization (FISH) is a name given to a variety of techniques commonly used for visualizing gene transcripts in eukaryotic cells ...

Rapid Identification of Gram Negative Bacteria from Blood Culture Broth Using MALDI-TOF Mass Spectrometry

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional identification requires the sub-culture of signaled blood culture broth with identification available only after colonies on solid agar have matured. MALDI-TOF MS is a reliable, rapid method for identification of the majority of clinically relevant bacteria when applied to colonies on solid media. The application of MALDI-TOF MS directly to blood culture broth is an attractive approach as it has potential to accelerate species identification of bacteria and improve clinical management. However, an important problem to overcome is the pre-analysis removal of interfering resins, proteins and hemoglobin&#160;contained in blood culture specimens which, if not removed, interfere with the MS spectra and can result in insufficient or low discrimination identification scores. In addition it is necessary to concentrate bacteria to develop spectra of sufficient quality. The presented method describes the concentration, purification, and extraction of Gram negative bacteria allowing for the early identification of bacteria from a signaled blood culture broth.

The application of matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometry (MS) directly to blood culture broth expedites the identification of bacteria. The presented method is a rapid and reliable method for identification of Gram negative bacteria directly from blood culture broth.

La identificación rápida de bacterias gram negativas de Cultura sangre caldo de cultivo utilizando MALDI-TOF espectrometría de masas

An important role of the clinical microbiology laboratory is to provide rapid identification of bacteria causing bloodstream infection. Traditional ...

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin proteolipid protein (PLP) 139-151-induced experimental autoimmune encephalomyelitis (EAE) in SJL mice and cardiac myosin heavy chain-&#945; (Myhc) 334-352-induced experimental autoimmune myocarditis (EAM) in A/J mice. Two sets of cocktails of dextramer reagents were used, where dextramers+ cells were analyzed by laser scanning confocal microscope (LSCM): EAE, IAs/PLP 139-151 dextramers (specific)/anti-CD4 and IAs/Theiler&#8217;s murine encephalomyelitis virus (TMEV) 70-86 dextramers (control)/anti-CD4; and EAM, IAk/Myhc 334-352 dextramers/anti-CD4 and IAk/bovine ribonuclease (RNase) 43-56 dextramers (control)/anti-CD4. LSCM analysis of brain sections obtained from EAE mice showed the presence of cells positive for CD4 and PLP 139-151 dextramers, but not TMEV 70-86 dextramers suggesting that the staining obtained with PLP 139-151 dextramers was specific. Likewise, heart sections prepared from EAM mice also revealed the presence of Myhc 334-352, but not RNase 43-56-dextramer+ cells as expected. Further, a comprehensive method has also been devised to quantitatively analyze the frequencies of antigen-specific CD4 T cells in the &#8216;Z&#8217; serial images.

In Situ Detection of Autoreactive CD4 T Cells in Brain and Heart Using Major Histocompatibility Complex Class II Dextramers

The protocol to detect self-reactive CD4 T cells in brain and heart by direct staining with major histocompatibility complex class II dextramers has been described in this report. For comprehensive analysis, a reliable method to enumerate the frequencies of antigen-specific CD4+ T cells in situ is also devised.

La detección in situ de las células T CD4 Autoreactive en Cerebro y Corazón Uso Mayor de Histocompatibilidad clase II Dextramers

This report demonstrates the use of major histocompatibility complex (MHC) class II dextramers for detection of autoreactive CD4 T cells in situ in myelin ...

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most common microdissection technique used today. In this technique, a laser is used to focally melt a thermoplastic membrane that overlies a dehydrated tissue section1. The tissue section composite is then lifted and separated from the membrane. Although this technique can be used successfully for tissue examination, it is time consuming and expensive. Furthermore, the successful completion of procedures using this technique requires the use of a laser, thus limiting its use. A new more affordable and practical microdissection approach called mesodissection is a possible solution to the pitfalls of LCM. This technique employs the MESO-1/MeSectr system to mill the desired tissue from a slide mounted tissue sample while concurrently dispensing and aspirating fluid to recover the desired tissue sample into a consumable mill bit. Before the dissection process begins, the user aligns the formalin fixed paraffin embedded (FFPE) slide with a hematoxylin and eosin stained (H&#38;E) reference slide. Thereafter, the operator annotates the desired dissection area and proceeds to dissect the appropriate segment. The program generates an archived image of the dissection. The main advantage of mesodissection is the short duration needed to dissect a slide, taking an average of ten minutes from set up to sample generation in this experiment. Additionally, the system is significantly more cost effective and user friendly. A slight disadvantage is that it is not as precise as laser capture microscopy. In this article we demonstrate how mesodissection can be used to extract RNA from slides from FFPE granulomas caused by Mycobacterium tuberculosis (Mtb).

A Novel Microdissection Approach to Recovering Mycobacterium tuberculosis Specific Transcripts from Formalin Fixed Paraffin Embedded Lung Granulomas

Microdissection has been extensively employed for the examination of DNA, RNA, and protein within tissue. Laser capture microscopy (LCM) is the most commonly used method, but a new milling technique, mesodissection, is recently available. We demonstrate RNA extraction from mesodissected formalin fixed paraffin embedded tissue slides of Mycobacterium tuberculosis granulomas.

Un nuevo enfoque para la recuperación Microdissection<em&gt; Mycobacterium tuberculosis</em&gt; Las transcripciones específicas de formalina parafina fijo Embedded pulmón granulomas

Microdissection has been used for the examination of tissues at DNA, RNA, and protein levels for over a decade. Laser capture microscopy (LCM) is the most ...

Identification of Rare Bacterial Pathogens by 16S rRNA Gene Sequencing and MALDI-TOF MS

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in immunocompromised patients. In most cases only few data, mostly published as case reports, are available which investigate the role of such pathogens as an infectious agent. Therefore, in order to clarify the pathogenic character of such microorganisms, it is necessary to conduct epidemiologic studies which include large numbers of these bacteria. The methods used in such a surveillance study have to meet the following criteria: the identification of the strains has to be accurate according to the valid nomenclature, they should be easy to handle (robustness), economical in routine diagnostics and they have to generate comparable results among different laboratories. Generally, there are three strategies for identifying bacterial strains in a routine setting: 1) phenotypic identification characterizing the biochemical and metabolic properties of the bacteria, 2) molecular techniques such as 16S rRNA gene sequencing and 3) mass spectrometry as a novel proteome based approach. Since mass spectrometry and molecular approaches are the most promising tools for identifying a large variety of bacterial species, these two methods are described. Advances, limitations and potential problems when using these techniques are discussed.

Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) and molecular techniques (16S rRNA gene sequencing) permit the identification of rare bacterial pathogens in routine diagnostics. The goal of this protocol lies in the combination of both techniques which leads to more accurate and reliable data.

La identificación de patógenos bacterianos raras por 16S rRNA gen secuenciación y MALDI-TOF MS

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in ...

A Method for Targeted 16S Sequencing of Human Milk Samples

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as with all these technologies, reproducible results depend on a laboratory workflow that incorporates appropriate precautions and controls. This is particularly important with low-biomass samples where contaminating bacterial DNA can generate misleading results. This article details a semi-automated workflow to identify microbes from human breast milk samples using targeted sequencing of the 16S ribosomal RNA (rRNA) V4 region on a low- to mid-throughput scale. The protocol describes sample preparation from whole milk including: sample lysis, nucleic acid extraction, amplification of the V4 region of the 16S rRNA gene, and library preparation with quality control measures. Importantly, the protocol and discussion consider issues that are salient to the preparation and analysis of low-biomass samples including appropriate positive and negative controls, PCR inhibitor removal, sample contamination by environmental, reagent, or experimental sources, and experimental best practices designed to ensure reproducibility. While the protocol as described is specific to human milk samples, it is adaptable to numerous low- and high-biomass sample types, including samples collected on swabs, frozen neat, or stabilized in a preservation buffer.

A semi-automated workflow is presented for targeted sequencing of 16S rRNA from human milk and other low-biomass sample types.

Un método de secuenciación de 16S específica de las muestras de leche humana

Studies of microbial communities have become widespread with the development of relatively inexpensive, rapid, and high throughput sequencing. However, as ...