Name: in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna
Uploaded: 2015-05-21T13:00:00.000+00:00
Duration: 11 min 15 s
Description: Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

Bu çalışma Kore Ulusal Araştırma Vakfı hibe (2013R1A1A3005669) ve Kore Sağlık Teknoloji Ar-Ge Projesi, Sağlık ve Refah Bakanlığı hibe (HI13C0016) tarafından desteklenmiştir.

1. Probe Hazırlık <ol><li> Prob PCR amplifikasyonu <ol><li> P. gingivalis spesıfik prob, P. bir 343-bp DNA fragmanını çoğaltmak P. genomik DNA kullanılarak PCR ile gingivalis 16S rRNA gingivalis aşağıdaki primerler: 5&#39;-TGC AAC TTG CCT TAC AGA GG-3 &#39;ve 5&#39;-ACT ATC CGT CGT GCC TAT TC-3&#39; 10. Aşağıdaki döngü koşulları amplifikasyonlar yapın: 35 döngü 95 ° C&#39;de 30 saniye, 30 saniye için 60 ° C, ve 72 ° &#39;de 5 dakika uzatma ve ardından 1 dakika 20 saniye için 72 ° C C 10,11 için. </li><li> 70 bp&#39;lik bir DNA parçası (5&#39;-CAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAG kullanılarak eubacterial prob yükseltin TCCCGCAACGAGCGCAACCC-3 &#39;bir oligonükleotid aşağıdaki primerler olarak sentezlenir): 5&#39;-CAG CTG GTR CMT GGY-3&#39; 11 ve 5&#39;-AGG GTT GCG CTC GTT-3. Aşağıdaki döngü koşulları amplifikasyonlar gerçekleştirin: 40 döngüleri30 saniye için 30 saniye için 9 4 ° C, 60 ° C ve 1 dakika 72 ° C 11,12 sıcaklıkta 5 dakikalık bir uzatma ve ardından 20 saniye süreyle 72 ° C&#39;de. </li><li> Ve 2 saat boyunca -20 ° C&#39;de inkübe 3 M sodyum asetat (pH 5.2) ve (: 1: 2 oranında 10 de),% 100 etanol ilave edilerek PCR ürünleri (≥500 ul) hızlandırabilir. </li><li> Santrifüj karışım 15 dakika için 14,000 x g&#39;de, TE tamponu, 100 ul pelet tekrar süspansiyon ve 260 nm&#39;de optik yoğunluk ile DNA konsantrasyonu ölçülür. </li></ol></li><li> DIG DNA etiketleme ve saptama kiti kullanılarak DIG-etiketleme <ol><li> 15 ul bir son hacme su ile prob 3 ug karıştırın. </li><li> 10 dakika boyunca 95 ° C &#39;de DNA&#39;yı denatüre ve hızlı bir şekilde buz üzerine soğuk. </li><li> 10x heksanükleotid karışımı 2 ul dNTP etiketleme karışımı 2 ul ve denatüre edilmiş DNA 15 ul Klenow enzimi 1 ul ekle. </li><li> Karıştırın ve 48 saat için 24 saat boyunca 37 ° C&#39;de inkübe edin ve 65 ° C&#39;de ısıtma ile reaksiyonu durdurun. </li></ol></li><li> DIG DNA etiketleme ve saptama kiti kullanılarak DIG-etiketli prob duyarlılığını kontrol <ol><li> El ile oda sıcaklığında 5 dakika boyunca kitte sağlanan pozitif kontrol probu seri dilüsyonları 1 ul naylon membran üzerinde DIG etiketli prob 1 ng ve kuru yük. </li><li> Kısaca 2x SSC tamponu (0.3 M NaCI, 30 mM sodyum sitrat, pH 7.0) &#39;de membran ıslatın ve DNA immobilize etmek için 1 saat boyunca 80 ° C&#39; de membran inkübe edin. </li><li> Kısaca maleik asit tamponu (MAB, 0.1 M maleik asit, 0.15 M NaCI, pH 7.5) membran emmek ve anti-DIG alkalin fosfataz ile birleştirilmiş bayır antikoru seyreltildi (AP) ile inkübe: Resim bloke çözeltisi içinde 6 ml (1 5000) 30 dakika boyunca oda sıcaklığında kiti. </li><li> MABT (MAB% 1 Tween 20 ihtiva eden) ile zarın yıkanması ve üzerine 2 ml saptama tamponu (0.1 M Tris-HCI, 0.1 M NaCI, 0.05 M MgCl2, pH 9.5) ile karıştırılmıştır NBT / BCIP çözeltisi 40 ul geçerlidir 1 dakika için membran. Etiketlenmiş prob duyarlılığı isetatmin edici değil, 1.1.3 den 1.3.4 için adımları tekrarlayın. </li><li> Etiketli prob (OD260) DNA konsantrasyonu ölçülür ve ul ng 100 konsantrasyonunu ayarlamak -1. </li></ol></li><li> DIG-etiketli prob özgünlüğünü kontrol <ol><li> Genomik DNA örnekleri denatüre 10 dakika boyunca 95 ° C &#39;de, belirli bir prob hedef bakteri dahil olmak üzere çeşitli bakteri türlerinin gelen (25 3 ul -1, her numune başına ng) ve hızlı bir şekilde buz üzerinde soğuk. </li><li> El ile oda sıcaklığında 20 dakika için denatüre edilmiş naylon membran üzerine DNA ve kuru yük. </li><li> Kısaca 2x SSC tamponu membran ıslatın ve DNA immobilize etmek için 2 saat boyunca 80 ° C &#39;de membran inkübe edin. </li><li> 1 saat boyunca oda sıcaklığında bloke edici bir solüsyonuyla membran bloke. </li><li> Hibridizasyon tamponu içinde seyreltilmiş probları denatüre ve membran üzerine uygulanır ul -1 1 ng probu ile seyreltilir. </li><li> 1 saat süre ile 45 ° C &#39;de membran inkübe edin. </li><li> Zarın yıkanması Üç2x SSC tamponu ile kere. </li><li> Kısaca MAB membran ıslatın. </li><li> 1 saat boyunca oda sıcaklığında bloke etme çözeltisi içinde 6 ml (2.000 1) ile seyreltildi, anti-DIG AP-konjuge antikor ile inkübe edin. </li><li> MABT ile zarın yıkanması ve 2 ml saptama tamponu ile karıştırıldı NBT / BCIP çözeltisi 40 ul uygulanır. </li><li> Sonda beklenen özgüllük elde değil zaman özgünlüğü görülünceye kadar, melezleme sıcaklığını arttırın. </li></ol></li></ol> İn Situ Hibridizasyon 2. Not: örnekler ve reaktifler kurumayı önlemek ıslak kağıt havlu ile astarlanmış bir nemlendirilmiş oda içinde Bütün inkübasyonlar, gerçekleştirmek için. <ol><li> De-paraffinization ve doku bölümleri rehidrasyon <ol><li> Parafin bloklardan 4 mikron kalınlığında doku bölümleri hazırlayın. Formalin, paraformaldehit ve çinkoya-dayalı sabitleyici bu protokol ile uyumludur. </li><li> DEPC arıtılmış su kullanılarak tüm reaktifler hazırlayın. </li><li> 30 dakika boyunca 60 ° C &#39;de kuru bir fırın içinde ısı slaytlar ve 30 dakika boyunca oda sıcaklığında slaytlar inkübe edin. </li><li> 5 dakika üç kez% 100 ksilen slaytlar daldırın; Taze ksilen, her zaman kullanın. Not: Bir kimyasal davlumbaz, bu de-ağda işlemi yapın. </li><li> Iki kez 5 dakika% 100 etanol içinde slaytlar bırakın, her zaman taze etanol kullanılarak, ve her biri 5 dakika için seri% 90 örnekleri,% 80 ve% 70 etanol çözüm rehidrate. </li><li> 1 dakika süre ile, DEPC ile muamele edilmiş su içinde slaytlar daldırın ve 6 dakika boyunca DEPC ile muamele edilmiş, PBS (pH 7.4) içinde slaytlar yıkayın. </li></ol></li><li> Doku bölümlerinin ön işlemler <ol><li> 20 dakika için 0.1 N hidroklorik asit içinde slaytlar daldırın ve 30 saniye süreyle DEPC ile muamele edilmiş su içinde slaytlar yıkayın. </li><li> Bir mum kalem kullanarak örnekleri çevreleyen bir hidrofobik bariyer çizin. Not: bir hidrofobik bariyer boyutu örneklerinin büyüklüğüne bağlıdır. Bu nedenle, aşağıdaki aşamalarda kullanılan reaktif miktarları örneklerinin boyutuna bağlı olarak, ancak hy doldurmak zorunda değişirdrophobic bariyer (küçük numuneler için 50 ul ve büyük numuneler için 400 ul). </li><li> 30 dakika için 37 ° C &#39;de kuru bir fırında proteinaz K (1-10 ug mi -1 DEPC ile muamele edilmiş, PBS içinde) ve 50-400 ul numune tedavi ve 1 dakika boyunca DEPC ile muamele edilmiş 1 x PBS içinde slaytlar yıkayın. </li><li> 10 dakika boyunca DEPC ile muamele edilmiş, PBS içinde% 4 paraformaldehid içinde slaytlar bekletin, daha sonra 1 dakika boyunca DEPC ile muamele edilmiş, PBS slaytlar yıkayın. </li><li> 0.1 M trietanolamin-HCl, 20 dakika boyunca% 0.5 asetik anhidrit içeren (pH 8.0) slaytlar ıslatın ve 30 saniye için DEPC ile muamele edilmiş su içinde slaytlar yıkayın. </li></ol></li><li> Prob ve yıkama ile hibridizasyon <ol><li> 20 dakika boyunca 2x SSC tamponu slaytlar bırakın. </li><li> Hibridizasyon tamponu içinde ul -1 1 ng (4x SSC probu ile seyreltilir,% 50 [hacim / hacim] formamid, 1 x Denhardt çözeltisi,% 10 [ağırlık / hacim] dekstran sülfat,% 0.1 [ağr / hac], sodyum dodesil sülfat, 0.4 mg mi -1 salmon sperm DNA&#39;sı). Negatif kontroller için, ile etiketlenmiş prob karışımıolmayan işaretli prob, bir 10-kat fazla miktarda. </li><li> Seyreltilmiş probları denatüre ve doku bölümleri üzerine 50-400 ul uygulayın. Slaytta bir kapak kayma yerleştirin ve oje ile mühür. </li><li> 45 ° C veya en uygun ısıda nemlendirilmiş bir odacık O / N 10 dakika boyunca 90 ° C &#39;de, PCR makinesi ısı slaytlar ve inkübe slaytlar aşama 1.4.11 de tespit edilmiştir. </li><li> 30 dakika boyunca 4 ° C &#39;de slaytlar soğutun kapak slipi kaldırmak ve aşağıdaki gibi, bir seri SSC tamponu slaytlar sokmak: 4x SSC 10 dakika, önceden ısıtılmış (45 ° C) 2 x SSC, 20 dakika, 2 x SSC, 10 için dakika ve 10 dakika süre ile 0.2x SSC. </li></ol></li><li> Anti-DIG AP-konjüge edilmiş antikor ile tespit <ol><li> 5 dakika boyunca MABT slaytlar yıkayın. </li><li> 20 dakika boyunca,% 1 Tween 20 ile bloklama çözeltisi 50-400 ul engeller. </li><li> Çözeltisi (1: 1000) bloke içinde seyreltilmiş anti-DIP-AP antikoru 50-400 ul ekle anld 90 dakika boyunca 37 ° C&#39;de inkübe edin. </li><li> 10 dakika boyunca MABT slaytlar yıkayın. </li> &lt;li&gt; 5 dakika boyunca% 1 Tween 20 içeren algılama tamponu slaytlar bırakın. </li><li> Μ 1 mM levamisol endojen alkalin fosfataz inaktive edilmesi için 5 dakika için (% 1 Tween 20 içeren saptama tamponu içinde) 50-400 ile tedavi edin. </li><li> (1 bulgulama tamponu içinde seyreltilmiş 100) önceden karıştırılmış NBT / BCIP çözeltisi 50-400 ul dağıtma Her örnek üzerinde ve gelişmiş sinyal tatmin kadar 2 ila 3 saat boyunca oda sıcaklığında nemli bir haznede slaytlar inkübe edin. </li><li> Görselleştirme durdurmak ve 10 dakika için 37 ° C &#39;de% 0.05 bir karşı leke olarak [ağırlık / hacim] metil yeşili 50-400 ul uygulamak için de-iyonize edilmiş su ile slaytlar durulayın. </li><li> % 100 etanol içinde dehidre, de-iyonize su ile slaytlar durulayın ve ksilen batırın. </li><li> Her bir slayt üzerine montaj çözümü 80 ul uygulayın ve kapak slipleri ile kaplayın. </li></ol></li></ol>

<ol>
	<li>Takarada, H., Cattoni, M., Sugimoto, A., Rose, G. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+studies+of+human+gingiva.+II.+The+lower+part+of+the+pocket+epithelium+in+chronic+periodontitis.">Ultrastructural studies of human gingiva. II. The lower part of the pocket epithelium in chronic periodontitis.</a> J. Periodontol. 45 (3), 155-169 (1974).</li><li>Allenspach-Petrzilka, G. E., Guggenheim, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+invasion+of+the+periodontium;+an+important+factor+in+the+pathogenesis+of+periodontitis.">Bacterial invasion of the periodontium; an important factor in the pathogenesis of periodontitis.</a> J. Clin. Periodontol. 10 (6), 609-617 (1983).</li><li>Saglie, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+presence+of+bacteria+in+the+oral+epithelium+in+periodontal+disease.+II.+Immunohistochemical+identification+of+bacteria.">The presence of bacteria in the oral epithelium in periodontal disease. II. Immunohistochemical identification of bacteria.</a> J. Periodontol. 57 (8), 492-500 (1986).</li><li>Christersson, L. A., Albini, B., Zambon, J. J., Wikesj&#246;, U. M., Genco, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tissue+localization+of+Actinobacillus+actinomycetemcomitans.+in+human+periodontitis.+I.+Light,+immunofluorescence+and+electron+microscopic+studies.">Tissue localization of Actinobacillus actinomycetemcomitans. in human periodontitis. I. Light, immunofluorescence and electron microscopic studies.</a> J. Periodontol. 58 (8), 529-539 (1987).</li><li>Saglie, F. R., Pertuiset, J., Rezende, M. T., Nestor, M., Marfany, A., Cheng, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+correlative+immuno-identification+of+mononuclear+infiltrates+and+invasive+bacteria+in+diseased+gingiva.">In situ. correlative immuno-identification of mononuclear infiltrates and invasive bacteria in diseased gingiva.</a> J. Periodontol. 59 (10), 688-696 (1988).</li><li>Rautemaa, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Porphyromonas+gingivalis.+thiol+proteinase+in+periodontal+tissues+of+chronic+periodontitis+patients.">Intracellular localization of Porphyromonas gingivalis. thiol proteinase in periodontal tissues of chronic periodontitis patients.</a> Oral Dis. 10 (5), 298-305 (2004).</li><li>Marttila, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracellular+localization+of+Treponema+denticola.+chymotrypsin-like+proteinase+in+chronic+periodontitis.">Intracellular localization of Treponema denticola. chymotrypsin-like proteinase in chronic periodontitis.</a> J. Oral Microbiol. 6, (2014).</li><li>Colombo, A. V., da Silva, C. M., Haffajee, A., Colombo, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+oral+species+within+human+crevicular+epithelial+cells+from+subjects+with+chronic+periodontitis+by+fluorescence+in+situ.+hybridization.">Identification of intracellular oral species within human crevicular epithelial cells from subjects with chronic periodontitis by fluorescence in situ. hybridization.</a> J. Periodontal Res. 42 (3), 236-243 (2007).</li><li>Abrams, K., Caton, J., Polson, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histologic+comparisons+of+interproximal+gingival+tissues+related+to+the+presence+or+absence+of+bleeding.">Histologic comparisons of interproximal gingival tissues related to the presence or absence of bleeding.</a> J. Periodontol. 55 (11), 629-632 (1984).</li><li>Kim, Y. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presence+of+Porphyromonas+gingivalis.+and+plasma+cell+dominance+in+gingival+tissues+with+periodontitis.">Presence of Porphyromonas gingivalis. and plasma cell dominance in gingival tissues with periodontitis.</a> Oral Dis. 16 (4), 375-381 (2010).</li><li>Choi, Y. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Porphyromonas+gingivalis.+and+dextran+sodium+sulfate+induce+periodontitis+through+the+disruption+of+physical+barriers.">Porphyromonas gingivalis. and dextran sodium sulfate induce periodontitis through the disruption of physical barriers.</a> Eur. J. Inflammation. 10, 419-431 (2013).</li><li>Choi, Y. S., Kim, Y. C., Ji, S., Choi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Increased+bacterial+invasion+and+differential+expression+of+tight+junction+proteins,+growth+factors,+and+growth+factor+receptors+in+periodontal+lesions.">Increased bacterial invasion and differential expression of tight junction proteins, growth factors, and growth factor receptors in periodontal lesions.</a> J. Periodontol. 85 (8), e313-e322 (2014).</li><li>Baker, G. C., Smith, J. J., Cowan, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review+and+re-analysis+of+domain-specific+16S+primers.">Review and re-analysis of domain-specific 16S primers.</a> J. Microbiol. Methods. 55 (3), 541-555 (2003).</li><li>Hajishengallis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Low-abundance+biofilm+species+orchestrates+inflammatory+periodontal+disease+through+the+commensal+microbiota+and+the+complement.">A Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and the complement.</a> Cell Host Microbe. 10 (5), 497-506 (2011).</li><li>Axon, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastric+cancer+and+Helicobacter+pylori.">Gastric cancer and Helicobacter pylori.</a> Aliment. Pharmacol. Ther. 16 (suppl. 4), 83-88 (2002).</li><li>Fenhalls, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ.+detection+of+Mycobacterium+tuberculosis+transcripts+in+human+lung+granulomas+reveals+differential+gene+expression+in+necrotic+lesions.">In situ. detection of Mycobacterium tuberculosis transcripts in human lung granulomas reveals differential gene expression in necrotic lesions.</a> Infect. Immun. 70 (11), 6330-6338 (2002).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Burada bir protokol tarif edilmiştir, DIG etiketli bir DNA probu kullanılarak parafine gömülü doku içindeki bakteri yerelleştirilmesine. Prob bakteriyel 16S rRNA geninin DNA ya da RNA moleküllerini hedef ve 16S rRNA hedefleme problar ya da türe spesifik ya da evrensel olarak dizayn edilebilir. P. spesifik hibridizasyon P. gingivalis -spesifik prob gingivalis ancak diğer ağız bakterileri daha önce 10 gösterilmiştir. Hibridizasyon etkinliği 12 farklı olsa d...

Bakteriler gibi periodontitis, pulpitis, Perikoronitis, selülit ve osteomyelit gibi çeşitli ağız hastalıklarının etiyolojisinde rol oynarlar. Hastalığın patojenezinde bakteri rolünü anlamak ve tedavilerin etkisini izlemek amacıyla, doku içindeki bakterilerin yeri önemlidir. periodontitis olan hastalardan alınan dişeti dokusu içinde bakterilerin varlığı Floresan-kullanarak, in situ hibridizasyon (FISH) 8 elektron mikroskobu 1,2, immünohistokimya ve immünofloresan kullanılarak bakterilerin spesifik antikorlar 3-7, ve floresan dahil olmak üzere çeşitli yöntemler kullanılarak gösterilmiştir 16S rRNA hedef etiketli oligonükleotid prob. Bununla birlikte, bu yöntemler yaygın nedeni, teknik sınırlama veya zorluklara kullanılmamaktadır. Antikorlar ile karşılaştırıldığında, 16S rRNA hedefleme probları üretmek ve tür spesifikliğini elde etmek kolaydır. BALIK Bact görüntülenmesi için mükemmel bir araç olduğunu kanıtlamıştırBöyle plak biyofilm olarak kendi doğal ortamlarında eria. Bununla birlikte, doku numunelerini, FISH uygulanması nedeniyle çeşitli doku bileşenlerinin otofloresansı sınırlıdır. Bunlar 9 kanama barındırır, örneğin kırmızı kan hücrelerinin kuvvetli otofloresansı genellikle iltihaplı dokulara floresans teknolojisinin uygulanmasını engellemektedir. Iltihaplı diş eti dokularda bakterilerin lokalize etmek için, bu nedenle, digoksigenin kullanılarak bir in situ hibridizasyon metodu (DIG) -etiketli DNA probu geliştirilmiştir ve başarılı bir şekilde 10,11 uygulanır. P kullanarak parafine gömülü dokularda bakteri lokalizasyonu için Burada detaylı bir protokol gingivalis-spesifik ve genel eubacterial sondalar açıklanmıştır. Özellikle içindeki sonuçlar diğer laboratuarlarda yeniden böylece yöntemin standardizasyon odaklanmıştır. Bu protokol histolojik bağlam ve resu içindeki bakterilerin lokalizasyonu veriyorlt son derece tekrarlanabilir. Açıklanan protokol, ya çeşitli dokularda bir türe özel veya genel bir şekilde bakterileri lokalize etmek için de kullanılabilir. Evrensel prob polimikrobial hastalıklarda bakteri tespit etmek ve belirli bir bakteri rolü bilinmemektedir burada hastalıklarda bakteri potansiyel rolünü araştırmak için yararlıdır.

<table><tbody><tr><td>Acetic anhydride</td><td>Sigma</td><td>6404</td><td></td></tr><tr><td>50% Dextran sulfate solution</td><td>Millipore</td><td>S4030</td><td></td></tr><tr><td>50X Denhardt&amp;rsquo;s solution</td><td>Sigma</td><td>D2532</td><td></td></tr><tr><td>DEPC</td><td>Sigma</td><td>P159220</td><td></td></tr><tr><td>DIG DNA labeling and detection kit</td><td>Roche</td><td>11 093 657 910</td><td></td></tr><tr><td>Formamide</td><td>Sigma</td><td>F9037</td><td></td></tr><tr><td>ImmEdge&amp;trade; Pen</td><td>Dako</td><td>H-400</td><td></td></tr><tr><td>Levamisole</td><td>Vector</td><td>SP-5000</td><td></td></tr><tr><td>Magnesium chloride</td><td>Sigma</td><td>246964</td><td></td></tr><tr><td>Maleic acid</td><td>Sigma</td><td>M0375</td><td></td></tr><tr><td>Methyl green</td><td>Sigma</td><td>M6776</td><td></td></tr><tr><td>Paraformaldehyde</td><td>Sigma</td><td>P1648</td><td></td></tr><tr><td>Permount</td><td>Fisher</td><td>SP15-500</td><td></td></tr><tr><td>Salmon sperm DNA solution</td><td>Invitrogen</td><td>#15632-011</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma</td><td>S9625</td><td></td></tr><tr><td>Sodium citrate</td><td>Duksan</td><td>D1420</td><td></td></tr><tr><td>Sodium dodecyl sulfate</td><td>Amresco</td><td>227</td><td></td></tr><tr><td>Triethanolamine-HCl</td><td>Sigma</td><td>90279</td><td></td></tr><tr><td>Tris-HCl</td><td>Research organics</td><td>3098T</td><td></td></tr></tbody></table>

in situ detection of bacteria within paraffin-embedded tissues using a digoxin-labeled dna probe targeting 16s rrna

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been reported using various methods, including electron microscopy, immunohistochemistry or immunofluorescence using bacteria-specific antibodies, and fluorescent in situ hybridization (FISH) using a fluorescence-labeled oligonucleotide probe. Nevertheless, these methods are not widely used due to technical limitation or difficulties. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled DNA probes has been introduced. The paraffin-embedded tissues are the most common form of biopsy tissues available from pathology banks. Bacteria can be detected either in a species-specific or universal manner. Bacterial signals are detected as either discrete forms (coccus, rod, fusiform, and hairy form) of bacteria or dispersed forms. The technique allows other histological information to be obtained: the epithelia, connective tissue, inflammatory infiltrates, and blood vessels are well distinguished. This method can be used to study the role of bacteria in various diseases, such as periodontitis, cancers, and inflammatory immune diseases.

Şekil 1 hassasiyetini belirlemek için sette bulunan pozitif kontrol probu ile karşılaştırıldığında DIG etiketli probları nokta blotlama. 343 bp P. gingivalis spesıfik sonda 70 bp eubacterial prob 25 kat daha hassastır. P. tespiti için kronik periodontitisli hastalardan elde edilen dişeti dokularının in situ hibridizasyon 2 gösterileri Şekil gingivalis ve Eubacteria. mor gösterilen bakteriyel sinyaller, doku dışı...

Watch this Scientific Journal Video about In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA at JoVE.com

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

16S rRNA Hedefleme Digoksin-etiketli DNA probu kullanılarak Parafine gömülmüş dokular içinde Bakterilerin in situ tespiti

The presence of bacteria within the pocket epithelium and underlying connective tissue in gingival biopsies from patients with periodontitis has been ...

in-situ-detection-bacteria-within-paraffin-embedded-tissues-using

Research

JoVE Journal

Immunology and Infection

In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

10.9K Görüntüleme.  School of Dentistry and Dental Research Institute, Seoul National University. Here a method to localize bacteria within paraffin-embedded tissues using DIG-labeled 16S rRNA-targeting DNA probes has been described. This protocol can be applied to study the role of bacteria in various diseases such as periodontitis, cancers, and inflammatory immune diseases.

Video: In Situ Detection of Bacteria within Paraffin-embedded Tissues Using a Digoxin-labeled DNA Probe Targeting 16S rRNA

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these diseases, do not exist in isolation when they colonize the vector; rather, they likely engage in interactions with resident microorganisms in the gut lumen. The vector microbiota has been demonstrated to play an important role in pathogen transmission for several vector-borne diseases. Whether resident bacteria in the gut of the Ixodes scapularis tick, the vector of several human pathogens including Borrelia burgdorferi, influence tick transmission of pathogens is not determined. We require methods for characterizing the composition of the bacteria associated with the tick gut to facilitate a better understanding of potential interspecies interactions in the tick gut. Using whole-mount in situ hybridization to visualize RNA transcripts associated with particular bacterial species allows for the collection of qualitative data regarding the abundance and distribution of the microbiota in intact tissue. This technique can be used to examine changes in the gut microbiota milieu over the course of tick feeding and can also be applied to analyze expression of tick genes. Staining of whole tick guts yield information about the gross spatial distribution of target RNA in the tissue without the need for three-dimensional reconstruction and is less affected by environmental contamination, which often confounds the sequencing-based methods frequently used to study complex microbial communities. Overall, this technique is a valuable tool that can be used to better understand vector-pathogen-microbiota interactions and their role in disease transmission.

Visualization of Microbiota in Tick Guts by Whole-mount In Situ Hybridization

Here, we present a protocol to spatially and temporally assess the presence of viable microbiota in tick guts using a modified whole-mount in situ hybridization approach.

Kene bağırsaklar tarafından bütün-mount Situ hibridizasyon Microbiota görselleştirme

Infectious diseases transmitted by arthropod vectors continue to pose a significant threat to human health worldwide. The pathogens causing these ...

Genetik

Detection of Bacteria Using Fluorogenic DNAzymes

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses each and every year. Prevention of such outbreaks and minimization of the impact of an ongoing epidemic place an ever-increasing demand for analytical methods that can accurately identify culprit pathogens at the earliest stage. Although there is a large array of effective methods for pathogen detection, none of them can satisfy all the following five premier requirements embodied for an ideal detection method: high specificity (detecting only the bacterium of interest), high sensitivity (capable of detecting as low as a single live bacterial cell), short time-to-results (minutes to hours), great operational simplicity (no need for lengthy sampling procedures and the use of specialized equipment), and cost effectiveness. For example, classical microbiological methods are highly specific but require a long time (days to weeks) to acquire a definitive result.1 PCR- and antibody-based techniques offer shorter waiting times (hours to days), but they require the use of expensive reagents and/or sophisticated equipment.2-4 Consequently, there is still a great demand for scientific research towards developing innovative bacterial detection methods that offer improved characteristics in one or more of the aforementioned requirements. Our laboratory is interested in examining the potential of DNAzymes as a novel class of molecular probes for biosensing applications including bacterial detection.5
DNAzymes (also known as deoxyribozymes or DNA enzymes) are man-made single-stranded DNA molecules with the capability of catalyzing chemical reactions.6-8 These molecules can be isolated from a vast random-sequence DNA pool (which contains as many as 1016 individual sequences) by a process known as "in vitro selection" or "SELEX" (systematic evolution of ligands by exponential enrichment).9-16 These special DNA molecules have been widely examined in recent years as molecular tools for biosensing applications.6-8
Our laboratory has established in vitro selection procedures for isolating RNA-cleaving fluorescent DNAzymes (RFDs; Fig. 1) and investigated the use of RFDs as analytical tools.17-29 RFDs catalyze the cleavage of a DNA-RNA chimeric substrate at a single ribonucleotide junction (R) that is flanked by a fluorophore (F) and a quencher (Q). The close proximity of F and Q renders the uncleaved substrate minimal fluorescence. However, the cleavage event leads to the separation of F and Q, which is accompanied by significant increase of fluorescence intensity.
More recently, we developed a method of isolating RFDs for bacterial detection.5 These special RFDs were isolated to "light up" in the presence of the crude extracellular mixture (CEM) left behind by a specific type of bacteria in their environment or in the media they are cultured (Fig. 1). The use of crude mixture circumvents the tedious process of purifying and identifying a suitable target from the microbe of interest for biosensor development (which could take months or years to complete). The use of extracellular targets means the assaying procedure is simple because there is no need for steps to obtain intracellular targets.
Using the above approach, we derived an RFD that cleaves its substrate (FS1; Fig. 2A) only in the presence of the CEM produced by E. coli (CEM-EC).5 This E. coli-sensing RFD, named RFD-EC1 (Fig. 2A), was found to be strictly responsive to CEM-EC but nonresponsive to CEMs from a host of other bacteria (Fig. 3).
Here we present the key experimental procedures for setting up E. coli detection assays using RFD-EC1 and representative results.

We have recently reported a novel approach for generating fluorogenic DNAzyme probes that can be applied to set up a simple, "mix-and-read" fluorescent assay for bacterial detection. These special DNA probes catalyze the cleavage of a chromophore-modified DNA-RNA chimeric substrate in the presence of crude extracellular mixture (CEM) produced by a specific bacterium, thereby translating bacterial detection into fluorescence signal generation. In this report we will describe key experimental procedures where a specific DNAzyme probe denoted "RFD-EC1" is employed for the detection of the model bacterium, Escherichia coli (E. coli).

Flourogenik DNAzymes kullanarak Bakterilerin Tespiti

Outbreaks linked to food-borne and hospital-acquired pathogens account for millions of deaths and hospitalizations as well as colossal economic losses ...

İmmünoloji ve Enfeksiyon

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

Corals are important ocean invertebrates that are critical for overall ocean health as well as human health. However, due to human impacts such as rising ocean temperatures and ocean acidification, corals are increasingly under threat. To tackle these challenges, advances in cell and molecular biology have proven to be crucial for diagnosing the health of corals. Modifying some of the techniques commonly used in human medicine could greatly improve researchers&#39; ability to treat and save corals. To address this, a protocol for in situ hybridization used primarily in human medicine and evolutionary developmental biology has been adapted for use in adult corals under stress.
The purpose of this method is to visualize the spatial expression of an RNA probe in adult coral tissue that has been embedded in paraffin and sectioned onto glass slides. This method focuses on removal of the paraffin and rehydration of the sample, pretreatment of the sample to ensure permeability of the sample, pre-hybridization incubation, hybridization of the RNA probe, and visualization of the RNA probe. This is a powerful method when using non-model organisms to discover where specific genes are expressed, and the protocol can be easily adapted for other non-model organisms. However, the method is limited in that it is primarily qualitative, because expression intensity can vary depending on the amount of time used during the visualization step and the concentration of the probe. Furthermore, patience is required, as this protocol can take up to 5 days (and in many cases, longer) depending on the probe being used. Finally, non-specific background staining is common, but this limitation can be overcome.

In Situ Hybridization Techniques for Paraffin-Embedded Adult Coral Samples

The goal of this protocol is to perform in situ hybridization on adult coral samples that have been embedded in paraffin and sectioned onto glass slides. This is a qualitative method used to visualize the spatial expression of an RNA anti-sense probe in paraffin-embedded tissues.

Situ Parafin gömülü yetişkin mercan örnekleri için hibridizasyon teknikleri

Corals are important ocean invertebrates that are critical for overall ocean health as well as human health. However, due to human impacts such as rising ...

Çevre

Kanser Dokusu Örneklerinde Onkojenik Etkenler için FISH Analizinin Geliştirilmesi

Robust Detection of Gene Amplification in Formalin-Fixed Paraffin-Embedded Samples by Fluorescence In Situ Hybridization

Focal gene amplification, such as extrachromosomal DNA (ecDNA), plays an important role in cancer development and therapy resistance. While sequencing-based methodologies enable an unbiased identification of ecDNA, cytogenetic-based techniques, such as fluorescence in situ hybridization (FISH), remain time and cost-effective for identifying ecDNA in clinical specimens. The application of FISH in formalin-fixed paraffin-embedded (FFPE) tissue samples offers a unique avenue for detecting amplified genes, particularly when viable specimens are not available for karyotype examination. However, there is a lack of consensus procedures for this technique. This protocol provides comprehensive, fully optimized, step-by-step instructions for conducting FISH to detect gene amplification, including ecDNA, in FFPE tissue samples which present unique challenges that this protocol aims to overcome and standardize. By following this protocol, researchers can reproducibly acquire high-quality imaging data to assess gene amplification.

Yazar Spotlight: Kanser Örneklerinde Hassas Gen Amplifikasyon Değerlendirmesi için Bir Araç Olarak FISH

This protocol provides a reproducible method to visualize gene amplification in formalin-fixed paraffin-embedded (FFPE) tissue specimens.

Floresan In Situ Hibridizasyon ile Formalinle Sabitlenmiş Parafine Gömülü Numunelerde Gen Amplifikasyonunun Sağlam Tespiti

Focal gene amplification, such as extrachromosomal DNA (ecDNA), plays an important role in cancer development and therapy resistance. While ...

Kanser Araştırmaları

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Assessing the expression pattern of a gene, as well as the subcellular localization properties of its transcribed RNA, are key features for understanding its biological function during development. RNA in situ hybridization (RNA-ISH) is a powerful method used for visualizing RNA distribution properties, be it at the organismal, cellular or subcellular levels 1. RNA-ISH is based on the hybridization of a labeled nucleic acid probe (e.g. antisense RNA, oligonucleotides) complementary to the sequence of an mRNA or a non-coding RNA target of interest 2. As the procedure requires primary sequence information alone to generate sequence-specific probes, it can be universally applied to a broad range of organisms and tissue specimens 3. Indeed, a number of large-scale ISH studies have been implemented to document gene expression and RNA localization dynamics in various model organisms, which has led to the establishment of important community resources 4-11. While a variety of probe labeling and detection strategies have been developed over the years, the combined usage of fluorescently-labeled detection reagents and enzymatic signal amplification steps offer significant enhancements in the sensitivity and resolution of the procedure 12. Here, we describe an optimized fluorescent in situ hybridization method (FISH) employing tyramide signal amplification (TSA) to visualize RNA expression and localization dynamics in staged Drosophila embryos. The procedure is carried out in 96-well PCR plate format, which greatly facilitates the simultaneous processing of large numbers of samples.

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Here we describe a whole-mount fluorescent in situ hybridization (FISH) protocol for determining the expression and localization properties of RNAs expressed during embryogenesis in the fruit fly, Drosophila melanogaster.

Tüm Dağı RNA Floresan<em&gt; In situ</emVe&gt; Hibridizasyon<em&gt; Drosophila</em&gt; Embriyolar

Assessing  the expression pattern of a gene, as well as the subcellular localization  properties of its transcribed RNA, are key features for ...

Biyoloji

Visualization of Gut Microbiota-host Interactions via Fluorescence In Situ Hybridization, Lectin Staining, and Imaging

Measuring the localization of microbes within their in vivo context is an essential step in revealing the functional relationships between the microbiota and the vertebrate gut. The spatial landscape of the gut microbiota is tightly controlled by physical features - intestinal mucus, crypts, and folds - and is affected by host-controlled properties such as pH, oxygen availability, and immune factors. These properties limit the ability of commensal microbes and pathogens alike to colonize the gut stably. At the micron-scale, microbial organization determines the close-range interactions between different microbes as well as the interactions between microbes and their host. These interactions then affect large-scale organ function and host health.
This protocol enables the visualization of the gut microbiota spatial organization from distances between cells to organ-wide scales. The method is based on fixing gut tissues while preserving intestinal structure and mucus properties. The fixed samples are then embedded, sectioned, and stained to highlight specific bacterial species through fluorescence in situ hybridization (FISH). Host features, such as mucus and host cell components, are labeled with fluorescently labeled lectins. Finally, the stained sections are imaged using a confocal microscope utilizing tile-scan imaging at high magnification to bridge the micron to centimeter length scales. This type of imaging can be applied to intestinal sections from animal models and biopsies from human tissues to determine the biogeography of the microbiota in the gut in health and disease.

Visualization of Gut Microbiota-host Interactions via Fluorescence In Situ Hybridization, Lectin Staining, and Imaging

This streamlined protocol details a workflow to detect and image bacteria in complex tissue samples, from fixing the tissue to staining microbes with fluorescent in situ hybridization.

Floresan In Situ Hibridizasyon, Lectin Boyama ve Görüntüleme Yoluyla Gut Mikrobiyota-konak Etkileşimlerinin Görselleştirilmesi

Measuring the localization of microbes within their in vivo context is an essential step in revealing the functional relationships between the microbiota ...

RNA Fluorescence in situ Hybridization (FISH) to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

The intestines of wild Caenorhabditis nematodes are inhabited by a variety of microorganisms, including gut microbiome bacteria and pathogens, such as microsporidia and viruses. Because of the similarities between Caenorhabditis elegans and mammalian intestinal cells, as well as the power of the C. elegans system, this host has emerged as a model system to study host intestine-microbe interactions in vivo. While it is possible to observe some aspects of these interactions with bright-field microscopy, it is difficult to accurately classify microbes and characterize the extent of colonization or infection without more precise tools. RNA fluorescence in situ hybridization (FISH) can be used as a tool to identify and visualize microbes in nematodes from the wild or to experimentally characterize and quantify infection in nematodes infected with microbes in the lab. FISH probes, labeling the highly abundant small subunit ribosomal RNA, produce a bright signal for bacteria and microsporidian cells. Probes designed to target conserved regions of ribosomal RNA common to many species can detect a broad range of microbes, whereas targeting divergent regions of the ribosomal RNA is useful for narrower detection. Similarly, probes can be designed to label viral RNA. A protocol for RNA FISH staining with either paraformaldehyde (PFA) or acetone fixation is presented. PFA fixation is ideal for nematodes associated with bacteria, microsporidia, and viruses, whereas acetone fixation is necessary for the visualization of microsporida spores. Animals were first washed and fixed in paraformaldehyde or acetone. After fixation, FISH probes were incubated with samples to allow for the hybridization of probes to the desired target. The animals were again washed and then examined on microscope slides or using automated approaches. Overall, this FISH protocol enables detection, identification, and quantification of the microbes that inhabit the C. elegans intestine, including microbes for which there are no genetic tools available.

RNA Fluorescence in situ Hybridization FISH to Visualize Microbial Colonization and Infection in Caenorhabditis elegans Intestines

Intestinal microbes, including extracellular bacteria and intracellular pathogens like the Orsay virus and microsporidia (fungi), are often associated with wild Caenorhabditis nematodes. This article presents a protocol for detecting and quantifying microbes that colonize and/or infect C. elegans nematodes, and for measuring pathogen load after controlled infections in the lab.

Caenorhabditis elegans Bağırsaklarında Mikrobiyal Kolonizasyon ve Enfeksiyonu Görselleştirmek için RNA Floresan in situ Hibridizasyon (FISH)

The intestines of wild Caenorhabditis nematodes are inhabited by a variety of microorganisms, including gut microbiome bacteria and pathogens, such as ...

Employing Digital Droplet PCR to Detect BRAF V600E Mutations in Formalin-fixed Paraffin-embedded Reference Standard Cell Lines

ddPCR is a highly sensitive PCR method that utilizes a water-oil emulsion system. Using a droplet generator, an extracted nucleic acid sample is partitioned into ~20,000 nano-sized, water-in-oil droplets, and PCR amplification occurs in individual droplets. The ddPCR approach is in identifying sequence mutations, copy number alterations, and select structural rearrangements involving targeted genes. Here, we demonstrate the use of ddPCR as a powerful technique for precisely quantitating rare BRAF V600E mutations in FFPE reference standard cell lines, which is helpful in identifying individuals with cancer. In conclusion, ddPCR technique offers the potential to precisely profile the specific rare mutations in different genes in various types of FFPE samples.

The goal of this video is to demonstrate how to perform&#160;automated DNA extraction from formalin-fixed paraffin-embedded (FFPE) reference standard cell lines and digital droplet PCR&#160;(ddPCR) analysis to detect rare mutations in a clinical setting. Detecting mutations in FFPE samples demonstrates the clinical utility of ddPCR in FFPE samples.

16S rRNA Hedefleme Digoksin-etiketli DNA probu kullanılarak Parafine gömülmüş dokular içinde Bakterilerin in situ tespiti

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Kene bağırsaklar tarafından bütün-mount Situ hibridizasyon Microbiota görselleştirme

Flourogenik DNAzymes kullanarak Bakterilerin Tespiti

Situ Parafin gömülü yetişkin mercan örnekleri için hibridizasyon teknikleri

Floresan In Situ Hibridizasyon ile Formalinle Sabitlenmiş Parafine Gömülü Numunelerde Gen Amplifikasyonunun Sağlam Tespiti

Floresan In Situ Hibridizasyon ile Formalinle Sabitlenmiş Parafine Gömülü Numunelerde Gen Amplifikasyonunun Sağlam Tespiti

Floresan In Situ Hibridizasyon ile Formalinle Sabitlenmiş Parafine Gömülü Numunelerde Gen Amplifikasyonunun Sağlam Tespiti

Tüm Dağı RNA Floresan

Floresan In Situ Hibridizasyon, Lectin Boyama ve Görüntüleme Yoluyla Gut Mikrobiyota-konak Etkileşimlerinin Görselleştirilmesi

Caenorhabditis elegans Bağırsaklarında Mikrobiyal Kolonizasyon ve Enfeksiyonu Görselleştirmek için RNA Floresan in situ Hibridizasyon (FISH)

Dijital Damlacık PCR Formalin sabit Parafin gömülü Referans Standart Hücre Hatlarında BRAF V600E mutasyonları tespit etmek istihdam