Deseamos agradecer a los laboratorios de la comunidad de C. elegans que desarrollaron y compartieron las herramientas y cuyo trabajo se cita en este manuscrito. Algunas cepas fueron proporcionadas por el CGC, que está financiado por la Oficina de Programas de Infraestructura de Investigación de los NIH (P40 OD010440). Este trabajo fue apoyado por una subvención del Proyecto de los Institutos Canadienses de Investigación en Salud (CIHR) a A.L.S. (PJT-175245). C.L. cuenta con el apoyo de una beca de posgrado del Consejo de Investigación de Ciencias Naturales e Ingeniería de Canadá (NSERC) (PGS-D).

Herencia epigenética y ChIP en Caenorhabditis elegans

<ol>
	<li>Alcazar, R. M., Lin, R., Fire, A. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmission+dynamics+of+heritable+silencing+induced+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans.</a> Genetics. 180 (3), 1275-1288 (2008).</li><li>Ashe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+can+trigger+a+multigenerational+epigenetic+memory+in+the+germline+of+C.+elegans.">piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.</a> Cell. 150 (1), 88-99 (2012).</li><li>Buckley, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+Argonaute+promotes+multigenerational+epigenetic+inheritance+and+germline+immortality.">A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.</a> Nature. 489 (7416), 447-451 (2012).</li><li>Vastenhouw, N. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+silencing+by+RNAi.">Long-term gene silencing by RNAi.</a> Nature. 442 (7105), 882 (2006).</li><li>Lee, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+piRNAs+mediate+the+genome-wide+surveillance+of+germline+transcripts.">C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.</a> Cell. 150 (1), 78-87 (2012).</li><li>Luteijn, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extremely+stable+Piwi-induced+gene+silencing+in+Caenorhabditis+elegans.">Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.</a> The EMBO Journal. 31 (16), 3422-3430 (2012).</li><li>Sapetschnig, A., Sarkies, P., Lehrbach, N. J., Miska, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+siRNAs+mediate+paramutation+in+C.+elegans.">Tertiary siRNAs mediate paramutation in C. elegans.</a> PLoS Genetics. 11 (3), e1005078 (2015).</li><li>Shirayama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+initiate+an+epigenetic+memory+of+nonself+RNA+in+the+C.+elegans+germline.">piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.</a> Cell. 150 (1), 65-77 (2012).</li><li>Minkina, O., Hunter, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+heritable+germline+silencing+directs+somatic+silencing+at+an+endogenous+locus.">Stable heritable germline silencing directs somatic silencing at an endogenous locus.</a> Molecular Cell. 65 (4), 659-670 (2017).</li><li>Seroussi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+epigenetic+regulation+by+C.+elegans+nuclear+RNA+interference+pathways.">Mechanisms of epigenetic regulation by C. elegans nuclear RNA interference pathways.</a> Seminars in Cell &amp; Developmental Biology. 127, 142-154 (2022).</li><li>Lev, I., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K9me3+is+required+for+inheritance+of+small+RNAs+that+target+a+unique+subset+of+newly+evolved+genes.">H3K9me3 is required for inheritance of small RNAs that target a unique subset of newly evolved genes.</a> eLife. 8, e40448 (2019).</li><li>Woodhouse, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifiers+SET-25+and+SET-32+are+required+for+establishment+but+not+long-term+maintenance+of+transgenerational+epigenetic+inheritance.">Chromatin modifiers SET-25 and SET-32 are required for establishment but not long-term maintenance of transgenerational epigenetic inheritance.</a> Cell Reports. 25 (8), 2259-2272 (2018).</li><li>Houri-Zeevi, L., Teichman, G., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+resets+ancestral+heritable+small+RNA+responses.">Stress resets ancestral heritable small RNA responses.</a> eLife. 10, e65797 (2021).</li><li>Houri-Ze'evi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tunable+mechanism+determines+the+duration+of+the+transgenerational+small+RNA+inheritance+in+C.+elegans.">A tunable mechanism determines the duration of the transgenerational small RNA inheritance in C. elegans.</a> Cell. 165 (1), 88-99 (2016).</li><li>Spracklin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+inheritance+machinery+of+Caenorhabditis+elegans.">The RNAi inheritance machinery of Caenorhabditis elegans.</a> Genetics. 206 (3), 1403-1416 (2017).</li><li>Perales, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+epigenetic+inheritance+is+negatively+regulated+by+the+HERI-1+chromodomain+protein.">Transgenerational epigenetic inheritance is negatively regulated by the HERI-1 chromodomain protein.</a> Genetics. 210 (4), 1287-1299 (2018).</li><li>Shukla, A., Perales, R., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+coordinate+poly(UG)+tailing+to+prevent+aberrant+and+perpetual+gene+silencing.">piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.</a> Current Biology. 31 (20), 4473-4485 (2021).</li><li>Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+GeneticsWormBook:+the+Online+Review+of+C.+elegans+Biology.">Reverse GeneticsWormBook: the Online Review of C. elegans Biology.</a> WormBook. , (2006).</li><li>Rivera Gomez, K., Schvarzstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+of+nematodes+for+live+imaging+using+an+agarose+pad+produced+with+a+Vinyl+Record.">Immobilization of nematodes for live imaging using an agarose pad produced with a Vinyl Record.</a> microPublication Biology. 2018, (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook: The Online Review of C. Elegans Biology. , 1-11 (2006).</li><li>Askjaer, P., Ercan, S., Meister, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modern+techniques+for+the+analysis+of+chromatin+and+nuclear+organization+in+C.+elegans.">Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.</a> WormBook: the Online Review of C. elegans Biology. , 1-35 (2014).</li><li>Gu, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+siRNA+in+Caenorhabditis+elegans+generates+a+transgenerational+sequence-targeted+histone+H3+lysine+9+methylation+footprint.">Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.</a> Nature Genetics. 44 (2), 157-164 (2012).</li><li>Kalinava, N., Ni, J. Z., Peterman, K., Chen, E., Gu, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoupling+the+downstream+effects+of+germline+nuclear+RNAi+reveals+that+H3K9me3+is+dispensable+for+heritable+RNAi+and+the+maintenance+of+endogenous+siRNA-mediated+transcriptional+silencing+in+Caenorhabditis+elegans.">Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.</a> Epigenetics &amp; Chromatin. 10, 6 (2017).</li><li>Kalinava, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=elegans+heterochromatin+factor+SET-32+plays+an+essential+role+in+transgenerational+establishment+of+nuclear+RNAi-mediated+epigenetic+silencing.">elegans heterochromatin factor SET-32 plays an essential role in transgenerational establishment of nuclear RNAi-mediated epigenetic silencing.</a> Cell Reports. 25 (8), 2273-2284 (2018).</li><li>Lev, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MET-2-dependent+H3K9+methylation+suppresses+transgenerational+small+RNA+inheritance.">MET-2-dependent H3K9 methylation suppresses transgenerational small RNA inheritance.</a> Current Biology. 27 (8), 1138-1147 (2017).</li><li>Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+specific+RNA-mediated+interference+through+ingested+double-stranded+RNA+in+Caenorhabditis+elegans.">Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans.</a> Genome Biology. 2 (1), (2001).</li><li>Xu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytoplasmic+Argonaute+protein+promotes+the+inheritance+of+RNAi.">A cytoplasmic Argonaute protein promotes the inheritance of RNAi.</a> Cell Reports. 23 (8), 2482-2494 (2018).</li><li>Grishok, A., Tabara, H., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+requirements+for+inheritance+of+RNAi+in+C.+elegans.">Genetic requirements for inheritance of RNAi in C. elegans.</a> Science. 287 (5462), 2494-2497 (2000).</li><li>Houri-Zeevi, L., Korem Kohanim, Y., Antonova, O., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+rules+explain+transgenerational+small+RNA+inheritance+in+C.+elegans.">Three rules explain transgenerational small RNA inheritance in C. elegans.</a> Cell. 182 (5), 1186-1197 (2020).</li><li>Burton, N. O., Burkhart, K. B., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+RNAi+maintains+heritable+gene+silencing+in+Caenorhabditis+elegans.">Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans.</a> Proceedings of the National Academy of Sciences. 108 (49), 19683-19688 (2011).</li><li>Mao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Nrde+pathway+mediates+small-RNA-directed+histone+H3+lysine+27+trimethylation+in+Caenorhabditis+elegans.">The Nrde pathway mediates small-RNA-directed histone H3 lysine 27 trimethylation in Caenorhabditis elegans.</a> Current Biology. 25 (18), 2398-2403 (2015).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Research. 22 (9), 1813-1831 (2012).</li><li>Mukhopadhyay, A., Deplancke, B., Walhout, A. J. M., Tissenbaum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+(ChIP)+coupled+to+detection+by+quantitative+real-time+PCR+to+study+transcription+factor+binding+to+DNA+in+Caenorhabditis+elegans.">Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.</a> Nature Protocols. 3 (4), 698-709 (2008).</li></ol>

Todos los autores confirman que no tienen ningún conflicto que revelar.

En este protocolo, el dsRNA se introduce por alimentación, que se ha convertido en un método estándar en C. elegans18. Para los ensayos de herencia de ARNi, el enfoque de alimentación proporciona un método fácil para obtener una gran población de P0 2,11,12,22,23,24,25. Sin embargo, el momento y la duración de la exposición al ARNi afectan a la eficacia del silenciamiento transgénico26, y la concentración de bacterias ARNi afecta a la persistencia del silenciamiento del ARNi hereditario1. Por lo tanto, el crecimiento estandarizado de bacterias ARNi y gusanos es importante para obtener un nivel constante de silenciamiento de GFP y duración de la herencia. Aquí, los embriones se colocan en placas de ARNi para que los animales P0 estén expuestos a las bacterias ARNi desde la eclosión. Los enfoques alternativos han colocado animales sincronizados en estadios L1 24,27 oL4 25 en placas de ARNi-NGM. Además, dado que la inanición y otros estreses afectan el mantenimiento de la herencia de ARNi13, las placas deben ser monitoreadas para evitar el hacinamiento y el agotamiento del suministro de alimentos. Como alternativa a la iniciación del ARNi por alimentación, algunos de los estudios pioneros de herencia de ARNi de C. elegans indujeron el ARNi a través de la inyección en gónadas, lo que proporciona un mayor control de la concentración de dsRNA 1,28.
En este protocolo, cada generación es transitada como una población con tratamiento con hipoclorito alcalino, como se describió previamente 16,22,23,24. El tratamiento con hipoclorito garantiza que la generación F1 no se contaminará con bacterias ARNi del entorno parental22 y evita posibles cuellos de botella no deseados en la población. Sin embargo, el paso a granel también puede ser una limitación, ya que los animales individuales pueden tener patrones de herencia distintos 1,29. Un método alternativo para establecer cada generación es seleccionar animales individuales 1,2,9,11,25. Este enfoque permite el seguimiento de fenotipos dentro de linajes y la incorporación de cruces genéticos. El análisis de linaje también puede ser ventajoso para fenotipos de baja penetrancia12.
La expresión de proteínas fluorescentes es una lectura potente y conveniente del silenciamiento inducido por ARNi 2,3,4,12,14,15,16,25,30. Como se describe en este protocolo, la expresión GFP se puede puntuar manualmente como ON o OFF 11,12,15,16,25. La puntuación manual se puede refinar aún más mediante la asignación de niveles de intensidad cualitativa 3,4,14. Alternativamente, la puntuación de intensidad automatizada de imágenes de microscopía 11,12,14,25,27 o la medición de fluorescencia por citometría de flujo de animales vivos2 pueden proporcionar una lectura cuantitativa y de alto rendimiento. Sin embargo, dado que la expresión del reportero está restringida a la línea germinal, una advertencia de los enfoques automatizados es que también deben diferenciar entre los animales con expresión silenciada de GFP y los animales sin línea germinal, especialmente si el estudio incorpora mutantes con un desarrollo anormal de la línea germinal. Como alternativa a la fluorescencia de GFP, se puede utilizar la transcripción inversa (RT)-qPCR para cuantificarlos niveles de ARNm y ARNm 2,16,23,24. Este enfoque proporciona una lectura más directa del silenciamiento, que se dirige al ARN, y es especialmente útil para otras dianas de ARNi en las que el silenciamiento no produce un fenotipo visible. Una limitación del uso de reporteros artificiales de GFP es que las secuencias exógenas y endógenas están reguladas diferencialmente en el ARNi transgeneracional11. Por lo tanto, los estudios con dianas endógenas, como el alelo letal embrionario sensible a la temperatura oma-1(zu405)1,11,16,25, deben considerarse como un enfoque complementario a los reporteros de transgenes fluorescentes.
El análisis de ChIP en el contexto de los ensayos de herencia de ARNi requiere la comparación entre tratamientos y réplicas. En primer lugar, para tener en cuenta las diferencias en el material de partida entre las muestras, la señal ChIP se normaliza a la señal de entrada en el mismo lugar que el "porcentaje de entrada". El procesamiento de una histona H3 ChIP en paralelo ayudará a determinar si cualquier alteración de la modificación de histonas se corresponde con cambios en la densidad de nucleosomas. Además, debido a que ChIP es un proceso de varios pasos, la eficiencia puede variar entre muestras. La selección de loci de control positivo y negativo apropiados es útil para evaluar y comparar la relación señal-ruido entre muestras y experimentos. Además, para facilitar las comparaciones entre muestras, los valores del ciclo umbral de qPCR de ADN ChIP en el objetivo de ARNi a menudo se normalizan a un locus de control 3,11,15,23,30,31. Para evaluar los efectos del tratamiento con ARNi, también se compara la relación entre la señal ChIP en el ARNi del tratamiento y las condiciones de control o ausencia de ARNi. Una limitación del enfoque actual es que la ChIP se realiza con animales enteros, mientras que la respuesta al tratamiento con ARNi puede ser exclusiva de la línea germinal. Un enfoque para superar esta advertencia es realizar ChIP utilizando núcleos aislados de la línea germinal. Las consideraciones técnicas adicionales para optimizar ChIP también se han discutido ampliamente en otros lugares32,33.
En general, esta herencia de ARNi y el protocolo ChIP proporcionan una base detallada y fácil de adaptar que puede integrarse con otras técnicas para explorar más a fondo la regulación epigenética transgeneracional. Por ejemplo, se pueden construir bibliotecas de secuenciación de alto rendimiento a partir del ADN ChIP (ChIP-seq) para obtener una visión más detallada del panorama de la cromatina, tanto proximal a la diana de ARNi como a escala de todo el genoma.

La herencia epigenética permite la transmisión de información reguladora de genes a través de generaciones y, por lo tanto, puede permitir que el entorno o las experiencias de los padres afecten a su progenie. En C. elegans, el silenciamiento génico de la línea germinal iniciado por ARN bicatenario exógeno (dsRNA) puede heredarse durante varias generaciones en la progenie no expuesta al desencadenante original 1,2,3,4. Este proceso, denominado herencia de ARN de interferencia (ARNi), es uno de varios fenómenos de silenciamiento epigenético relacionados en C. elegans, incluido el silenciamiento multigeneracional iniciado por piRNA2,5, la paramutación/ARNe (silenciamiento epigenético inducido por ARN)6,7,8 y el silenciamiento iniciado por matrices multicopia9, que tienen requisitos superpuestos pero distintos para la maquinaria de regulación de ARN pequeño y cromatina . En el ARNi exógeno de C. elegans, el dsRNA se procesa en pequeños ARN interferentes (siRNA) que actúan en un complejo con las proteínas primarias de Argonaute para reconocer su ARNm diana. Esta orientación conduce a la amplificación de siRNAs secundarios que se asocian con Argonautas secundarios para silenciar el ARNm diana a través de vías de silenciamiento citoplasmático y nuclear. En el caso de las dianas de ARNi expresadas en la línea germinal, el ARGONAUTE secundario nuclear HRDE-1 y los factores de ARNi nuclear adicionales se dirigen a los transcritos nacientes, lo que da lugar a la represión transcripcional y al reclutamiento de metiltransferasas de histonas para depositar marcas de cromatina represivas, incluida H3K9me310. La histona H3K9me3 promueve el establecimiento del silenciamiento hereditario de los transgenes de proteína verde fluorescente (GFP) expresados en la línea germinal por la herencia de ARNi11,12.
El objetivo de este protocolo es utilizar un transgén que exprese una proteína de fusión GFP-histona en la línea germinal como indicador de la herencia de ARNi y ensayar los cambios en las modificaciones de las histonas en el locus del transgén reportero mediante inmunoprecipitación de cromatina y reacción en cadena de la polimerasa cuantitativa (ChIP-qPCR). Este protocolo describe un enfoque estandarizado de alimentación de ARNi basado en placas para iniciar el silenciamiento del reportero. También proporciona una cronología detallada para el paso de animales entre generaciones mediante el aislamiento en el útero de embriones de adultos grávidos mediante un tratamiento con hipoclorito alcalino («blanqueo»). También se describen métodos y datos representativos para monitorizar la frecuencia de silenciamiento de GFP en un subconjunto de la población mediante microscopía de fluorescencia y para la histona H3K9me3 ChIP-qPCR. Los ensayos de herencia de ARNi basados en reporteros proporcionan un sistema altamente manejable para diseccionar funcionalmente los roles de los factores genéticos y ambientales en la regulación epigenética 13,14, y los exámenes genéticos que utilizan dichos reporteros han identificado tanto los genes que son necesarios para 2,3,15 como los genes que regulan negativamente 16,17 la duración de la herencia epigenética transgeneracional.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td>AGA002</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>AMP201</td>
			<td>Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Anti-H3K9me3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab8898</td>
			<td>Concentration is batch-dependent (0.9 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Anti-Histone H3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab1791</td>
			<td>Concentration is batch-dependent (0.7 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Bleach (6% Sodium hypochlorite)</td>
			<td>Lavo</td>
			<td>02358107</td>
			<td></td>
		</tr>
		<tr>
			<td>C. elegans strain with GFP RNAi Reporter</td>
			<td>NA</td>
			<td>SX1263</td>
			<td>Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge.</td>
		</tr>
		<tr>
			<td>Carbenicillin</td>
			<td>BioShop</td>
			<td>CAR544</td>
			<td>Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Dynabeads Protein G Magnetic Beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain HT115(DE3)</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>HT115(DE3)</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain OP50-1</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>OP50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence Stereoscope</td>
			<td>Zeiss</td>
			<td>Axio Zoom.V16</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde (37%)</td>
			<td>Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sigma</td>
			<td>50046</td>
			<td>Make a 1.25 M solution and store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>HEPES-KOH (1 M, pH 7.5)</td>
			<td>Teknova</td>
			<td>H1035</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophobic Printed Slides, 10 wells</td>
			<td>VWR</td>
			<td>100488-904</td>
			<td></td>
		</tr>
		<tr>
			<td>IGEPAL CA-630 (Octylphenol ethoxylate)</td>
			<td>BioShop</td>
			<td>NON999</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
		<tr>
			<td>IPTG (Isopropyl-&#946;-D-thiogalactoside)</td>
			<td>BioShop</td>
			<td>IPT001</td>
			<td>Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar Plates supplemented with 100 &#181;g/mL Ampicillin</td>
			<td>NA</td>
			<td>NA</td>
			<td>Standard lab recipe.</td>
		</tr>
		<tr>
			<td>Levamisole (Tetramisole hydrochloride)</td>
			<td>Sigma</td>
			<td>L9756</td>
			<td>Make a 200 mM solution in ultrapure water. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>LiCl (8 M)</td>
			<td>Sigma</td>
			<td>L7026</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4.</td>
		</tr>
		<tr>
			<td>Magnetic Separator (1.5 mL tubes)</td>
			<td>Applied Biosystems</td>
			<td>A13346</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Separator (0.2 mL tubes)</td>
			<td>Permagen</td>
			<td>MSR812</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glass</td>
			<td>Fisher Scientific</td>
			<td>12541B</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Slide</td>
			<td>Technologist Choice</td>
			<td>LAB-037</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl (5 M)</td>
			<td>Promega</td>
			<td>V4221</td>
			<td>For ChIP buffers.</td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Sigma</td>
			<td>S5881</td>
			<td>Make a 10 M solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>NGM Plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#956;g/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 &#181;g/mL streptomycin.</td>
		</tr>
		<tr>
			<td>Normal Rabbit IgG (1 mg/mL)</td>
			<td>Cell Signaling Technology</td>
			<td>2729</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri Dishes (35 mm x 10 mm)</td>
			<td>Sarstedt</td>
			<td>82.1135.500</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (10X)</td>
			<td>Fisher BioReagents</td>
			<td>BP3991</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - Control RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4440 (Plasmid #1654)</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - GFP-targetting RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4417 (Plasmid #1649)</td>
			<td>Note, alternative L4440-derived plasmids targeting GFP can be used.</td>
		</tr>
		<tr>
			<td>Primer pair [-3.3 kb upstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG</td>
		</tr>
		<tr>
			<td>Primer pair [+1.3 kb downstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT</td>
		</tr>
		<tr>
			<td>Primer pair [clec-18]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 1]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 4]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA</td>
		</tr>
		<tr>
			<td>Primer pair [hrp-2]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail Tablet</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K&#160;</td>
			<td>Bioline</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit&#160;</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>CFX96&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAi-NGM plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#181;g/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 &#181;g/mL carbenicillin and 5 mM IPTG.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Sigma</td>
			<td>R4642</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarkosyl (N-Lauroylsarcosine sodium salt)</td>
			<td>Sigma</td>
			<td>L5777</td>
			<td>Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>74255</td>
			<td>Make a 10% (w/v) solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>Sodium deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>Sonication Tube</td>
			<td>Evergreen</td>
			<td>214-3721-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonication Tube Cap</td>
			<td>Evergreen</td>
			<td>300-2911-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Qsonica</td>
			<td>Q800R3-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptomycin sulfate</td>
			<td>Bioshop</td>
			<td>STP101</td>
			<td>Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>TAE buffer (1X)</td>
			<td>NA</td>
			<td>NA</td>
			<td>40 mM Tris, 20 mM acetate, 1 mM EDTA</td>
		</tr>
		<tr>
			<td>Tally counter clicker</td>
			<td>Uline</td>
			<td>H-7350</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Bioshop</td>
			<td>TET701</td>
			<td>Make a 5 mg/mL solution in ethanol and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>Eppendorf</td>
			<td>05-400-205</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl (1 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15568025</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>T8787</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
	</tbody>
</table>

analysis of transgenerational epigenetic inheritance in c. elegans using a fluorescent reporter and chromatin immunoprecipitation (chip)

La herencia epigenética transgeneracional (TEI) permite la transmisión de información a través de la línea germinal sin cambiar la secuencia del genoma, a través de factores como los ARN no codificantes y las modificaciones de la cromatina. El fenómeno de la herencia de ARN de interferencia (ARNi) en el nematodo Caenorhabditis elegans es un modelo eficaz para investigar TEI que aprovecha el corto ciclo de vida, la autopropagación y la transparencia de este organismo modelo. En la herencia de ARNi, la exposición de los animales al ARNi conduce al silenciamiento génico y a la alteración de las firmas de cromatina en el locus diana que persisten durante varias generaciones en ausencia del desencadenante inicial. Este protocolo describe el análisis de la herencia de ARNi en C. elegans utilizando un indicador de proteína fluorescente verde nuclear (GFP) expresado en la línea germinal. El silenciamiento del reportero se inicia alimentando a los animales con bacterias que expresan ARN bicatenario dirigido a GFP. En cada generación, los animales son conducidos para mantener un desarrollo sincronizado, y el silenciamiento del gen reportero se determina mediante microscopía. En generaciones seleccionadas, las poblaciones se recolectan y procesan para la inmunoprecipitación de cromatina (ChIP) y la reacción en cadena de la polimerasa cuantitativa (qPCR) para medir el enriquecimiento de la modificación de histonas en el locus reportero de GFP. Este protocolo para estudiar la herencia de ARNi puede modificarse fácilmente y combinarse con otros análisis para investigar más a fondo los factores TEI en las vías de ARN pequeño y cromatina.

Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment (&#39;bleaching&#39;). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.

Autor destacado: Herencia de ARNi y ChIP en C. elegans 

Análisis de la herencia epigenética transgeneracional en C. elegans mediante un reportero fluorescente e inmunoprecipitación de cromatina (ChIP)

Research in our lab examines how chromatin-associated proteins, histone modifications, and small RNA pathway factors work together in the context of development and transgenerational epigenetic inheritance. The RNA inheritance assay, using a GFP reporter, has become a very powerful tool. This protocol describes how to standardize the preparation, scoring, and passaging of worms, and the preparation of ChIP samples, which can help to generate reproducible results.One of the experimental challenges when studying germline-expressed transgenes is isolating the effects in the animal's germline. We're currently using whole animals for ChIP, but in the future we would like to develop assays to examine chromatin, specifically in the germline. Our laboratory is interested in histone methylation and proteins that recognize these marks.Going forward, we would like to investigate the interplay between these chromatin readers and small RNA pathways in the context of RNAi inheritance at transgenes and the regulation of endogenous sequences.

Los animales portadores del reportero de la histona GFP H2B [mex-5p::gfp-h2b::tbb-2 3'UTR]7 expresada en la línea germinal (Figura 2A) fueron expuestos al ARNi de GFP o al ARNi de control mediante la alimentación, y se les hizo pasar como se describe en el protocolo y en la Figura 1. La señal de GFP nuclear en la línea germinal se puntuó manualmente utilizando un microscopio de disección de fluorescencia para una muestra de la población en cada generación. El silenciamiento del transgén fue totalmente penetrante en los animales puntuados P0 y F1 tratados con GFP RNAi (Figura 2B). En la generación F2, la proporción de la población que exhibía herencia de silenciamiento de GFP fue de aproximadamente el 50%. Para la generación F5, la mayoría de la población no mostró herencia de silenciamiento, y para la generación F10, no se detectó herencia, ya que todos los animales expresaron GFP.
Para determinar el cambio en el enriquecimiento de la histona H3K9me3 correspondiente al silenciamiento inducido por ARNi, se realizó ChIP-qPCR en animales de generación F1 después de un tratamiento con ARNi GFP o ARNi control. Como era de esperar, la población tratada con ARNi de GFP mostró niveles más altos de histonas H3K9me3 en el objetivo de GFP y en la región descendente de 1,3 kb en comparación con los animales tratados con ARNi de control (Figura 2C). La especificidad de la histona H3K9me3 ChIP está respaldada por el enriquecimiento en un locus de control positivo (clec-18) que se sabe que está enriquecido en esta marca, pero no en un locus de control negativo cercano (hrp-2). También se detectó enriquecimiento de histonas H3 y enriquecimiento cercano al fondo en las inmunoprecipitaciones de control de IgG en todos los loci de qPCR, como se esperaba. Cuando el enriquecimiento de ChIP en el reportero se normaliza al locus de control positivo clec-18 , se muestra un mayor enriquecimiento de la histona H3K9me3 en el ARNi de GFP, mientras que el enriquecimiento de la histona H3 es similar entre los tratamientos de control y de ARNi de GFP (Figura 2D). Dado que no se espera que el ARNi de GFP afecte a la histona H3K9me3 ni a la ocupación total de la histona H3 en el locus clec-18 , esta normalización mitiga la variación técnica, como las diferencias en la eficiencia de ChIP entre el ARNi de GFP y las muestras de ARNi de control. El cambio de plegamiento de los niveles de histonas H3K9me3 e histonas H3 entre los tratamientos con ARNi muestra un enriquecimiento de la histona H3K9me3 específica del reportero de GFP, independiente de la ocupación de la histona, tras el silenciamiento inducido por ARNi de GFP (Figura 2E).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65285/65285fig02.jpg"> Figura 2: El silenciamiento inducido por GFP RNAi corresponde a un enriquecimiento elevado de H3K9me3 en la diana de ARNi. (A) Diagrama del reportero de ARNi GFP expresado en la línea germinal mjIs134[mex-5p::gfp-h2b::tbb-2 3'UTR] con regiones de amplicón de qPCR marcadas. (B) La expresión de GFP se obtuvo a lo largo de las generaciones después de los tratamientos con ARNi a 21 °C. Las barras de error representan la desviación estándar de dos réplicas biológicas. (C) ChIP-qPCR de H3K9me3, histona H3 y control de IgG en adultos jóvenes F1 a partir de dos réplicas biológicas. clec-18 y hrp-2 son los loci de control positivo y negativo para el enriquecimiento de H3K9me3, respectivamente. (D) Enriquecimiento de H3K9me3 e histona H3 en el reportero de ARNi de GFP normalizado al locus de control positivo clec-18. (E) Cambio en el enriquecimiento de H3K9me3 e histona H3 entre los animales tratados con ARNi GFP y los animales tratados con ARNi control, con normalización a clec-18. La línea punteada representa un cambio de plegado de 1. <a href="https://www.jove.com/files/ftp_upload/65285/65285fig02large.jpg" target="_blank">Haga clic aquí para ver una versión más grande de esta figura.</a>

Watch this Scientific Journal Video about RNAi Inheritance and ChIP in C. elegans at JoVE.com

Este protocolo describe un ensayo de interferencia de ARN y ChIP para estudiar la herencia epigenética del silenciamiento inducido por ARNi y las modificaciones asociadas a la cromatina en C. elegans.

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through ...

La investigación en nuestro laboratorio examina cómo las proteínas asociadas a la cromatina, las modificaciones de las histonas y los factores de la vía del ARN pequeño trabajan juntos en el contexto del desarrollo y la herencia epigenética transgeneracional. El ensayo de herencia de ARN, utilizando un reportero GFP, se ha convertido en una herramienta muy poderosa. Este protocolo describe cómo estandarizar la preparación, el puntaje y el paso de gusanos, y la preparación de muestras de ChIP, lo que puede ayudar a generar resultados reproducibles.Uno de los retos experimentales cuando se estudian los transgenes expresados en la línea germinal es aislar los efectos en la línea germinal del animal. Actualmente estamos utilizando animales enteros para ChIP, pero en el futuro nos gustaría desarrollar ensayos para examinar la cromatina, específicamente en la línea germinal. Nuestro laboratorio está interesado en la metilación de histonas y las proteínas que reconocen estas marcas.En el futuro, nos gustaría investigar la interacción entre estos lectores de cromatina y las pequeñas vías de ARN en el contexto de la herencia de ARNi en los transgenes y la regulación de las secuencias endógenas.

analysis-transgenerational-epigenetic-inheritance-c-elegans-using

Research

JoVE Journal

Genetics

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

1.6K vistas.  University of Toronto. La investigación en nuestro laboratorio examina cómo las proteínas asociadas a la cromatina, las modificaciones de las histonas y los factores de la vía del ARN pequeño trabajan juntos en el contexto del desarrollo y la herencia epigenética transgeneracional. El ensayo de herencia de ARN, utilizando un reportero GFP, se ha convertido en una herramienta muy poderosa. Este protocolo describe cómo estandarizar la preparación, el puntaje y el paso de gusanos, y la preparación de muestras...

Video: Autor destacado: Herencia de ARNi y ChIP en C. elegans 

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.

This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.

Investigación

Genética

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates  

Prepare animals for the RNAi inheritance assay by picking three or four gravid Caenorhabditis elegans adults under the 35 millimeter standard NGM plates seeded with OP50-1 bacteria. After four days, wash the gravid adult worms off the plates into 1.5 milliliter tubes using 800 microliters of M9 buffer supplemented with Triton X-100. Repeat the wash and pull the worms into one tube.After centrifuging the worms at 1, 000 G for 1.5 to two minutes, aspirate the supernatant leaving 100 microliters without disturbing the worm pellet. To each tube containing the worm pellet, add 650 microliters of double distilled water. To isolate the C.elegans embryos from the collected population, add 250 microliters of the freshly prepared bleaching solution and start a timer.Every one to two minutes, vortex the tubes thoroughly. After five minutes, monitor the degradation of adult worms under the stereoscope. Continue vortexing until the worms are completely dissolved and only embryos remain.This generally takes six to seven minutes. Immediately centrifuge the tubes at 1, 000 G for 1.5 minutes and aspirate the supernatant, leaving approximately 50 to 100 microliters of the supernatant with the embryos. Add one milliliter of M9 buffer supplemented with Triton X-100 to the embryos and vortex.Centrifuge the suspension and repeat the wash two times. After the final wash, aspirate the supernatant and leave approximately 100 microliters in the tube. Vortex the tubes with isolated embryos and pipette two microliters from each tube twice onto a labeled glass slide.Count the embryos using a tally counter to estimate the concentration of embryos per microliter. To start a semi-synchronized population growth, transfer approximately 250 embryos onto each RNAi NGM plate containing E.coli HT115 bacteria with GFP or control RNAi vectors. Allow the liquid to absorb.Incubate the P naught generation treated with RNAi for four days at 21 degrees Celsius.

Blanqueamiento y siembra de embriones de generación P0 de Caenorhabditis elegans en placas de ARNi-NGM

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression  

Begin preparing the agarose pads by placing a drop of melted 1%agarose onto the vinyl record using a glass Pasteur pipet. Orient a glass slide so that the lines on the record are horizontal or vertical, and place the slide quickly onto the agarose drop for 30 seconds. Remove the glass slide from the record and add approximately five microliters of freshly prepared five millimolar levamisole under the stereoscope.Gently flick the tube containing worms and transfer 5 to 10 microliters onto the agarose pad to mount the worms. Estimate the number of worms as they are being added so that there are approximately 40 worms per replicate. Line up the worms in rows using an eyelash pick, and place a glass coverslip onto the slide.Isolate the embryos from the remaining worms using the bleaching protocol and plate 250 embryos onto 35 millimeter NGM plates seeded with OP50-1 bacteria. Under the fluorescent stereoscope, use a GFP filter set and count and record the number of GFP positive and GFP negative worms on the slides for each replicate using a tally counter. The manual scoring of the nuclear GFP signal in the germline for each generation showed that the silencing of the transgene was fully penetrant in the scored P0 and F1 worms treated with GFP RNAi.In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%By the F5 generation, the majority of the population did not show the inheritance of silencing. By the F10 generation, all the worms expressed GFP and no inheritance was detected.

Aprobación y puntuación de la generación P0 de Caenorhabditis elegans para la expresión de GFP de la línea germinal

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)  

Begin by plating approximately 3, 500 C.elgans F1 generation embryos on 14 plates and allow them to grow to the young adult stage for three days at 21 degrees Celsius. Wash and collect the C.elgans into 1.5-milliliter tubes using PBS/TX. Centrifuge at 1000 G for two minutes, aspirate, and pull the worms from one strain into one tube.Repeat three washes with PBS/TX. Next, aspirate the supernatant leaving one milliliter in the tube and invert to mix. After counting the number of C.elgans worms in three microliters three times, calculate the concentration of worms and transfer a volume corresponding to 3000 worms to a new tube for formaldehyde cross-linking.

Colección de Caenorhabditis elegans de la generación F1 para inmunoprecipitación de cromatina (ChIP)

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP  

Begin by adding formaldehyde to a 1.8%final concentration to the tube containing the worms and rotating the tube at room temperature for six minutes. Then immediately freeze the tubes in liquid nitrogen, and store the samples at 80 degrees Celsius. To proceed thaw the formaldehyde cross-link sample in a room temperature water bath for three minutes, and rotate the samples for 16 minutes at room temperature.At 1.25 molar glycine to a 125 millimolar final concentration, and rotate for five minutes at room temperature. Following this step, keep the samples on ice, or at four degrees, and use ice cold buffers until the magnetic bead elution. After centrifuging the sample at 1000 g for three minutes, wash it three times with one milliliter of PBSTX.Then wash it two times with one milliliter of Resuspension Buffer. After the last wash, leave enough Buffer to ensure the total volume is at least three times the pellet volume and a minimum of 100 microliters.

Reticulación de formaldehído de la generación F1 de Caenorhabditis elegans para ChIP

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation  

Begin by mixing and aliquoting 90 to 120 microliters of the formaldehyde crosslinked C.Elegans samples into a polystyrene sonication tube. Add an equal volume of resuspension buffer containing 2X detergents. Sonicate in a water bath sonicator for seven minutes.Gently mix the sample by pipetting and repeat the sonication for an additional seven minutes. Once done, transfer the sonicated lysate to a 1.5 milliliter tube. Add a half volume of resuspension buffer without detergents.After centrifugation at 13, 000 G for 15 minutes at four degrees Celsius, divide the lysate supernatant into four parts. Store the input lysate part at minus 20 degrees Celsius in a 1.5 milliliter tube. Add 0.5 micrograms of anti-H3K9 trimethylation, anti-histone H3 or IgG to the appropriate immunoprecipitation or IP sample.Incubate the reaction at four degrees Celsius overnight with rotation. The following day, aliquot the nine microliters of protein G coated magnetic beads per IP sample in a 1.5 milliliter tube. After two washes with one milliliter of FA-150, resuspend the magnetic beads in the FA-150 buffer.Once done, add 7.5 microliters of the magnetic bead suspension to each IP antibody mix before incubating the tubes at four degrees Celsius for two hours with rotation. Next, wash the magnetic beads seven times using at least 200 microliters of each buffer solution. Incubate each wash at four degrees Celsius for five minutes with rotation before collecting the beads on a magnetic stand to aspirate the wash.After aspirating the last wash of the buffer, resuspend the magnetic beads in 50 microliters of chromatin IP elution buffer, and transfer it to a 1.5 milliliter tube. After eluting the sample in a ThermoMixer, collect the beads on a magnetic stand and transfer the supernatant to a new tube. Repeat the elution with another 50 microliters of chromatin immunoprecipitation elution buffer.Once done, pull a total of 100 microliters of supernatant before proceeding with reverse cross-linking and DNA elution.