Araçları geliştiren ve paylaşan ve bu makalede çalışmalarına atıfta bulunulan C. elegans topluluğundaki laboratuvarlara teşekkür etmek istiyoruz. Bazı suşlar, NIH Araştırma Altyapısı Programları Ofisi (P40 OD010440) tarafından finanse edilen CGC tarafından sağlanmıştır. Bu çalışma, Kanada Sağlık Araştırmaları Enstitüleri (CIHR) Projesi tarafından A.L.S.'ye (PJT-175245) hibe ile desteklenmiştir. CL, Kanada Doğa Bilimleri ve Mühendislik Araştırma Konseyi (NSERC) lisansüstü bursu (PGS-D) tarafından desteklenmektedir.

Caenorhabditis elegans'ta Epigenetik Kalıtım ve ChIP

<ol>
	<li>Alcazar, R. M., Lin, R., Fire, A. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmission+dynamics+of+heritable+silencing+induced+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans.</a> Genetics. 180 (3), 1275-1288 (2008).</li><li>Ashe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+can+trigger+a+multigenerational+epigenetic+memory+in+the+germline+of+C.+elegans.">piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.</a> Cell. 150 (1), 88-99 (2012).</li><li>Buckley, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+Argonaute+promotes+multigenerational+epigenetic+inheritance+and+germline+immortality.">A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.</a> Nature. 489 (7416), 447-451 (2012).</li><li>Vastenhouw, N. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+silencing+by+RNAi.">Long-term gene silencing by RNAi.</a> Nature. 442 (7105), 882 (2006).</li><li>Lee, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+piRNAs+mediate+the+genome-wide+surveillance+of+germline+transcripts.">C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.</a> Cell. 150 (1), 78-87 (2012).</li><li>Luteijn, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extremely+stable+Piwi-induced+gene+silencing+in+Caenorhabditis+elegans.">Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.</a> The EMBO Journal. 31 (16), 3422-3430 (2012).</li><li>Sapetschnig, A., Sarkies, P., Lehrbach, N. J., Miska, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+siRNAs+mediate+paramutation+in+C.+elegans.">Tertiary siRNAs mediate paramutation in C. elegans.</a> PLoS Genetics. 11 (3), e1005078 (2015).</li><li>Shirayama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+initiate+an+epigenetic+memory+of+nonself+RNA+in+the+C.+elegans+germline.">piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.</a> Cell. 150 (1), 65-77 (2012).</li><li>Minkina, O., Hunter, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+heritable+germline+silencing+directs+somatic+silencing+at+an+endogenous+locus.">Stable heritable germline silencing directs somatic silencing at an endogenous locus.</a> Molecular Cell. 65 (4), 659-670 (2017).</li><li>Seroussi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+epigenetic+regulation+by+C.+elegans+nuclear+RNA+interference+pathways.">Mechanisms of epigenetic regulation by C. elegans nuclear RNA interference pathways.</a> Seminars in Cell &amp; Developmental Biology. 127, 142-154 (2022).</li><li>Lev, I., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K9me3+is+required+for+inheritance+of+small+RNAs+that+target+a+unique+subset+of+newly+evolved+genes.">H3K9me3 is required for inheritance of small RNAs that target a unique subset of newly evolved genes.</a> eLife. 8, e40448 (2019).</li><li>Woodhouse, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifiers+SET-25+and+SET-32+are+required+for+establishment+but+not+long-term+maintenance+of+transgenerational+epigenetic+inheritance.">Chromatin modifiers SET-25 and SET-32 are required for establishment but not long-term maintenance of transgenerational epigenetic inheritance.</a> Cell Reports. 25 (8), 2259-2272 (2018).</li><li>Houri-Zeevi, L., Teichman, G., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+resets+ancestral+heritable+small+RNA+responses.">Stress resets ancestral heritable small RNA responses.</a> eLife. 10, e65797 (2021).</li><li>Houri-Ze'evi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tunable+mechanism+determines+the+duration+of+the+transgenerational+small+RNA+inheritance+in+C.+elegans.">A tunable mechanism determines the duration of the transgenerational small RNA inheritance in C. elegans.</a> Cell. 165 (1), 88-99 (2016).</li><li>Spracklin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+inheritance+machinery+of+Caenorhabditis+elegans.">The RNAi inheritance machinery of Caenorhabditis elegans.</a> Genetics. 206 (3), 1403-1416 (2017).</li><li>Perales, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+epigenetic+inheritance+is+negatively+regulated+by+the+HERI-1+chromodomain+protein.">Transgenerational epigenetic inheritance is negatively regulated by the HERI-1 chromodomain protein.</a> Genetics. 210 (4), 1287-1299 (2018).</li><li>Shukla, A., Perales, R., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+coordinate+poly(UG)+tailing+to+prevent+aberrant+and+perpetual+gene+silencing.">piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.</a> Current Biology. 31 (20), 4473-4485 (2021).</li><li>Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+GeneticsWormBook:+the+Online+Review+of+C.+elegans+Biology.">Reverse GeneticsWormBook: the Online Review of C. elegans Biology.</a> WormBook. , (2006).</li><li>Rivera Gomez, K., Schvarzstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+of+nematodes+for+live+imaging+using+an+agarose+pad+produced+with+a+Vinyl+Record.">Immobilization of nematodes for live imaging using an agarose pad produced with a Vinyl Record.</a> microPublication Biology. 2018, (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook: The Online Review of C. Elegans Biology. , 1-11 (2006).</li><li>Askjaer, P., Ercan, S., Meister, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modern+techniques+for+the+analysis+of+chromatin+and+nuclear+organization+in+C.+elegans.">Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.</a> WormBook: the Online Review of C. elegans Biology. , 1-35 (2014).</li><li>Gu, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+siRNA+in+Caenorhabditis+elegans+generates+a+transgenerational+sequence-targeted+histone+H3+lysine+9+methylation+footprint.">Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.</a> Nature Genetics. 44 (2), 157-164 (2012).</li><li>Kalinava, N., Ni, J. Z., Peterman, K., Chen, E., Gu, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoupling+the+downstream+effects+of+germline+nuclear+RNAi+reveals+that+H3K9me3+is+dispensable+for+heritable+RNAi+and+the+maintenance+of+endogenous+siRNA-mediated+transcriptional+silencing+in+Caenorhabditis+elegans.">Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.</a> Epigenetics &amp; Chromatin. 10, 6 (2017).</li><li>Kalinava, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=elegans+heterochromatin+factor+SET-32+plays+an+essential+role+in+transgenerational+establishment+of+nuclear+RNAi-mediated+epigenetic+silencing.">elegans heterochromatin factor SET-32 plays an essential role in transgenerational establishment of nuclear RNAi-mediated epigenetic silencing.</a> Cell Reports. 25 (8), 2273-2284 (2018).</li><li>Lev, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MET-2-dependent+H3K9+methylation+suppresses+transgenerational+small+RNA+inheritance.">MET-2-dependent H3K9 methylation suppresses transgenerational small RNA inheritance.</a> Current Biology. 27 (8), 1138-1147 (2017).</li><li>Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+specific+RNA-mediated+interference+through+ingested+double-stranded+RNA+in+Caenorhabditis+elegans.">Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans.</a> Genome Biology. 2 (1), (2001).</li><li>Xu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytoplasmic+Argonaute+protein+promotes+the+inheritance+of+RNAi.">A cytoplasmic Argonaute protein promotes the inheritance of RNAi.</a> Cell Reports. 23 (8), 2482-2494 (2018).</li><li>Grishok, A., Tabara, H., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+requirements+for+inheritance+of+RNAi+in+C.+elegans.">Genetic requirements for inheritance of RNAi in C. elegans.</a> Science. 287 (5462), 2494-2497 (2000).</li><li>Houri-Zeevi, L., Korem Kohanim, Y., Antonova, O., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+rules+explain+transgenerational+small+RNA+inheritance+in+C.+elegans.">Three rules explain transgenerational small RNA inheritance in C. elegans.</a> Cell. 182 (5), 1186-1197 (2020).</li><li>Burton, N. O., Burkhart, K. B., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+RNAi+maintains+heritable+gene+silencing+in+Caenorhabditis+elegans.">Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans.</a> Proceedings of the National Academy of Sciences. 108 (49), 19683-19688 (2011).</li><li>Mao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Nrde+pathway+mediates+small-RNA-directed+histone+H3+lysine+27+trimethylation+in+Caenorhabditis+elegans.">The Nrde pathway mediates small-RNA-directed histone H3 lysine 27 trimethylation in Caenorhabditis elegans.</a> Current Biology. 25 (18), 2398-2403 (2015).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Research. 22 (9), 1813-1831 (2012).</li><li>Mukhopadhyay, A., Deplancke, B., Walhout, A. J. M., Tissenbaum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+(ChIP)+coupled+to+detection+by+quantitative+real-time+PCR+to+study+transcription+factor+binding+to+DNA+in+Caenorhabditis+elegans.">Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.</a> Nature Protocols. 3 (4), 698-709 (2008).</li></ol>

Tüm yazarlar, açıklanacak herhangi bir çelişkileri olmadığını onaylar.

Bu protokolde, dsRNA, C. elegans18'de standart bir yöntem haline gelen besleme yoluyla tanıtılır. RNAi kalıtım deneyleri için besleme yaklaşımı, büyük bir P0 popülasyonu 2,11,12,22,23,24,25 elde etmek için kolay bir yöntem sağlar. Bununla birlikte, RNAi maruziyetinin zamanlaması ve süresi, transgen susturmanın etkinliğini etkiler26 ve RNAi bakterilerinin konsantrasyonu, kalıtsal RNAi susturmanınkalıcılığını etkiler 1. Bu nedenle, standartlaştırılmış RNAi bakterileri ve solucan büyümesi, tutarlı bir GFP susturma seviyesi ve kalıtım süresi elde etmek için önemlidir. Burada embriyolar RNAi plakaları üzerine kaplanır, böylece P0 hayvanları yumurtadan RNAi bakterilerine maruz kalır. Alternatif yaklaşımlar, senkronize L1 24,27 veyaL4 25 evre hayvanlarını RNAi-NGM plakalarına kaplamıştır. Ek olarak, açlık ve diğer stresler RNAi kalıtımının13 sürdürülmesini etkilediğinden, gıda arzının aşırı kalabalıklaşmasını ve tükenmesini önlemek için plakalar izlenmelidir. Beslenme yoluyla RNAi'yi başlatmaya bir alternatif olarak, öncü C. elegans RNAi kalıtım çalışmalarından bazıları, dsRNA konsantrasyonunun daha fazla kontrolünü sağlayangonad enjeksiyonu yoluyla RNAi'yi indükledi 1,28.
Bu protokolde, her nesil, daha önce tarif edildiği gibialkalin hipoklorit muamelesi ile bir popülasyon olarak kabul edilir 16,22,23,24. Hipoklorit arıtımı, F1 neslinin ebeveyn ortamından22 RNAi bakterileri ile kontamine olmamasını sağlar ve olası istenmeyen popülasyon darboğazını önler. Bununla birlikte, toplu geçiş de bir sınırlama olabilir, çünkü bireysel hayvanlar farklı kalıtım modellerinesahip olabilir 1,29. Her nesli oluşturmak için alternatif bir yöntem, tek tek hayvanlarıseçmektir 1,2,9,11,25. Bu yaklaşım, soylar içindeki fenotiplerin izlenmesine ve genetik çaprazlamaların dahil edilmesine izin verir. Soy analizi, düşük penetranslı fenotipler için de avantajlı olabilir12.
Floresan protein ekspresyonu, RNAi kaynaklı susturma 2,3,4,12,14,15,16,25,30'un güçlü ve kullanışlı bir okumasıdır. Bu protokolde açıklandığı gibi, GFP ifadesi manuel olarak AÇIK veya KAPALI 11,12,15,16,25 olarak puanlanabilir. Manuel puanlama,nitel yoğunluk seviyeleri 3,4,14 atanarak daha da iyileştirilebilir. Alternatif olarak, mikroskopi görüntülerinin 11,12,14,25,27 otomatik yoğunluk puanlaması veya canlı hayvanların akış sitometrisi floresan ölçümü2 kantitatif ve yüksek verimli bir okuma sağlayabilir. Bununla birlikte, raportör ifadesi germ hattı ile sınırlı olduğundan, otomatik yaklaşımların bir uyarısı, özellikle çalışma anormal germ hattı gelişimine sahip mutantları içeriyorsa, susturulmuş GFP ekspresyonu olan hayvanlar ile germ hattı olmayan hayvanlar arasında ayrım yapmaları gerektiğidir. GFP floresansına alternatif olarak, RNAi hedef pre-mRNA ve mRNA seviyeleri 2,16,23,24'ü ölçmek için ters transkripsiyon (RT)-qPCR kullanılabilir. Bu yaklaşım, RNA'yı hedef alan susturmanın daha doğrudan bir okumasını sağlar ve özellikle susturmanın görünür bir fenotip üretmediği diğer RNAi hedefleri için yararlıdır. Yapay GFP raportörlerinin kullanılmasının bir sınırlaması, eksojen ve endojen dizilerin nesiller arası RNAi11'de diferansiyel olarak düzenlenmesidir. Bu nedenle, sıcaklığa duyarlı embriyonik öldürücü alel oma-1(zu405)1,11,16,25 gibi endojen hedeflerle yapılan çalışmalar, floresan transgen raportörlerine tamamlayıcı bir yaklaşım olarak düşünülmelidir.
ChIP'nin RNAi kalıtım testleri bağlamında analizi, tedaviler ve replikasyonlar arasında karşılaştırma yapılmasını gerektirir. İlk olarak, numuneler arasındaki başlangıç malzemesindeki farklılıkları hesaba katmak için, ChIP sinyali, 'Giriş yüzdesi' ile aynı lokusta Giriş sinyaline normalleştirilir. Bir histon H3 ChIP'nin paralel olarak işlenmesi, herhangi bir histon modifikasyon değişikliğinin nükleozom yoğunluğundaki değişikliklere karşılık gelip gelmediğini belirlemeye yardımcı olacaktır. Ek olarak, ChIP çok adımlı bir süreç olduğundan, verimlilik numuneler arasında değişebilir. Uygun pozitif ve negatif kontrol lokuslarının seçimi, numuneler ve deneyler arasındaki sinyal-gürültü oranını değerlendirmek ve karşılaştırmak için yararlıdır. Ek olarak, numuneler arasındaki karşılaştırmaları kolaylaştırmak için, RNAi hedefindeki ChIP DNA qPCR eşik döngüsü değerleri genelliklebir kontrol odağı 3,11,15,23,30,31'e normalleştirilir. RNAi tedavisinin etkilerini değerlendirmek için, tedavi RNAi'sindeki ChIP sinyalinin kontrol veya RNAi olmayan koşullara oranı da karşılaştırılır. Mevcut yaklaşımın bir sınırlaması, ChIP'nin bütün hayvanlarla gerçekleştirilmesidir, RNAi tedavisine verilen yanıt ise germ hattına özgü olabilir. Bu uyarının üstesinden gelmek için bir yaklaşım, izole germ hattı çekirdeklerini kullanarak ChIP gerçekleştirmektir. ChIP'yi optimize etmek için ek teknik hususlar da başka bir yerde kapsamlı bir şekilde tartışılmıştır32,33.
Genel olarak, bu RNAi kalıtımı ve ChIP protokolü, nesiller arası epigenetik düzenlemeyi daha fazla keşfetmek için diğer tekniklerle entegre edilebilecek ayrıntılı ve uyarlanması kolay bir temel sağlar. Örneğin, kromatin manzarasının hem RNAi hedefine yakın hem de genom çapında bir ölçekte daha ayrıntılı bir görünümü için ChIP DNA'dan (ChIP-seq) yüksek verimli dizileme kütüphaneleri oluşturulabilir.

Epigenetik kalıtım, gen düzenleyici bilgilerin nesiller boyunca aktarılmasına izin verir ve bu nedenle ebeveynlerin çevresinin veya deneyimlerinin soylarını etkilemesine izin verebilir. C. elegans'ta, eksojen çift sarmallı RNA (dsRNA) tarafından başlatılan germ hattı gen susturması, orijinal tetikleyiciyemaruz kalmayan döllerde birden fazla nesil için kalıtsal olabilir 1,2,3,4. RNA interferansı (RNAi) kalıtımı olarak adlandırılan bu süreç, C. elegans'ta piRNA tarafından başlatılan çok kuşaklı susturma2,5, paramutasyon/RNAe (RNA kaynaklı epigenetik susturma)6,7,8 ve çok kopyalı dizi tarafından başlatılan susturma9 dahil olmak üzere, küçük RNA ve kromatin düzenleme makineleri için örtüşen ancak farklı gereksinimleri olan birkaç ilgili epigenetik susturma fenomeninden biridir . C. elegans eksojen RNAi'de dsRNA, hedef mRNA'larını tanımak için birincil Argonaute proteinleri ile bir kompleks içinde hareket eden küçük enterferans yapan RNA'lara (siRNA'lar) işlenir. Bu hedefleme, hem sitoplazmik hem de nükleer susturma yolları yoluyla hedef mRNA'yı susturmak için ikincil Argonotlar ile ilişkili ikincil siRNA'ların amplifikasyonuna yol açar. Germ hattı eksprese edilen RNAi hedefleri için, nükleer ikincil Argonaute HRDE-1 ve ek nükleer RNAi faktörleri, yeni ortaya çıkan transkriptleri hedef alır, bu da transkripsiyonel baskılama ve H3K9me310 dahil olmak üzere baskılayıcı kromatin işaretlerini biriktirmek için histon metiltransferazların işe alınmasına neden olur. Histon H3K9me3, RNAi kalıtımı11,12 ile germ hattı ile eksprese edilen yeşil floresan protein (GFP) transgenlerinin kalıtsal susturulmasının kurulmasını destekler.
Bu protokolün amacı, RNAi kalıtımı için bir raportör olarak germ hattında bir GFP-histon füzyon proteinini eksprese eden bir transgen kullanmak ve kromatin immünopresipitasyon ve kantitatif polimeraz zincir reaksiyonu (ChIP-qPCR) kullanarak raportör transgen lokusunda histon modifikasyonlarındaki değişiklikleri test etmektir. Bu protokol, raportör susturmayı başlatmak için standartlaştırılmış bir plaka bazlı RNAi besleme yaklaşımını açıklar. Ayrıca, alkalin hipoklorit tedavisi ('ağartma') ile gravid yetişkinlerden utero embriyoları izole ederek hayvanların nesiller arasında geçirilmesi için ayrıntılı bir zaman çizelgesi sağlar. Floresan mikroskobu ile popülasyonun bir alt kümesinde GFP susturma sıklığının izlenmesi ve histon H3K9me3 ChIP-qPCR için yöntemler ve temsili veriler de açıklanmaktadır. Raportör tabanlı RNAi kalıtım deneyleri, epigenetik düzenlemede genetik ve çevresel faktörlerin rollerini işlevsel olarak incelemek için oldukça izlenebilir bir sistem sağlar 13,14 ve bu tür raportörleri kullanan genetik taramalar, hem 2,3,15 için gerekli olan genleri hem de16,17 nesiller arası epigenetik kalıtım süresini negatif olarak düzenleyen genleri tanımlamıştır.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Agarose</td>
			<td>Bioshop</td>
			<td>AGA002</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Bioshop</td>
			<td>AMP201</td>
			<td>Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Anti-H3K9me3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab8898</td>
			<td>Concentration is batch-dependent (0.9 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Anti-Histone H3 Rabbit Polyclonal Antibody</td>
			<td>Abcam</td>
			<td>ab1791</td>
			<td>Concentration is batch-dependent (0.7 - 1 mg/mL).</td>
		</tr>
		<tr>
			<td>Bleach (6% Sodium hypochlorite)</td>
			<td>Lavo</td>
			<td>02358107</td>
			<td></td>
		</tr>
		<tr>
			<td>C. elegans strain with GFP RNAi Reporter</td>
			<td>NA</td>
			<td>SX1263</td>
			<td>Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge.</td>
		</tr>
		<tr>
			<td>Carbenicillin</td>
			<td>BioShop</td>
			<td>CAR544</td>
			<td>Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Dynabeads Protein G Magnetic Beads</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain HT115(DE3)</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>HT115(DE3)</td>
			<td></td>
		</tr>
		<tr>
			<td>E. coli strain OP50-1</td>
			<td>Caenorhabditis Genetics Center (CGC)</td>
			<td>OP50-1</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (0.5 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15575020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence Stereoscope</td>
			<td>Zeiss</td>
			<td>Axio Zoom.V16</td>
			<td></td>
		</tr>
		<tr>
			<td>Formaldehyde (37%)</td>
			<td>Sigma</td>
			<td>F8775</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Sigma</td>
			<td>50046</td>
			<td>Make a 1.25 M solution and store at 4 &#176;C.</td>
		</tr>
		<tr>
			<td>HEPES-KOH (1 M, pH 7.5)</td>
			<td>Teknova</td>
			<td>H1035</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrophobic Printed Slides, 10 wells</td>
			<td>VWR</td>
			<td>100488-904</td>
			<td></td>
		</tr>
		<tr>
			<td>IGEPAL CA-630 (Octylphenol ethoxylate)</td>
			<td>BioShop</td>
			<td>NON999</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
		<tr>
			<td>IPTG (Isopropyl-&#946;-D-thiogalactoside)</td>
			<td>BioShop</td>
			<td>IPT001</td>
			<td>Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>1725122</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar Plates supplemented with 100 &#181;g/mL Ampicillin</td>
			<td>NA</td>
			<td>NA</td>
			<td>Standard lab recipe.</td>
		</tr>
		<tr>
			<td>Levamisole (Tetramisole hydrochloride)</td>
			<td>Sigma</td>
			<td>L9756</td>
			<td>Make a 200 mM solution in ultrapure water. Store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>LiCl (8 M)</td>
			<td>Sigma</td>
			<td>L7026</td>
			<td></td>
		</tr>
		<tr>
			<td>M9 Buffer</td>
			<td>NA</td>
			<td>NA</td>
			<td>22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4.</td>
		</tr>
		<tr>
			<td>Magnetic Separator (1.5 mL tubes)</td>
			<td>Applied Biosystems</td>
			<td>A13346</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Separator (0.2 mL tubes)</td>
			<td>Permagen</td>
			<td>MSR812</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Cover Glass</td>
			<td>Fisher Scientific</td>
			<td>12541B</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope Slide</td>
			<td>Technologist Choice</td>
			<td>LAB-037</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl (5 M)</td>
			<td>Promega</td>
			<td>V4221</td>
			<td>For ChIP buffers.</td>
		</tr>
		<tr>
			<td>NaOH&#160;</td>
			<td>Sigma</td>
			<td>S5881</td>
			<td>Make a 10 M solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>NGM Plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#956;g/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 &#181;g/mL streptomycin.</td>
		</tr>
		<tr>
			<td>Normal Rabbit IgG (1 mg/mL)</td>
			<td>Cell Signaling Technology</td>
			<td>2729</td>
			<td></td>
		</tr>
		<tr>
			<td>Petri Dishes (35 mm x 10 mm)</td>
			<td>Sarstedt</td>
			<td>82.1135.500</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate Buffered Saline (10X)</td>
			<td>Fisher BioReagents</td>
			<td>BP3991</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - Control RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4440 (Plasmid #1654)</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmid - GFP-targetting RNAi&#160;</td>
			<td>Addgene</td>
			<td>L4417 (Plasmid #1649)</td>
			<td>Note, alternative L4440-derived plasmids targeting GFP can be used.</td>
		</tr>
		<tr>
			<td>Primer pair [-3.3 kb upstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG</td>
		</tr>
		<tr>
			<td>Primer pair [+1.3 kb downstream of gfp]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT</td>
		</tr>
		<tr>
			<td>Primer pair [clec-18]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 1]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC</td>
		</tr>
		<tr>
			<td>Primer pair [gfp exon 4]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA</td>
		</tr>
		<tr>
			<td>Primer pair [hrp-2]</td>
			<td>Integrated DNA Technologies</td>
			<td>NA</td>
			<td>F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA</td>
		</tr>
		<tr>
			<td>Protease Inhibitor Cocktail Tablet</td>
			<td>Roche</td>
			<td>11836170001</td>
			<td></td>
		</tr>
		<tr>
			<td>Proteinase K&#160;</td>
			<td>Bioline</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr>
			<td>QIAquick PCR Purification Kit&#160;</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td></td>
		</tr>
		<tr>
			<td>Real-Time PCR Detection System</td>
			<td>Bio-Rad</td>
			<td>CFX96&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAi-NGM plates</td>
			<td>NA</td>
			<td>NA</td>
			<td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &#181;g/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 &#181;g/mL carbenicillin and 5 mM IPTG.</td>
		</tr>
		<tr>
			<td>RNase A</td>
			<td>Sigma</td>
			<td>R4642</td>
			<td></td>
		</tr>
		<tr>
			<td>Sarkosyl (N-Lauroylsarcosine sodium salt)</td>
			<td>Sigma</td>
			<td>L5777</td>
			<td>Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>74255</td>
			<td>Make a 10% (w/v) solution and store at room temperature.</td>
		</tr>
		<tr>
			<td>Sodium deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td>
		</tr>
		<tr>
			<td>Sonication Tube</td>
			<td>Evergreen</td>
			<td>214-3721-010</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonication Tube Cap</td>
			<td>Evergreen</td>
			<td>300-2911-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Qsonica</td>
			<td>Q800R3-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptomycin sulfate</td>
			<td>Bioshop</td>
			<td>STP101</td>
			<td>Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>TAE buffer (1X)</td>
			<td>NA</td>
			<td>NA</td>
			<td>40 mM Tris, 20 mM acetate, 1 mM EDTA</td>
		</tr>
		<tr>
			<td>Tally counter clicker</td>
			<td>Uline</td>
			<td>H-7350</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Bioshop</td>
			<td>TET701</td>
			<td>Make a 5 mg/mL solution in ethanol and store at -20 &#176;C.</td>
		</tr>
		<tr>
			<td>Thermomixer</td>
			<td>Eppendorf</td>
			<td>05-400-205</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-HCl (1 M, pH 8.0)</td>
			<td>Invitrogen</td>
			<td>15568025</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma</td>
			<td>T8787</td>
			<td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td>
		</tr>
	</tbody>
</table>

analysis of transgenerational epigenetic inheritance in c. elegans using a fluorescent reporter and chromatin immunoprecipitation (chip)

Nesiller arası epigenetik kalıtım (TEI), kodlamayan RNA'lar ve kromatin modifikasyonları gibi faktörler aracılığıyla genom dizisini değiştirmeden germ hattı boyunca bilgi aktarımına izin verir. Nematod Caenorhabditis elegans'ta RNA interferansı (RNAi) kalıtımı olgusu, bu model organizmanın kısa yaşam döngüsünden, kendi kendine yayılmasından ve şeffaflığından yararlanan TEI'yi araştırmak için etkili bir modeldir. RNAi kalıtımında, hayvanların RNAi'ye maruz kalması, ilk tetikleyicinin yokluğunda birden fazla nesil boyunca devam eden hedef lokusta gen susturulmasına ve değişmiş kromatin imzalarına yol açar. Bu protokol, germ hattı ile eksprese edilen bir nükleer yeşil floresan protein (GFP) raportörü kullanılarak C. elegans'ta RNAi kalıtımının analizini açıklar. Muhabir susturma, GFP'yi hedefleyen çift sarmallı RNA eksprese eden bakterilerin hayvanlarla beslenmesiyle başlatılır. Her nesilde, senkronize gelişimi sürdürmek için hayvanlar geçirilir ve raportör gen susturma mikroskopi ile belirlenir. Seçilmiş nesillerde, GFP raportör lokusunda histon modifikasyon zenginleşmesini ölçmek için kromatin immünopresipitasyon (ChIP)-kantitatif polimeraz zincir reaksiyonu (qPCR) için popülasyonlar toplanır ve işlenir. RNAi kalıtımını incelemek için bu protokol, küçük RNA ve kromatin yolaklarındaki TEI faktörlerini daha fazla araştırmak için kolayca değiştirilebilir ve diğer analizlerle birleştirilebilir.

Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment (&#39;bleaching&#39;). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.

Yazar Spotlight: C. elegans'ta RNAi Kalıtım ve ChIP 

Nesiller Arası Epigenetik Kalıtımın Analizi C. elegans Floresan Raportör ve Kromatin İmmünopresipitasyon (ChIP) Kullanılarak

Research in our lab examines how chromatin-associated proteins, histone modifications, and small RNA pathway factors work together in the context of development and transgenerational epigenetic inheritance. The RNA inheritance assay, using a GFP reporter, has become a very powerful tool. This protocol describes how to standardize the preparation, scoring, and passaging of worms, and the preparation of ChIP samples, which can help to generate reproducible results.One of the experimental challenges when studying germline-expressed transgenes is isolating the effects in the animal's germline. We're currently using whole animals for ChIP, but in the future we would like to develop assays to examine chromatin, specifically in the germline. Our laboratory is interested in histone methylation and proteins that recognize these marks.Going forward, we would like to investigate the interplay between these chromatin readers and small RNA pathways in the context of RNAi inheritance at transgenes and the regulation of endogenous sequences.

Germ hattı ile eksprese edilen GFP-histon H2B [mex-5p::gfp-h2b::tbb-2 3'UTR]7 raportörünü taşıyan hayvanlar (Şekil 2A) beslenerek GFP RNAi'ye veya kontrol RNAi'ye maruz bırakıldı ve protokolde ve Şekil 1'de açıklandığı gibi geçti. Germ hattındaki nükleer GFP sinyali, her nesildeki popülasyonun bir örneği için bir floresan diseksiyon mikroskobu kullanılarak manuel olarak puanlandı. Transgenin susturulması, GFP RNAi ile tedavi edilen skorlanmış P0 ve F1 hayvanlarında tamamen nüfuz ediciydi (Şekil 2B). F2 neslinde, GFP susturma kalıtımı sergileyen popülasyonun oranı yaklaşık% 50 idi. F5 kuşağı tarafından, popülasyonun çoğunluğu susturma kalıtımı göstermedi ve F10 kuşağı tarafından, tüm hayvanlar GFP'yi ifade ettiği için kalıtım tespit edilmedi.
RNAi ile indüklenen susturmaya karşılık gelen histon H3K9me3 zenginleşmesindeki değişikliği belirlemek için, GFP RNAi veya kontrol RNAi tedavisini takiben F1 nesil hayvanlarda ChIP-qPCR gerçekleştirildi. Beklendiği gibi, GFP RNAi ile tedavi edilen popülasyon, kontrol RNAi ile tedavi edilen hayvanlara kıyasla GFP hedefinde ve 1.3 kb aşağı akış bölgesinde daha yüksek histon H3K9me3 seviyeleri sergiledi (Şekil 2C). Histon H3K9me3 ChIP'nin özgüllüğü, bu işarette zenginleştirildiği bilinen, ancak yakındaki bir negatif kontrol lokusunda (hrp-2) olmayan bir pozitif kontrol lokusunda (clec-18) zenginleştirme ile desteklenir. Beklendiği gibi tüm qPCR lokuslarında histon H3 zenginleşmesi ve IgG kontrol immünopresipitasyonlarında arka plana yakın zenginleşme de tespit edildi. Raportördeki ChIP zenginleştirmesi clec-18 pozitif kontrol lokusuna normalleştirildiğinde, GFP RNAi üzerinde daha yüksek histon H3K9me3 zenginleşmesi gösterilirken, histon H3 zenginleştirmesi kontrol ve GFP RNAi tedavileri arasında benzerdir (Şekil 2D). GFP RNAi'nin clec-18 lokusundaki histon H3K9me3 veya toplam histon H3 doluluğunu etkilemesi beklenmediğinden, bu normalizasyon, GFP RNAi ve kontrol RNAi numuneleri arasındaki ChIP verimliliğindeki farklılıklar gibi teknik varyasyonlara karşı hafifletir. RNAi tedavileri arasında histon H3K9me3 ve histon H3 seviyelerinin kat değişimi, GFP RNAi kaynaklı susturma üzerine histon doluluğundan bağımsız olarak GFP muhabirine özgü histon H3K9me3 zenginleşmesini gösterir (Şekil 2E).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65285/65285fig02.jpg"> Şekil 2: GFP RNAi kaynaklı susturma, RNAi hedefinde yüksek H3K9me3 zenginleşmesine karşılık gelir. (A) qPCR amplikon bölgeleri etiketli germ hattı ile eksprese edilen GFP RNAi raportörü mjIs134[mex-5p::gfp-h2b::tbb-2 3'UTR] diyagramı. (B) GFP ekspresyonu, 21 ° C'de RNAi tedavilerinden sonra nesiller boyunca puanlandı. Hata çubukları, iki biyolojik kopyadan standart sapmayı temsil eder. (C) İki biyolojik kopyadan F1 genç yetişkinlerde H3K9me3, histon H3 ve IgG kontrolünün ChIP-qPCR'si. clec-18 ve hrp-2, sırasıyla H3K9me3 zenginleştirmesi için pozitif ve negatif kontrol lokuslarıdır. (D) GFP RNAi raporlayıcısında H3K9me3 ve histon H3 zenginleşmesi, clec-18 pozitif kontrol lokusuna normalize edildi. (E) CLEC-18'e normalizasyon ile GFP RNAi ve kontrol RNAi ile tedavi edilen hayvanlar arasında H3K9me3 ve histon H3 zenginleşmesinde değişiklik. Noktalı çizgi, 1'lik bir katlama değişimini temsil eder. <a href="https://www.jove.com/files/ftp_upload/65285/65285fig02large.jpg" target="_blank">Bu rakamın daha büyük bir sürümünü görüntülemek için lütfen buraya tıklayın.</a>

Watch this Scientific Journal Video about RNAi Inheritance and ChIP in C. elegans at JoVE.com

Bu protokol, C. elegans'ta RNAi kaynaklı susturma ve ilişkili kromatin modifikasyonlarının epigenetik kalıtımını incelemek için bir RNA girişimini ve ChIP testini açıklar.

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through ...

Laboratuvarımızdaki araştırmalar, kromatinle ilişkili proteinlerin, histon modifikasyonlarının ve küçük RNA yolu faktörlerinin gelişim ve nesiller arası epigenetik kalıtım bağlamında birlikte nasıl çalıştığını incelemektedir. Bir GFP raportörü kullanan RNA kalıtım testi çok güçlü bir araç haline geldi. Bu protokol, solucanların hazırlanmasının, puanlanmasının ve geçirilmesinin ve tekrarlanabilir sonuçların üretilmesine yardımcı olabilecek ChIP örneklerinin hazırlanmasının nasıl standartlaştırılacağını açıklar.Germ hattı ile eksprese edilen transgenleri incelerken karşılaşılan deneysel zorluklardan biri, hayvanın germ hattındaki etkileri izole etmektir. Şu anda ChIP için bütün hayvanları kullanıyoruz, ancak gelecekte, özellikle germ hattında kromatini incelemek için tahliller geliştirmek istiyoruz. Laboratuvarımız histon metilasyonu ve bu işaretleri tanıyan proteinler ile ilgilenmektedir.İleriye dönük olarak, transgenlerde RNAi kalıtımı ve endojen dizilerin düzenlenmesi bağlamında bu kromatin okuyucuları ve küçük RNA yolları arasındaki etkileşimi araştırmak istiyoruz.

analysis-transgenerational-epigenetic-inheritance-c-elegans-using

Research

JoVE Journal

Genetics

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

1.6K Görüntüleme.  University of Toronto. Laboratuvarımızdaki araştırmalar, kromatinle ilişkili proteinlerin, histon modifikasyonlarının ve küçük RNA yolu faktörlerinin gelişim ve nesiller arası epigenetik kalıtım bağlamında birlikte nasıl çalıştığını incelemektedir. Bir GFP raportörü kullanan RNA kalıtım testi çok güçlü bir araç haline geldi. Bu protokol, solucanların hazırlanmasının, puanlanmasının ve geçirilmesinin ve tekrarlanabilir sonuçların üretilmesine yardımcı olabilecek ChIP ör...

Video: Yazar Spotlight: C. elegans'ta RNAi Kalıtım ve ChIP 

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.

This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.

Genetik

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates

Bleaching and Plating Caenorhabditis elegans P0 Generation Embryos onto RNAi-NGM plates  

Prepare animals for the RNAi inheritance assay by picking three or four gravid Caenorhabditis elegans adults under the 35 millimeter standard NGM plates seeded with OP50-1 bacteria. After four days, wash the gravid adult worms off the plates into 1.5 milliliter tubes using 800 microliters of M9 buffer supplemented with Triton X-100. Repeat the wash and pull the worms into one tube.After centrifuging the worms at 1, 000 G for 1.5 to two minutes, aspirate the supernatant leaving 100 microliters without disturbing the worm pellet. To each tube containing the worm pellet, add 650 microliters of double distilled water. To isolate the C.elegans embryos from the collected population, add 250 microliters of the freshly prepared bleaching solution and start a timer.Every one to two minutes, vortex the tubes thoroughly. After five minutes, monitor the degradation of adult worms under the stereoscope. Continue vortexing until the worms are completely dissolved and only embryos remain.This generally takes six to seven minutes. Immediately centrifuge the tubes at 1, 000 G for 1.5 minutes and aspirate the supernatant, leaving approximately 50 to 100 microliters of the supernatant with the embryos. Add one milliliter of M9 buffer supplemented with Triton X-100 to the embryos and vortex.Centrifuge the suspension and repeat the wash two times. After the final wash, aspirate the supernatant and leave approximately 100 microliters in the tube. Vortex the tubes with isolated embryos and pipette two microliters from each tube twice onto a labeled glass slide.Count the embryos using a tally counter to estimate the concentration of embryos per microliter. To start a semi-synchronized population growth, transfer approximately 250 embryos onto each RNAi NGM plate containing E.coli HT115 bacteria with GFP or control RNAi vectors. Allow the liquid to absorb.Incubate the P naught generation treated with RNAi for four days at 21 degrees Celsius.

Caenorhabditis elegans P0 Nesil Embriyoların RNAi-NGM plakalarına Ağartılması ve Kaplanması

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression

Passaging and Scoring the Caenorhabditis elegans P0 Generation for Germline GFP Expression  

Begin preparing the agarose pads by placing a drop of melted 1%agarose onto the vinyl record using a glass Pasteur pipet. Orient a glass slide so that the lines on the record are horizontal or vertical, and place the slide quickly onto the agarose drop for 30 seconds. Remove the glass slide from the record and add approximately five microliters of freshly prepared five millimolar levamisole under the stereoscope.Gently flick the tube containing worms and transfer 5 to 10 microliters onto the agarose pad to mount the worms. Estimate the number of worms as they are being added so that there are approximately 40 worms per replicate. Line up the worms in rows using an eyelash pick, and place a glass coverslip onto the slide.Isolate the embryos from the remaining worms using the bleaching protocol and plate 250 embryos onto 35 millimeter NGM plates seeded with OP50-1 bacteria. Under the fluorescent stereoscope, use a GFP filter set and count and record the number of GFP positive and GFP negative worms on the slides for each replicate using a tally counter. The manual scoring of the nuclear GFP signal in the germline for each generation showed that the silencing of the transgene was fully penetrant in the scored P0 and F1 worms treated with GFP RNAi.In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%By the F5 generation, the majority of the population did not show the inheritance of silencing. By the F10 generation, all the worms expressed GFP and no inheritance was detected.

Germline GFP Ekspresyonu için Caenorhabditis elegans P0 Jenerasyonunun Geçirilmesi ve Puanlanması

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)

Collection of F1 Generation Caenorhabditis elegans for Chromatin Immunoprecipitation (ChIP)  

Begin by plating approximately 3, 500 C.elgans F1 generation embryos on 14 plates and allow them to grow to the young adult stage for three days at 21 degrees Celsius. Wash and collect the C.elgans into 1.5-milliliter tubes using PBS/TX. Centrifuge at 1000 G for two minutes, aspirate, and pull the worms from one strain into one tube.Repeat three washes with PBS/TX. Next, aspirate the supernatant leaving one milliliter in the tube and invert to mix. After counting the number of C.elgans worms in three microliters three times, calculate the concentration of worms and transfer a volume corresponding to 3000 worms to a new tube for formaldehyde cross-linking.

Kromatin İmmünopresipitasyon (ChIP) için F1 Generation Caenorhabditis elegans Koleksiyonu

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP

Formaldehyde Crosslinking of the F1 Generation of Caenorhabditis elegans for ChIP  

Begin by adding formaldehyde to a 1.8%final concentration to the tube containing the worms and rotating the tube at room temperature for six minutes. Then immediately freeze the tubes in liquid nitrogen, and store the samples at 80 degrees Celsius. To proceed thaw the formaldehyde cross-link sample in a room temperature water bath for three minutes, and rotate the samples for 16 minutes at room temperature.At 1.25 molar glycine to a 125 millimolar final concentration, and rotate for five minutes at room temperature. Following this step, keep the samples on ice, or at four degrees, and use ice cold buffers until the magnetic bead elution. After centrifuging the sample at 1000 g for three minutes, wash it three times with one milliliter of PBSTX.Then wash it two times with one milliliter of Resuspension Buffer. After the last wash, leave enough Buffer to ensure the total volume is at least three times the pellet volume and a minimum of 100 microliters.

ChIP için F1 Nesil Caenorhabditis elegans'ın formaldehit çapraz bağlanması

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation

Sonication of Formaldehyde-Crosslinked Caenorhabditis elegans and Chromatin Immunoprecipitation  

Begin by mixing and aliquoting 90 to 120 microliters of the formaldehyde crosslinked C.Elegans samples into a polystyrene sonication tube. Add an equal volume of resuspension buffer containing 2X detergents. Sonicate in a water bath sonicator for seven minutes.Gently mix the sample by pipetting and repeat the sonication for an additional seven minutes. Once done, transfer the sonicated lysate to a 1.5 milliliter tube. Add a half volume of resuspension buffer without detergents.After centrifugation at 13, 000 G for 15 minutes at four degrees Celsius, divide the lysate supernatant into four parts. Store the input lysate part at minus 20 degrees Celsius in a 1.5 milliliter tube. Add 0.5 micrograms of anti-H3K9 trimethylation, anti-histone H3 or IgG to the appropriate immunoprecipitation or IP sample.Incubate the reaction at four degrees Celsius overnight with rotation. The following day, aliquot the nine microliters of protein G coated magnetic beads per IP sample in a 1.5 milliliter tube. After two washes with one milliliter of FA-150, resuspend the magnetic beads in the FA-150 buffer.Once done, add 7.5 microliters of the magnetic bead suspension to each IP antibody mix before incubating the tubes at four degrees Celsius for two hours with rotation. Next, wash the magnetic beads seven times using at least 200 microliters of each buffer solution. Incubate each wash at four degrees Celsius for five minutes with rotation before collecting the beads on a magnetic stand to aspirate the wash.After aspirating the last wash of the buffer, resuspend the magnetic beads in 50 microliters of chromatin IP elution buffer, and transfer it to a 1.5 milliliter tube. After eluting the sample in a ThermoMixer, collect the beads on a magnetic stand and transfer the supernatant to a new tube. Repeat the elution with another 50 microliters of chromatin immunoprecipitation elution buffer.Once done, pull a total of 100 microliters of supernatant before proceeding with reverse cross-linking and DNA elution.