Les auteurs sont financés par le Corus, entrée dans la cellule medsys, CHAIN ​​et les projets de Resina.

Le protocole est résumé dans la figure. 4. 1. Prélèvement d&#39;échantillons sanguins <ol><li> Recueillez au moins 3 ml de sang dans des tubes EDTA sur le site clinique. </li><li> Les échantillons peuvent être conservés jusqu&#39;à une semaine à 4 ° C. </li><li> Envoyer les échantillons de sang EDTA dès que possible au laboratoire par courrier ordinaire. </li></ol> 2. L&#39;isolement de l&#39;ARN du VIH et / ou l&#39;ADN <ol><li> Obtenir l&#39;ARN viral et / ou de l&#39;ADN à partir de sang total 1000 pi, du sérum ou du plasma, en utilisant la MagNA Pure isolation compacte kit Nucleic Acid I I et le système MagNA pur compact. </li><li> Éluer l&#39;ARN ou l&#39;ADN obtenu dans 50 pl de tampon TE. En variante, d&#39;autres acides nucléiques procédures de purification peuvent être utilisées. </li></ol> 3. L&#39;amplification de la région env Amplifier la région env (Figs. 2 et 4) à partir de plasma supporte ARN ou d&#39;ADN proviral. A 1245 pb au long du produit, comprenant la majorité de la protéine Env (nt 6556-7811 according à HXB2) est généré. <ol><li> Échantillons d&#39;ARN par RT-PCR: réaction <ol><li> L&#39;ARN viral présente une structure très complexe secondaire (Fig. 4) qui peuvent entraver la réaction de RT. Pour éviter ce problème, incuber 10 ul d&#39;ARN à 65 ° C pendant 10 minutes (déjà dans le tube de PCR et dans la machine PCR), puis réduire la température à 50 ° C. </li><li> Ajouter 40 ul de la PCR Master Mix, y compris les amorces Env-F et-R Env. Master Mix pour la RT-PCR In-House-système: <table border="1"><tbody><tr><td></td><td> volume / réaction (pl) </td><td> concentration finale </td></tr><tr><td> RNase H 2 O </td><td> 14,4 </td><td></td></tr><tr><td> Tampon 5x (Qiagen OneStep RT-PCR Kit) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM chacun) </td> &lt;td&gt; 2 </td><td> 400 pM de chaque dNTP </td></tr><tr><td> Enzym-Mix (Qiagen OneStep RT-PCR Kit) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-R (100 M) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> RNase Inhibitor (RNasin) </td><td> 1 </td><td> 5 unités / réaction </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586 selon HXB2) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Exécuter la réaction de RT à 50 ° C pendant 30 minutes. </li><li> Exécuter la première PCR comme suit: <table border="1"><tbody><tr><td> 95 ° C, 15 min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 50 ° C, 30 sec 72 ° C, 2 min </td&gt; <td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 56 ° C, 30 sec 72 ° C, 2 min </td><td> 38 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol></li><li> Échantillons d&#39;ADN: réaction PCR Pour les échantillons d&#39;ADN proviral, aucune réaction initiale RT est nécessaire, et la réaction de PCR peut démarrer directement. <ol><li> Ajouter 40 pl de PCR Master Mix à 10 pl de l&#39;ADN PROVIAL. Master Mix PCR pour In-House-système: <table border="1"><tbody><tr><td></td><td> volume / réaction (pl) </td><td> concentration finale </td></tr><tr><td> RNase H 2 O </td><td> 15,4 </td><td></td></tr><tr><td> Tampon 5x (ADN polymérase HotStarTaq) </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 10 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM chacun) </td><td> 2 </td><td> 400 pM de chaque dNTP </td></tr><tr><td> Enzym-Mix (ADN polymérase HotStarTaq) </td><td> 2 </td><td></td></tr><tr><td> Primer Env-F (100 uM) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-R (100 M) </td><td> 0,3 </td><td> 0,6 uM </td></tr></tbody></table> Env-F: 5&#39;-CAAAGCCTAAAGCCATGTGTAAA -3 &#39;(nt 6556 → 6586) Env-R: 5&#39;-AGTGCTTCCTGCTGCTCCTAAGAACCC -3 &#39;(nt 7785 ← 7811) </li><li> Exécutez les conditions de PCR comme décrit précédemment pour les échantillons d&#39;ARN (étape 3.1.4). </li></ol></li></ol> 4. L&#39;amplification de la région V3: PCR nichée <ol><li> Pour la PCR nichée, utilisez 5 pl de la première réaction de PCR (sans analyse précédente en gel d&#39;agarose) comme matrice et ajouter 95 ul de Mas PCRMélanger ter. Master Mix pour Nested-PCR In-House <table border="1"><tbody><tr><td></td><td> volume / réaction (pl) </td><td> concentration finale </td></tr><tr><td> H 2 O </td><td> 61,9 </td><td></td></tr><tr><td> Tampon PCR 10x </td><td> 10 </td><td> 1x </td></tr><tr><td> 5x Q-Solution </td><td> 20 </td><td> 1x </td></tr><tr><td> dNTP Mix (10 mM chacun) </td><td> 2 </td><td> 200 uM de chaque dNTP </td></tr><tr><td> Primer Env-2F (100 M) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> Primer Env-2R (100 M) </td><td> 0,3 </td><td> 0,6 uM </td></tr><tr><td> ADN polymérase HotStarTaq </td><td> 0,5 </td><td> 2,5 unités / réaction </td></tr></tbody></table> Env-2F: 5&#39;-GTCCAAAGGTATCCTTTGAGCCAATTC -3 &#39;(nt 6838 → 6864) <strong&gt; Env-2R: 5&#39;-CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3 &#39;(nt 7712 ← 7742) </li><li> Exécutez la PCR comme suit: <table border="0"><tbody><tr><td> 93 ° C, 15 min </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 50 ° C, 30 sec 72 ° C, 90 sec </td><td> 1 x </td></tr><tr><td> 95 ° C, 30 sec 56 ° C, 30 sec 72 ° C, 90 sec </td><td> 43 x </td></tr><tr><td> 72 ° C, 10 min 4 ° C ∞ </td><td></td></tr></tbody></table></li><li> Analyser le produit de PCR sur un gel d&#39;agarose 1% (Figure 4). Le produit attendu est 902 pb de long. </li><li> Purification des échantillons de séquençage. <ol><li> Purifier le produit PCR avec le kit Qiagen PCR Purification Kit, en utilisant le protocole, des solutions et des micro-colonnes fournies par le fournisseur. Éluer dans 30-100 pi de tampon PE, en fonction de l&#39;intensité des bandes. </li><li> Alternativement, les échantillons peuvent être purifiés en utilisant l&#39;exonucléaseI et rapide AP (Thermo phosphatase alcaline). À cette fin, ajouter 6 pi Exo-AP Mix à 15 ul produit de PCR et incuber 15 minutes à 37 ° C. <table border="1"><tbody><tr><td> 580 ul H 2 O </td></tr><tr><td> 66 ul rapide AP </td></tr><tr><td> 13,4 ul Exo I </td></tr></tbody></table></li></ol></li></ol> 5. Réaction de séquence de l&#39;amplicon V3 <ol><li> La réaction consiste en une séquence de réaction de PCR en utilisant seulement l&#39;une des amorces suivantes: Env-2: 5&#39;-GTACAATGYACACATGGAATTAGGC -3 (nt 6959 → 6980) Env-5: 5&#39;-AAAATTCCCCTCCACAATTA - 3 &#39;(nt 7352 ← 7371) Env-6: 5&#39;-GGCCAGTAGTATCAACTCAAC - 3 &#39;(nt 6979 → 7000) Env-7: 5&#39;-TGTCCACTGATGGGAGGGGC - 3 &#39;(nt 7530 ← 7549) Env-10: 5 &#39;- GCAGAATAAAACAAATTATAAACATGTGGC - 3&#39; (nt 7478 ← 7507) Env-11: 5 &#39;- TACATTGCTTTTCCTACTTTCTGCCAC - 3&#39; (nt 7638 ← 7664) Amorces de premier choix sont les suivants: Env-2, Env-6 ou Env-7, Env-11 </li><li> Utilisez 1 pl de l&#39;amplicon V3 purifié comme modèle et ajouter 9 pl de PCR master mix. Séquençage Mix Master: <table border="1"><tbody><tr><td> 4 mix séquence ul (VIH génotypage Kit) </td></tr><tr><td> 4 pl H 2 O </td></tr><tr><td> 1 Primer ul (100 pmol / pl) </td></tr></tbody></table></li><li> Exécuter la séquence réactionnelle suivante: <table border="0"><tbody><tr><td> 96 ° C, 10 sec </td><td></td></tr><tr><td> 50 ° C, 10 sec </td><td> 36 x </td></tr><tr><td> 60 ° C, 45 sec </td><td></td></tr><tr><td> 4 ° C ∞ </td><td></td></tr></tbody></table></li></ol> 6. Purification des échantillons de séquençage Purifier les séquences using Sephadex G-50 superfine. <ol><li> Remplissez le nombre approprié de puits dans le &quot;chargeur colonne&quot; de Sephadex G-50 superfine. Transférer le Sephadex pour la MAHVN4510 plaque filtrante en retournant. </li><li> Ajouter 300 ul Milli-Q H 2 O dans chaque puits de la plaque de filtration et incuber pendant au moins 3 heures à 2-8 ° C. </li><li> Centrifuger les plaques pendant 5 min à 910Xg et 4-15 ° C. Jeter l&#39;effluent à travers. </li><li> Ajouter 10 ul de H 2 O à la séquence du produit et ensuite la séquence pipette sur la plaque de Sephadex gonflé. </li><li> Pour obtenir le produit purifié, centrifuger la plaque pendant 5 min. à 910Xg et 4-15 ° C et récupérer le flux continu. </li></ol> 7. Le séquençage des échantillons purifiés sur le séquenceur ABI Prism XL 3130 <ol><li> Avant chaque course, changer le tampon et vérifier le volume du polymère (POP7). Si nécessaire, remplacez le flacon polymère ancienne par une nouvelle. </li><li> Utiliser les conditions d&#39;exécution sauvegardées, y compris un temps d&#39;injection de 18 secondes. </li><li> Dans cette machine, la collecte des données de signal d&#39;une course de 16 échantillons de séquence dure environ 60 min (36 cm capillaire) ou 150 min (50 cm capillaire). </li></ol> 8. Édition de séquence <ol><li> Utilisez le programme (ADN-Star) Lasergene d&#39;aligner et d&#39;éditer les séquences (fig. 5). D&#39;autres programmes d&#39;édition de séquence peut être utilisé. Utilisez un &quot;consensus V3-B&quot; et la séquence consensus env en tant que références. </li><li> Lasergene crée une séquence consensus de l&#39;échantillon analysé à l&#39;aide de toutes les données brutes disponibles et les stocker en tant que fichier FASTA. Le fichier FASTA est un fichier texte qui comprend un en-tête avec le nom de l&#39;échantillon et la séquence de nucléotides. </li></ol> 9. Séquençage l&#39;interprétation des données et de prévision tropisme <ol><li> Séquençage d&#39;interprétation des données est effectuée par le système d&#39;interprétation basé sur le Web geno2pheno [corécepteur] ( <a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/</a>index.php). Pour la prévision tropisme, les paramètres du FPR différents peuvent être sélectionnés. Le réglage par défaut est selon les recommandations thérapeutiques germano-autrichienne. Pour FPR ≥ 20%, le virus est classé comme lorsque R5 FPR ≥ 20% et X4 FPR &lt;12,5%. </li><li> Téléchargez le fichier FASTA dans le serveur. Ce serveur convertit la séquence de nucléotides en acides aminés, il s&#39;aligne avec la séquence B-V3 consensus et produit une classification sous-type. En outre, il génère une prédiction de l&#39;utilisation du corécepteur (Fig. 4) exprimée en taux de faux positifs (FPR). </li></ol> 10. Les résultats représentatifs Le geno2pheno [corécepteur] sortie montre une interprétation progressive du tropisme. En fonction de la probabilité de l&#39;utilisation du corécepteur, le texte d&#39;interprétation et couleur de fond varie du vert (FPR &lt;20%), ce qui suggère une administration sécuritaire pour MVC, au jaune, suggérant un possible risque faible et enfin au rouge. Le rouge est la couleur suggèretion de ne pas prescrire MVC. En outre, le serveur génère un rapport pdf qui peut être imprimé, rempli avec le patient et les données de l&#39;échantillon, et envoyé au médecin. Des exemples de geno2pheno sortie [corécepteur] sont représentés sur la Fig. 6. <img alt="Figure 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> Comprenne qui pourra. 1. Schéma de la réplication du VIH. Virion doit se lier aux récepteurs CD4 cellulaire que et soit le CCR5 ou CXCR4 comme corécepteur. Le corécepteur CCR5 peut être bloqué par des antagonistes du CCR5 maraviroc (MVC comme, Celsentri, Selzentry). Après la fusion des membranes virales et cellulaires, la nucléocapside virale est libérée dans le cytoplasme. La nucléocapside se démonte et le complexe ARN viral est libéré dans le cytoplasme. La transcriptase inverse virale (RT) transcrit l&#39;ARN génomique en ADN proviral, qui est ensuite transporté vers le noyau et intégré dans le génome de l&#39;hôte par l&#39;intégrase du VIH. Polymérases ARN cellulaire transcribe génomique virale et ARN messagers du génome proviral. Les protéines virales sont produites dans le cytoplasme et transportées à la surface de la cellule. Le bourgeon particules virales immatures, comme non infectieux des virions à partir des cellules. La protéase du VIH clive les protéines produisent des particules infectieuses. L&#39;inhibition de l&#39;une des étapes conduit à une interruption du cycle de réplication. Les médicaments antirétroviraux et l&#39;étape de réplication qui ils inhibent sont marqués en rouge. L&#39;ARN viral et l&#39;ADN proviral (matériau utilisé pour l&#39;analyse tropisme ou résistance) sont marquées en vert. <img alt="Figure 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> Figure 2. Génome proviral du VIH. La particule de VIH est construit avec différentes protéines structurales et des maisons de diverses enzymes et de protéines à la fois d&#39;origine virale et cellulaire. La figure montrents la localisation des gènes dans le génome viral. La surface protéines gp120 et gp41 constituent des pointes sur la surface du virion et communiquer avec la cellule humaine pour réaliser la fusion membranaire. Dans la partie inférieure de la figure, les produits d&#39;amplification PCR et les amorces utilisées dans notre protocole sont affichés. <img alt="Figure 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> Figure 3. Proportion de patients ayant une charge virale faible (VL) des mesures analysées pour la résistance aux médicaments ou la détermination de tropisme à l&#39;Institut de Virologie, Université de Cologne (Allemagne). <img alt="Figure 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> Figure 4. Diagramme d&#39;ensemble de l&#39;expérience .. S&#39;il vous plaît <a href="http://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">cliquez ici</a> pour voir une version plus grande de cette figure. <img alt="Figure 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> Figure 5. Séquence d&#39;édition avec Lasergene. L&#39;amplicon V3 est séquencée avec au moins une amorce avant et une marche arrière. Lasergene alignes les «ABI». Fichiers obtenus à partir du séquenceur avec des séquences de référence du «Consensus V3-B&quot; et env. Lasergene crée une séquence consensus à l&#39;aide de toutes les données de rangées disponibles. Les séquences de référence peut être marqué (et sont ensuite affichés en gris) de sorte qu&#39;elles ne contribuent pas à la séquence consensus de l&#39;échantillon. <img alt="Figure 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> Figure 6. Rapports de prévision tropisme générés par le geno2pheno [corécepteur] tool.The rapports sont générés sous forme de fichiers pdf qui peuvent être enregistrés et complétés dans l&#39;ordinateur. Des données supplémentaires telles noms patient nous, la date de prélèvement de sang, etc, peuvent être inclus manuellement à l&#39;aide d&#39;un programme pdf writer. Observations spécifiques peuvent également être ajoutés. The Les données sont exclusivement sur ​​l&#39;ordinateur de l&#39;utilisateur et non sur le serveur geno2pheno [corécepteur]. S&#39;il vous plaît <a href="http://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">cliquez ici</a> pour voir une version plus grande de cette figure.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

Cet article vidéo est sponsorisé par ViiV Soins de santé et GlaxoSmithKline.

La séquence V3 permet une prédiction fiable tropisme viral, comme indiqué dans les études cliniques 3-9. En fait, la détermination génotypique est envisagé dans les directives européennes et germano-autrichienne 10. Comparativement à l&#39;essai phénotypique, non seulement le temps de rotation plus courte (équivalent à des tests de résistance), mais aussi les coûts. En outre, un avantage majeur du test génotypique est que les résultats sont classés en tant FPR et ne peut donc être adapté aux besoins des patients. Résultats Trofile, d&#39;autre part, sont tout simplement des rapports R5 ou X4, et l&#39;accès aux données brutes n&#39;est pas donné. À l&#39;heure actuelle, les directives européennes suggèrent un FPR cut-off de 20 à 10%, tandis que les lignes directrices austro-allemandes permettent d&#39;adapter le FPR coupure spécifiquement aux besoins de chaque patient 11. Dans cette ligne, pour les patients avec un large éventail d&#39;options de médicaments antirétroviraux, plus FPR seuils (&gt; 20%) sont recommterminé. En revanche, pour lourdement prétraités patients atteints de peu d&#39;options thérapeutiques, le bas du FPR seuils (&gt; 5%) peuvent être utilisés. Ce type d&#39;orientation thérapeutique est actuellement en cours par la résistance à tester INTI, INNTI, les IP, et l&#39;INIS, où les médicaments partiellement actifs peuvent être inclus dans le traitement des patients atteints réduction des options thérapeutiques. En outre, avec un nombre croissant de changements de thérapie génotypiquement-guidés, la clinique pertinente FPR seuils sont continuellement ajustés par un panel de bioinformaticiens, des virologistes et des cliniciens. Un autre avantage important des tests génotypiques de tropisme est la possibilité d&#39;analyser des échantillons cliniques avec une charge virale très faible, voire indétectable (VL). Dans ce cas, lorsque l&#39;ARN plasmatique n&#39;est pas amplifiable, l&#39;ADN proviral peut être séquencés et utilisés pour des prévisions fiables 9,12. Fait à noter, le nombre de patients ayant une charge virale basse ou indétectable a fortement augmenté au cours des dernières années. À ce jour, le Trofil de test ne permet que l&#39;analyse des échantillons provenant de patients atteints de LV &lt;1000 copies / ml. Cependant, des études préliminaires ont montré que l&#39;ADN proviral peut être aussi adecuate d&#39;être testé par Trofile 13.

<table border="1"><tbody><tr><td> Nom du réactif </td><td> Entreprise </td><td> Numéro de catalogue </td><td> Commentaires </td></tr><tr><td> MagNA Pure Compact Kit Nucleic Acid Isolation I </td><td> Roche Diagnostics </td><td> 04 802 993 001 </td><td></td></tr><tr><td> MagNA Pure System Compact </td><td> Roche Diagnostics </td><td> 03731146001 </td><td></td></tr><tr><td> T3000 Thermocycleur </td><td> Biometra </td><td> 050-723 </td><td></td></tr><tr><td> One Step RT-PCR Kit </td><td> Qiagen </td><td> 210215 </td><td></td></tr><tr><td> HotStarTaq Mix Master Kit </td><td> Qiagen </td><td> 203445 </td><td></td></tr><tr><td> QIAquick PCR Purification Kit </td><td> Qiagen </td><td> 28106 </td><td></td></tr><tr><td> Exonucléase I (Exo I) </td><td> Fermentas </td><td> EN0582 </td><td></td></tr><tr><td> Fastap thermosensible phosphatase alcaline </td><td> Fermentas </td><td> EF0651 </td> &lt;td&gt; </td></tr><tr><td> BigDye Terminator Cycle Sequencing Kit v3.1 </td><td> Applied Biosystems </td><td> 4337457 </td><td></td></tr><tr><td> Sephadex G-50 Superfine </td><td> GE Healthcare </td><td> 17-0041-01 </td><td></td></tr><tr><td> ABI Prism 3130 XL séquenceur capillaire </td><td> Applied Biosystems </td><td> 3130XL </td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Le maraviroc (MVC) est le premier médicament homologué antirétroviral de la classe des antagonistes des corécepteurs. Il se lie à l&#39;hôte corécepteur CCR5, qui est utilisé par la majorité des souches de VIH pour infecter les cellules humaines immunitaires (Fig. 1). D&#39;autres isolats de HIV utiliser un corécepteur différente, le CXCR4. Lequel récepteur est utilisé, est déterminée dans le virus de la protéine Env (Fig. 2). Selon le corécepteur utilisé, les virus sont classés comme R5 ou X4, respectivement. MVC se lie au récepteur CCR5 inhiber l&#39;entrée du virus R5 dans la cellule cible. Au cours de l&#39;évolution de la maladie, les virus X4 peuvent émerger et dépasser les virus R5. Détermination de l&#39;usage du corécepteur (aussi appelée tropisme) est donc obligatoire avant l&#39;administration de MVC, comme exigé par l&#39;EMA et de la FDA. Les études d&#39;efficacité MVC MOTIVER, MERIT et 1029 ont été réalisées avec le test Trofile de monogramme, San Francisco, USA Ceci est un essai de haute qualité basé sur sophisticated essais recombinés. L&#39;acceptation de ce test de routine quotidienne est plutôt faible en dehors des Etats-Unis, puisque les médecins européens ont plutôt tendance à travailler avec des laboratoires experts décentralisés, qui fournissent également des tests de résistance concomitante. Ces laboratoires ont fait l&#39;objet de plusieurs évaluations d&#39;assurance de la qualité, la dernière a été présentée en 2011 1. Depuis plusieurs années, nous avons effectué des déterminations tropisme basée sur l&#39;analyse de la séquence env du VIH-V3 région du gène (V3) 2. Cette région comporte suffisamment d&#39;informations pour effectuer une prédiction fiable. La détermination du génotype de l&#39;utilisation de corécepteur présente des avantages tels que: réduction du temps de chiffre d&#39;affaires (équivalent à des tests de résistance), une réduction des coûts, la possibilité d&#39;adapter les résultats aux besoins des patients et la possibilité d&#39;analyser des échantillons cliniques avec une charge virale très faible, voire indétectable (VL ), d&#39;autant plus que le nombre d&#39;échantillons analysés avec CV &lt;1000 copies / ulenviron augmenté au cours des dernières années (figure 3). Les principales étapes de test de tropisme (Fig. 4) montre cette vidéo: 1. Prélèvement d&#39;un échantillon de sang 2. L&#39;isolement de l&#39;ARN du VIH dans le plasma et / ou l&#39;ADN proviral du VIH de cellules mononucléées sanguines 3. L&#39;amplification de la région env 4. L&#39;amplification de la région V3 5. Réaction de séquence de l&#39;amplicon V3 6. Purification des échantillons de séquençage 7. Le séquençage des échantillons purifiés 8. Édition de séquence 9. Séquençage l&#39;interprétation des données et de prévision tropisme

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

La prédiction de l&#39;utilisation du corécepteur du VIH-1 est nécessaire pour l&#39;administration d&#39;une nouvelle classe de médicaments anti-rétroviraux, les antagonistes du corécepteur soit. Elle peut être effectuée par analyse de la séquence de l&#39;<em&gt; Env</em&gt; Gène et l&#39;interprétation ultérieure par un système d&#39;interprétation basé sur Internet (geno2pheno<sub&gt; [Corécepteur]</sub&gt;).

Prédiction du VIH-1 Utilisation corécepteur (tropisme) par analyse de séquence en utilisant une approche génotypique

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Research

JoVE Journal

Immunology and Infection

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

13.1K vues.  University of Cologne.  Español 

Vidéo: Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

Évaluation des immunologiquement pertinents dynamiques tertiaires Caractéristiques structurelles de l&#39;épidémie de VIH-1 séquence de la boucle V3 de la Couronne par R2<em&gt; Ab initio</em&gt; Pliante

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

Recherche

Immunologie et infection

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Marquage spécifique du VIH-1 des cellules positives à l&#39;aide d&#39;un vecteur Rev-dépendante lentiviraux exprimant la protéine fluorescente verte

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Inférence génotypique de tropisme du VIH-1 en utilisant la population basée séquençage du V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein complexes and assemblies. In fact, single particle electron microscopy1 and two-dimensional (2D) electron crystallography2 have become relatively routine methodologies and a large number of structures have been solved using these methods. At the same time, image processing and three-dimensional (3D) reconstruction of helical objects has rapidly developed, especially, the iterative helical real-space reconstruction (IHRSR) method3, which uses single particle analysis tools in conjunction with helical symmetry. Many biological entities function in filamentous or helical forms, including actin filaments4, microtubules5, amyloid fibers6, tobacco mosaic viruses7, and bacteria flagella8, and, because a 3D density map of a helical entity can be attained from a single projection image, compared to the many images required for 3D reconstruction of a non-helical object, with the IHRSR method, structural analysis of such flexible and disordered helical assemblies is now attainable.
In this video article, we provide detailed protocols for obtaining a 3D density map of a helical protein assembly (HIV-1 capsid9 is our example), including protocols for cryo-EM specimen preparation, low dose data collection by cryo-EM, indexing of helical diffraction patterns, and image processing and 3D reconstruction using IHRSR. Compared to other techniques, cryo-EM offers optimal specimen preservation under near native conditions. Samples are embedded in a thin layer of vitreous ice, by rapid freezing, and imaged in electron microscopes at liquid nitrogen temperature, under low dose conditions to minimize the radiation damage. Sample images are obtained under near native conditions at the expense of low signal and low contrast in the recorded micrographs. Fortunately, the process of helical reconstruction has largely been automated, with the exception of indexing the helical diffraction pattern. Here, we describe an approach to index helical structure and determine helical symmetries (helical parameters) from digitized micrographs, an essential step for 3D helical reconstruction. Briefly, we obtain an initial 3D density map by applying the IHRSR method. This initial map is then iteratively refined by introducing constraints for the alignment parameters of each segment, thus controlling their degrees of freedom. Further improvement is achieved by correcting for the contrast transfer function (CTF) of the electron microscope (amplitude and phase correction) and by optimizing the helical symmetry of the assembly.

This article describes a method to obtain a three-dimensional (3D) structure of helically assembled molecules using cryo-electron microscopy. In this protocol, we use HIV-1 capsid assemblies to illustrate the detailed 3D reconstruction procedure for achieving a density map by the iterative helical real-space reconstruction method.

Structure du VIH-1 Assemblées capside par cryo-microscopie électronique et reconstruction itérative hélicoïdal espace réel

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

En décapsidation in vitro du VIH-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

L&#39;évaluation de l&#39;Innate détection du VIH-1 CD4 infectés<sup&gt; +</sup&gt; Cellules T par les cellules dendritiques plasmacytoïdes Utilisation d&#39;un<em&gt; Ex vivo</em&gt; Système de co-culture.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

Évaluation de conformation du VIH-1 trimère glycoprotéines d&#39;enveloppe l&#39;aide d&#39;un base de cellules test ELISA

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Isolement des exosomes dans le plasma du VIH-1 individus positifs

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

Mesure de<em&gt; In vitro</em&gt; Activité d&#39;intégration du VIH-1 préintégration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.