Name: prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach
Uploaded: 2011-12-01T13:00:00
Duration: 7 min 6 s
Description: Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

The authors are funded from the Corus, MedSys Cell Entry, CHAIN and Resina projects.

The protocol is summarized in Fig. 4.
1. Collection of blood samples
<ol>
 <li>Collect at least 3 ml blood in EDTA tubes at the clinical site.</li>
 <li>The samples can be stored up to a week at 4&deg;C.</li>
 <li>Send the EDTA-blood samples as soon as possible to the laboratory by ordinary mail.</li>
</ol>
2. Isolation of HIV RNA and/or DNA
<ol>
 <li>Obtain viral RNA and/or DNA from 1000 &mu;l whole blood, serum or plasma, using the MagNA Pure Compact Nucleic Acid Isolation I kit I and the MagNA Pure Compact System.</li>
 <li>Elute the gained RNA or DNA in 50 &mu;l TE buffer. Alternatively, other nucleic acids purification procedures may be used.</li>
</ol>
3. Amplification of the env region
Amplify the env region (Figs. 2 and 4) from either plasma RNA or proviral DNA. A 1245 bp-long product, comprising the majority of the Env protein (nt 6556-7811 according to HXB2) is generated.
<ol>
 <li>RNA samples: RT-PCR reaction
 <ol>
 <li>Viral RNA presents a very complex secondary structure (Fig. 4) that may hinder the RT reaction. To avoid this problem, incubate 10 &mu;l RNA at 65&deg;C for 10 minutes (already in the PCR tube and in the PCR machine) and then reduce the temperature to 50&deg;C.</li>
 <li>Add 40 &mu;l of the PCR Master Mix including the primers Env-F and Env-R.
 Master Mix for RT-PCR In-House-System: 
 <table border="1">
 <tbody>
 <tr>
 <td>&nbsp;</td>
 <td>volume/reaction (&mu;l)</td>
 <td>final concentration</td>
 </tr>
 <tr>
 <td>RNase-free H2O</td>
 <td>14.4</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>5x Buffer (Qiagen OneStep RT-PCR Kit)</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>5x Q-Solution</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>dNTP Mix (10 mM each)</td>
 <td>2</td>
 <td>400 &mu;M of each dNTP</td>
 </tr>
 <tr>
 <td>Enzym-Mix (Qiagen OneStep RT-PCR Kit)</td>
 <td>2</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>Primer Env-F (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>Primer Env-R (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>RNase Inhibitor (RNasin)</td>
 <td>1</td>
 <td>5 units/reaction</td>
 </tr>
 </tbody>
 </table>
 Env-F: 5'- CAAAGCCTAAAGCCATGTGTAAA -3' (nt 6556&rarr;6586 according to HXB2)
 Env-R: 5'- AGTGCTTCCTGCTGCTCCTAAGAACCC -3' (nt 7785&larr;7811)</li>
 <li>Run the RT reaction at 50&deg;C for 30 minutes.</li>
 <li>Run the first PCR as follows:
 
 <table border="1">
 <tbody>
 <tr>
 <td>95&deg;C, 15min</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 50&deg;C, 30 sec 
 72&deg;C, 2 min</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 56&deg;C, 30 sec 
 72&deg;C, 2 min</td>
 <td>38 x</td>
 </tr>
 <tr>
 <td>72&deg;C, 10 min 
 4&deg;C &infin;</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
 </table>
 </li>
 </ol>
 </li>
 <li>DNA samples: PCR reaction
 For proviral DNA samples, no initial RT reaction is needed, and the PCR reaction can directly start.
 <ol>
 <li>Add 40 &mu;l of PCR Master Mix to 10 &mu;l of provial DNA. 
 Master Mix for PCR In-House-System: 
 <table border="1">
 <tbody>
 <tr>
 <td>&nbsp;</td>
 <td>volume/reaction (&mu;l)</td>
 <td>final concentration</td>
 </tr>
 <tr>
 <td>RNase-free H2O</td>
 <td>15.4</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>5x Buffer (HotStarTaq DNA Polymerase)</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>5x Q-Solution</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>dNTP Mix (10 mM each)</td>
 <td>2</td>
 <td>400 &mu;M of each dNTP</td>
 </tr>
 <tr>
 <td>Enzym-Mix (HotStarTaq DNA Polymerase)</td>
 <td>2</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>Primer Env-F (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>Primer Env-R (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 </tbody>
 </table>
 Env-F: 5'- CAAAGCCTAAAGCCATGTGTAAA -3' (nt 6556&rarr;6586)
 Env-R: 5'- AGTGCTTCCTGCTGCTCCTAAGAACCC -3' (nt 7785&larr;7811)</li>
 <li>Run the PCR conditions as previously described for RNA samples (Step 3.1.4).</li>
 </ol>
 </li>
</ol>
4. Amplification of the V3 region: nested PCR
<ol>
 <li>For the nested PCR, use 5 &mu;l from the first PCR reaction (without previous analysis in agarose gel) as template and add 95 &mu;l of PCR Master Mix.
 Master Mix for Nested-In-House PCR
 <table border="1">
 <tbody>
 <tr>
 <td>&nbsp;</td>
 <td>volume/reaction (&mu;l)</td>
 <td>final concentration</td>
 </tr>
 <tr>
 <td>H2O</td>
 <td>61.9</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>10x PCR Buffer</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>5x Q-Solution</td>
 <td>20</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>dNTP Mix (10 mM each)</td>
 <td>2</td>
 <td>200 &mu;M of each dNTP</td>
 </tr>
 <tr>
 <td>Primer Env-2F (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>Primer Env-2R (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>HotStarTaq DNA Polymerase</td>
 <td>0.5</td>
 <td>2,5 units/reaction</td>
 </tr>
 </tbody>
 </table>
 Env-2F: 5'- GTCCAAAGGTATCCTTTGAGCCAATTC -3' (nt 6838&rarr;6864)
 Env-2R: 5'- CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3' (nt 7712&larr;7742)</li>
 <li>Run the PCR as follows:
 <table border="0">
 <tbody>
 <tr>
 <td> 
 93&deg;C, 15min</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 50&deg;C, 30 sec 
 72&deg;C, 90 sec</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 56&deg;C, 30 sec 
 72&deg;C, 90 sec</td>
 <td>43 x</td>
 </tr>
 <tr>
 <td>72&deg;C, 10 min 
 4&deg;C &infin;</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
 </table>
 </li>
 <li>Analyze the PCR product on a 1% agarose gel (Fig. 4). The expected product is 902 bp-long.</li>
 <li>Purification of the sequencing samples.
 <ol>
 <li>Purify the PCR product with the Qiagen PCR-Purification kit, using the protocol, solutions and micro-columns provided by the supplier. Elute in 30-100 &mu;l PE buffer, depending on band intensity.</li>
 <li>Alternatively, the samples can be purified using Exonuclease I and Fast AP (Thermo alkaline phosphatase). For this purpose, add 6 &mu;l Exo-AP Mix to 15 &mu;l PCR product and incubate 15 minutes at 37&deg;C.
 <table border="1">
 <tbody>
 <tr>
 <td>580 &mu;l H2O</td>
 </tr>
 <tr>
 <td>66 &mu;l fast AP</td>
 </tr>
 <tr>
 <td>13.4 &mu;l Exo I</td>
 </tr>
 </tbody>
 </table>
 </li>
 </ol>
 </li>
</ol>
5. Sequence reaction of the V3 amplicon
<ol>
 <li>The sequence reaction consists of a PCR reaction using only one of the following primers:
 Env-2: 5'- GTACAATGYACACATGGAATTAGGC -3 (nt 6959&rarr;6980) 
 Env-5: 5'- AAAATTCCCCTCCACAATTA - 3' (nt 7352&larr;7371) 
 Env-6: 5'- GGCCAGTAGTATCAACTCAAC - 3' (nt 6979&rarr;7000) 
 Env-7: 5'- TGTCCACTGATGGGAGGGGC - 3' (nt 7530&larr;7549) 
 Env-10: 5' - GCAGAATAAAACAAATTATAAACATGTGGC - 3' (nt 7478&larr;7507) 
 Env-11: 5' - TACATTGCTTTTCCTACTTTCTGCCAC - 3' (nt 7638&larr;7664) 
 First choice primers are: Env-2, Env-6 or Env-7, Env-11</li>
 <li>Use 1 &mu;l from the purified V3 amplicon as template and add 9 &mu;l of PCR master-mix.
 Sequencing Master Mix:
 <table border="1">
 <tbody>
 <tr>
 <td>4 &mu;l sequence mix (HIV-Genotyping Kit)</td>
 </tr>
 <tr>
 <td>4 &mu;l H2O</td>
 </tr>
 <tr>
 <td>1 &mu;l Primer (100 pmol/&mu;l)</td>
 </tr>
 </tbody>
 </table>
 </li>
 <li>Run the sequence reaction as follows:
 <table border="0">
 <tbody>
 <tr>
 <td>96&deg;C, 10 sec</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>50&deg;C, 10 sec</td>
 <td>36 x</td>
 </tr>
 <tr>
 <td>60&deg;C, 45 sec</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>4&deg;C &infin;</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
 </table>
 </li>
</ol>
6. Purification of the sequencing samples
Purify sequences using Sephadex G-50 superfine.
<ol>
 <li>Fill the appropriate number of wells in the "column loader" with Sephadex G-50 superfine. Transfer the Sephadex to the filter plate MAHVN4510 by turning over.</li>
 <li>Add 300 &mu;l Milli-Q H2O to each well in the filter plate, and incubate it for at least 3h at 2-8&deg;C.</li>
 <li>Centrifuge the plates for 5 min at 910Xg and 4-15&deg;C. Discard the flow-through.</li>
 <li>Add 10 &mu;l H2O to the sequence product and then pipet the sequence on the swelled Sephadex plate.</li>
 <li>To gain the purified product, centrifuge the plate for 5 min. at 910Xg and 4-15&deg;C and collect the flow-through.</li>
</ol>
7. Sequencing the purified samples on the sequencer ABI Prism 3130 XL
<ol>
 <li>Before each run, change the buffer and check the volume of the polymer (POP7). If needed, replace the old polymer flask by a new one.</li>
 <li>Use the saved run conditions, including an injection time of 18 seconds.</li>
 <li>In this machine, the collection of the signal data of one run with 16 sequence samples takes about 60 min (36 cm capillary) or 150 min (50 cm capillary).</li>
</ol>
8. Sequence editing
<ol>
 <li>Use the program Lasergene (DNA-Star) to align and edit the sequences (Fig. 5). Other sequence editing programs may be used. Use a "V3-Consensus B" and the env consensus sequence as references.</li>
 <li>Lasergene creates a consensus sequence of the analysed sample using all the raw data available and store it as FASTA file. The FASTA file is a text file that includes a header with the name of the sample and the nucleotide sequence.</li>
</ol>
9. Sequencing data interpretation and tropism prediction
<ol>
 <li>Sequencing data interpretation is performed by the web-based interpretation system geno2pheno[coreceptor] (<a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/index.php</a>). For the tropism prediction, different FPR settings can be selected. The default setting is according to the German-Austrian therapy guidelines. For FPR &ge; 20%, the virus is classified as R5 when FPR &ge; 20% and X4 for FPR &lt; 12.5%.</li>
 <li>Upload the FASTA file into the server. This server translates the nucleotide sequence into amino acids, aligns it with the V3-Consensus B sequence and produces a subtype classification. In addition, it generates a prediction of the coreceptor usage (Fig. 4) expressed as false positive rate (FPR).</li>
</ol>
10. Representative Results
The geno2pheno[coreceptor] output shows a graded interpretation of the tropism. Depending on the likelihood of the coreceptor usage, the interpretation text and background color varies from green (&lt;20% FPR), suggesting a safe administration for MVC, to yellow, suggesting a possible, low risk and finally to red. Red is the color suggesting not to prescribe MVC. In addition, the server generates a pdf report that can be printed, filled in with patient's and sample data, and sent to the physician. Examples of geno2pheno[coreceptor] output are depicted in Fig. 6.
<img alt="Figure 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> 
Figure. 1. Schematic replication of HIV. The virion must bind to the cellular CD4 as receptor and to either the CCR5 or CXCR4 as coreceptor. The coreceptor CCR5 can be blocked with CCR5 antagonists like Maraviroc (MVC, Celsentri, Selzentry). After fusion of the viral and cellular membranes, the viral nucleocapsid is released in the cytoplasm. The nucleocapsid disassembles and the viral RNA complex is liberated into the cytoplasm. The viral reverse transcriptase (RT) transcribes the genomic RNA into proviral DNA, that is then transported to the nucleus and integrated into the host genome by the HIV integrase. Cellular RNA polymerases transcribe viral genomic and messenger RNAs from the proviral genome. The viral proteins are produced in the cytoplasm and transported to the cell surface. The virus particles bud as immature, non-infectious virions from the cells. The HIV protease cleaves the proteins producing to infectious particles. Inhibition of one of the steps leads to an interruption of the replication cycle.
The antiretroviral drugs and the replication step that they inhibit are marked in red.
The viral RNA and proviral DNA (material used for tropism or resistance analysis) are marked in green.


<img alt="Figure 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> 
Figure 2. HIV proviral genome. The HIV particle is built with different structural proteins and houses various enzymes and proteins both from viral and cellular origin. The figure shows the location of the genes within the viral genome. The surface proteins gp120 and gp41 constitute spikes on the surface of the virion and contact the human cell to perform the membrane fusion. In the lower part of the figure, the PCR amplification products and the primers used in our protocol are shown.
<img alt="Figure 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> 
Figure 3. Proportion of patients with low viral load (VL) measurements analyzed for drug-resistance or tropism determination at the Institute of Virology, University of Cologne (Germany).


<img alt="Figure 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> 
Figure 4. Overall scheme of the experiment.. Please <a href="https://www.jove.com/files/ftp_upload/3264/3264fig4_lg.jpg">click here</a> to see a larger version of this figure.
<img alt="Figure 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> 
Figure 5. Sequence editing with Lasergene. The V3 amplicon is sequenced with at least one forward and one reverse primer. Lasergene alignes the ".abi" files obtained from the sequencer with the reference sequences "V3-Consensus B" and env. Lasergene creates a consensus sequence using all the row data available. The reference sequences can be marked (and are then displayed in grey) so that they do not contribute to the sample consensus sequence.
<img alt="Figure 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> 
Figure 6. Tropism prediction reports generated by the geno2pheno[coreceptor] tool.The reports are generated as pdf files that can be saved and completed in the computer. Additional data such us patient's name, date of blood extraction, etc., can be manually included using a pdf writer program. Specific comments can be also added. These data are exclusively on the user's computer and not on the geno2pheno[coreceptor] server. Please <a href="https://www.jove.com/files/ftp_upload/3264/3264fig6_lg.jpg">click here</a> to see a larger version of this figure.

<ol>
	<li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+coreceptor+proficiency+panel+test.">European coreceptor proficiency panel test.</a> , (2011).</li><li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bioinformatic+prediction+of+HIV+coreceptor+usage.">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li><li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial.">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> , (2010).</li><li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice.">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li><li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc:+the+ANRS+GenoTropism+study.">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li><li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype.">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> , (2010).</li><li>Macartney, M. J., Cameron, J., Strang, A., Garc&#237;a, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+a+genotypic+assay+for+the+prediction+of+HIV-1+coreceptor+tropism+and+guiding+the+use+of+CCR5+antagonists+in+clinical+practice.">Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice.</a> , (2010).</li><li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., F&#228;tkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment.">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> , (2010).</li><li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., K&#246;ppe, S., &#252;&#252;nsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort.">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> , (2010).</li><li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing.">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li><li>Walter, H., Eberle, J., M&#246;ller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+(DAIG+Recommendations+for+the+HIV-1+tropism+testing).">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li><li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., K&#246;ppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA:+week+24+analysis+of+the+Berlin+maraviroc+cohort.">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, 129-129 (2010).</li><li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determining+HIV-1+Co-receptor+Tropism+Using+PBMC+Proviral+DNA+Derived+from+Aviremic+Blood+Samples.">Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples.</a> , (2010).</li></ol>

This video article is sponsored by ViiV Healthcare and GlaxoSmithKline.

The V3 sequence permits a reliable viral tropism prediction, as shown in clinical studies3-9. In fact, genotypic determination is contemplated in the current European and German-Austrian guidelines10. 
Compared to phenotypic testing, not only is the turnover time shorter (equivalent to resistance testing), but also are the costs. In addition, a major advantage of genotypic testing is that the results are graded as FPR and therefore can be adapted to the patients' needs. Trofile results, on the other hand, are simply R5 or X4 reports, and access to the raw data is not given.
Currently, The European guidelines suggest a FPR cut-off of 20%10, while the Austrian-German guidelines allow adapting the FPR cut-off specifically to each patient's needs11. In this line, for patients with a broad range of antiretroviral drugs options, higher FPR cut-offs (&gt; 20%) are recommended. Conversely, for heavily pre-treated patients with limited therapeutic options, lower FPR cut-offs (&gt; 5%) may be used. This kind of therapy guidance is currently ongoing by the resistance testing to NRTIs, NNRTIs, PIs, and INIs, where partially-active drugs may be included in the treatment for patients with reduced therapeutic options. In addition, with growing numbers of genotypically-guided therapy changes, the clinically-relevant FPR cut-offs are constantly being adjusted by a panel of bioinformaticians, virologists and clinicians.
Another important advantage of the genotypic tropism testing is the possibility of analyzing clinical samples with very low or even undetectable viral load (VL). In this cases, when plasma RNA is not amplifiable, the proviral DNA can be sequenced and used for reliable predictions9,12. Of note, the number of patients with low or undetectable viral load has sharply increased in the latest years. To date, the Trofile assay only allows the analysis of samples from patients with VL&lt;1000 copies/ml. However, preliminary studies have shown that proviral DNA may be also adecuate to be tested by Trofile13.

<table border="1">
<tbody>
<tr>
<td>Name of the reagent</td>
<td>Company</td>
<td>Catalogue number</td>
<td>Comments </td>
</tr>
<tr>
<td>MagNA Pure Compact Nucleic Acid Isolation Kit I</td>
<td>Roche Diagnostics</td>
<td>04 802 993 001</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>MagNA Pure Compact System</td>
<td>Roche Diagnostics</td>
<td>03731146001</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>T3000 Thermocycler</td>
<td>Biometra</td>
<td>050-723</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>One Step RT-PCR Kit</td>
<td>Qiagen</td>
<td>210215</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>HotStarTaq Master Mix Kit</td>
<td>Qiagen</td>
<td>203445</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>QIAquick PCR Purification Kit</td>
<td>Qiagen</td>
<td>28106</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>Exonuclease I (Exo I)</td>
<td>Fermentas</td>
<td>EN0582</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>FastAP Thermosensitive Alkaline Phosphatase</td>
<td>Fermentas</td>
<td>EF0651</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>BigDye Terminator v3.1 Cycle Sequencing Kit</td>
<td>Applied Biosystems</td>
<td>4337457</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>Sephadex G-50 Superfine</td>
<td>GE Healthcare</td>
<td>17-0041-01</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>ABI Prism 3130 XL capillary sequencer</td>
<td>Applied Biosystems</td>
<td>3130XL</td>
<td>&nbsp;</td>
</tr>
</tbody>
</table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by the majority of HIV strains in order to infect the human immune cells (Fig. 1). Other HIV isolates use a different coreceptor, the CXCR4. Which receptor is used, is determined in the virus by the Env protein (Fig. 2). Depending on the coreceptor used, the viruses are classified as R5 or X4, respectively. MVC binds to the CCR5 receptor inhibiting the entry of R5 viruses into the target cell. During the course of disease, X4 viruses may emerge and outgrow the R5 viruses. Determination of coreceptor usage (also called tropism) is therefore mandatory prior to administration of MVC, as demanded by EMA and FDA. 
The studies for MVC efficiency MOTIVATE, MERIT and 1029 have been performed with the Trofile assay from Monogram, San Francisco, U.S.A. This is a high quality assay based on sophisticated recombinant tests. The acceptance for this test for daily routine is rather low outside of the U.S.A., since the European physicians rather tend to work with decentralized expert laboratories, which also provide concomitant resistance testing. These laboratories have undergone several quality assurance evaluations, the last one being presented in 20111.
For several years now, we have performed tropism determinations based on sequence analysis from the HIV env-V3 gene region (V3)2. This region carries enough information to perform a reliable prediction. 
The genotypic determination of coreceptor usage presents advantages such as: shorter turnover time (equivalent to resistance testing), lower costs, possibility to adapt the results to the patients' needs and possibility of analysing clinical samples with very low or even undetectable viral load (VL), particularly since the number of samples analysed with VL&lt;1000 copies/&mu;l roughly increased in the last years (Fig. 3).
The main steps for tropism testing (Fig. 4) demonstrated in this video: 
1. Collection of a blood sample 
 2. Isolation of the HIV RNA from the plasma and/or HIV proviral DNA from blood mononuclear cells 
 3. Amplification of the env region 
 4. Amplification of the V3 region 
 5. Sequence reaction of the V3 amplicon 
 6. Purification of the sequencing samples 
 7. Sequencing the purified samples 
 8. Sequence editing 
 9. Sequencing data interpretation and tropism prediction

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

The prediction of the coreceptor usage of HIV-1 is required for the administration of a new class of antiretroviral drugs, i.e. coreceptor antagonists. It can be performed by sequence analysis of the env gene and subsequent interpretation through an internet based interpretation system (geno2pheno[coreceptor]).

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="http://www.jove.com/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Research

JoVE Journal

Immunology and Infection

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein complexes and assemblies. In fact, single particle electron microscopy1 and two-dimensional (2D) electron crystallography2 have become relatively routine methodologies and a large number of structures have been solved using these methods. At the same time, image processing and three-dimensional (3D) reconstruction of helical objects has rapidly developed, especially, the iterative helical real-space reconstruction (IHRSR) method3, which uses single particle analysis tools in conjunction with helical symmetry. Many biological entities function in filamentous or helical forms, including actin filaments4, microtubules5, amyloid fibers6, tobacco mosaic viruses7, and bacteria flagella8, and, because a 3D density map of a helical entity can be attained from a single projection image, compared to the many images required for 3D reconstruction of a non-helical object, with the IHRSR method, structural analysis of such flexible and disordered helical assemblies is now attainable.
In this video article, we provide detailed protocols for obtaining a 3D density map of a helical protein assembly (HIV-1 capsid9 is our example), including protocols for cryo-EM specimen preparation, low dose data collection by cryo-EM, indexing of helical diffraction patterns, and image processing and 3D reconstruction using IHRSR. Compared to other techniques, cryo-EM offers optimal specimen preservation under near native conditions. Samples are embedded in a thin layer of vitreous ice, by rapid freezing, and imaged in electron microscopes at liquid nitrogen temperature, under low dose conditions to minimize the radiation damage. Sample images are obtained under near native conditions at the expense of low signal and low contrast in the recorded micrographs. Fortunately, the process of helical reconstruction has largely been automated, with the exception of indexing the helical diffraction pattern. Here, we describe an approach to index helical structure and determine helical symmetries (helical parameters) from digitized micrographs, an essential step for 3D helical reconstruction. Briefly, we obtain an initial 3D density map by applying the IHRSR method. This initial map is then iteratively refined by introducing constraints for the alignment parameters of each segment, thus controlling their degrees of freedom. Further improvement is achieved by correcting for the contrast transfer function (CTF) of the electron microscope (amplitude and phase correction) and by optimizing the helical symmetry of the assembly.

This article describes a method to obtain a three-dimensional (3D) structure of helically assembled molecules using cryo-electron microscopy. In this protocol, we use HIV-1 capsid assemblies to illustrate the detailed 3D reconstruction procedure for achieving a density map by the iterative helical real-space reconstruction method.

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the protocols described here use freshly isolated human peripheral blood mononuclear cells (PBMCs) or plasmacytoid dendritic cells (pDCs) to sense infections in either T cell line (MT4) or heterologous primary CD4+ T cells. In order to ensure proper sensing, it is essential that PBMC are isolated immediately after blood collection and that optimal percentage of infected T cells are used. Furthermore, multi-parametric flow cytometric staining can be used to confirm that PBMC samples contain the different cell lineages at physiological ratios. A number of controls can also be included to evaluate viability and functionality of pDCs. These include, the presence of specific surface markers, assessing cellular responses to known agonist of Toll-Like Receptors (TLR) pathways, and confirming a lack of spontaneous type-I interferon (IFN) production. In this system, freshly isolated PBMCs or pDCs are co-cultured with HIV-1 infected cells in 96 well plates for 18-22 hr. Supernatants from these co-cultures are then used to determine the levels of bioactive type-I IFNs by monitoring the activation of the ISGF3 pathway in HEK-Blue IFN-&#945;/&#946; cells. Prior and during co-culture conditions, target cells can be subjected to flow cytometric analysis to determine a number of parameters, including the percentage of infected cells, levels of specific surface markers, and differential killing of infected cells. Although, these protocols were initially developed to follow type-I IFN production, they could potentially be used to study other imuno-modulatory molecules released from pDCs and to gain further insight into the molecular mechanisms governing HIV-1 innate sensing.

Assessing the Innate Sensing of HIV-1 Infected CD4+ T Cells by Plasmacytoid Dendritic Cells Using an Ex vivo Co-culture System.

Unlike cell-free HIV-1 particles, infected CD4+ T cells are effectively sensed by plasmacytoid dendritic cells (pDCs). This manuscript describes a method where peripheral blood mononuclear cells (PBMCs) or isolated pDCs are co-cultured with HIV-1 infected T cells to evaluate innate sensing by pDCs as assessed by release of type-I IFN.

HIV-1 innate sensing requires direct contact of infected CD4+ T cells with plasmacytoid dendritic cells (pDCs). In order to study this process, the ...

Conformational Evaluation of HIV-1 Trimeric Envelope Glycoproteins Using a Cell-based ELISA Assay

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins are able to fuel the fusion process through their conformational changes could lead to the design of better, more effective immunogens for vaccine strategies. Here we describe a cell-based ELISA assay that allows studying the recognition of trimeric HIV-1 Env by monoclonal antibodies. Following expression of HIV-1 trimeric Env at the surface of transfected cells, conformation specific anti-Env antibodies are incubated with the cells. A horseradish peroxidase-conjugated secondary antibody and a simple chemiluminescence reaction are then used to detect bound antibodies. This system is highly flexible and can detect Env conformational changes induced by soluble CD4 or cellular proteins. It requires minimal amount of material and no highly-specialized equipment or know-how. Thus, this technique can be established for medium to high throughput screening of antigens and antibodies, such as newly-isolated antibodies.

Understanding viral surface antigens conformations is required to evaluate antibody neutralization and guide the design of effective vaccine immunogens. Here we describe a cell-based ELISA assay that allows the study of the recognition of trimeric HIV-1 Env expressed at the surface of transfected cells by specific anti-Env antibodies.

HIV-1 envelope glycoproteins (Env) mediate viral entry into target cells and are essential to the infectious cycle. Understanding how those glycoproteins ...

Isolation of Exosomes from the Plasma of HIV-1 Positive Individuals

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. They are found in a number of biological fluids and are known to carry a variety of proteins, lipids, and nucleic acid molecules. Originally thought to be little more than reservoirs for cellular debris, the roles of exosomes regulating biological processes and in diseases are increasingly appreciated.
Several methods have been described for isolating exosomes from cellular culture media and biological fluids. Due to their small size and low density, differential ultracentrifugation and/or ultrafiltration are the most commonly used techniques for exosome isolation. However, plasma of HIV-1 infected individuals contains both exosomes and HIV viral particles, which are similar in size and density. Thus, efficient separation of exosomes from HIV viral particles in human plasma has been a challenge.
To address this limitation, we developed a procedure modified from Cantin et. al., 2008 for purification of exosomes from HIV particles in human plasma. Iodixanol velocity gradients were used to separate exosomes from HIV-1 particles in the plasma of HIV-1 positive individuals. Virus particles were identified by p24 ELISA. Exosomes were identified on the basis of exosome markers acetylcholinesterase (AChE), and the CD9, CD63, and CD45 antigens. Our gradient procedure yielded exosome preparations free of virus particles. The efficient purification of exosomes from human plasma enabled us to examine the content of plasma-derived exosomes and to investigate their immune modulatory potential and other biological functions.

Techniques describing a gradient procedure to separate exosomes from human immunodeficiency virus (HIV) particles are described. This procedure was used to isolate exosomes away from HIV particles in human plasma from HIV-infected individuals. The isolated exosomes were analyzed for cytokine/chemokine content.

Exosomes are small vesicles ranging in size from 30 nm to 100 nm that are released both constitutively and upon stimulation from a variety of cell types. ...

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3&#39; ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes

This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the ...

SILAC Based Proteomic Characterization of Exosomes from HIV-1 Infected Cells

Proteomics is the large-scale analysis of proteins. Proteomic techniques, such as liquid chromatography tandem mass spectroscopy (LC-MS/MS), can characterize thousands of proteins at a time. These powerful techniques allow us to have a systemic understanding of cellular changes, especially when cells are subjected to various stimuli, such as infections, stresses, and specific test conditions. Even with recent developments, analyzing the exosomal proteome is time-consuming and often involves complex methodologies. In addition, the resultant large dataset often needs robust and streamlined analysis in order for researchers to perform further downstream studies. Here, we describe a SILAC-based protocol for characterizing the exosomal proteome when cells are infected with HIV-1. The method is based on simple isotope labeling, isolation of exosomes from differentially labeled cells, and mass spectrometry analysis. This is followed by detailed data mining and bioinformatics analysis of the proteomic hits. The resultant datasets and candidates are easy to understand and often offer a wealth of information that is useful for downstream analysis. This protocol is applicable to other subcellular compartments and a wide range of test conditions.

Here, we describe a quantitative proteomics method using the technique of stable isotope labeling by amino acids in cell culture (SILAC) to analyze the effects of HIV-1 infection on host exosomal proteomes. This protocol can be easily adapted to cells under different stress or infection conditions.