Nous reconnaissons le soutien de prix NIH Innovateur New DP2 116520 et ORAU Ralph Powe junior Prix Amélioration de la Faculté.

1. L&#39;entretien des cellules <ol><li> CSEh H1 (WiCell) ont été maintenues sur CSEh qualifiés Matrigel puits revêtus avec mTeSR1 médias, avec les médias changent tous les jours. Les puits ont été revêtus par une solution diluée matrigel, préparée par addition de 300 ul de matrigel CSEh dans 25 ml de DMEM: F12. 1 ml de cette solution matrigel a été ajouté à chaque puits d&#39;une plaque de six puits, ou 400 pi ajouté à chaque puits d&#39;une plaque 12 puits et on laisse manteau pendant 1 heure à température ambiante. Les cellules ont été repiquées au mécaniquement un facteur de division de 1:4 en grattant colonies fois qu&#39;ils ont atteint entre 1 et 1,5 mm de diamètre. </li><li> RHMVEC (technologies CVE) a été maintenue dans MCDB-131 médias avec les médias changent tous les jours. Les cellules ont été divisés par trypsinisation fois 80% de confluence a été atteint à un rapport de division de 1:3. Les cellules endothéliales entre les passages 3 et 7 ont été utilisés pour cette étude. </li></ol> 2. Préparation des solutions stock <ol><li> Activine A a été reconstitué à 50 ug / ml dans P stérileBS contenant 0,1% de sérum albumine bovine. La solution a été aliquotés et conservés à -20 ° C. </li><li> FEM a été reconstitué à 500 ug / ml dans l&#39;acide acétique stérile de 10 mM. La solution a été aliquotés et conservés à -20 ° C. </li><li> L&#39;insuline a été reconstitué à 10 mg / ml en ajoutant acidifié H 2 O (pH ≤ 2), préparé par addition de 0,1 ml d&#39;acide acétique glacial à 10 ml d&#39;eau. </li><li> DAPT a été reconstitué dans du DMSO à 18 mg / ml. Il a en outre été diluée à 300 uM de concentration dans un milieu DMEM: F12, aliquotés et conservés à -20 ° C. </li><li> KAAD-cyclopamine a été reconstitué dans du DMSO à 5mg/ml. Il a également été dilué à 2 uM de concentration dans un milieu DMEM: F12, aliquotés et conservés à -20 ° C. </li><li> All-trans rétinoïque a été reconstitué à 2,7 mg / ml dans de l&#39;éthanol à 95%. Il a en outre été dilués à la concentration 2 mM dans du DMEM: F12, aliquotés et conservés à -80 ° C. </li></ol> 3. Endoderme définitif (DE) et les cellules progénitrices du pancréas (PP) à induction <ol><li> Une fois hColonies ESC atteint entre 1 et 1,5 mm de diamètre, l&#39;induction DE été effectuée par addition du DMEM: F12 supplémenté avec B27, 0,2% de BSA, 100 ng / ml et une activine A wortmannine uM pendant 4 jours (jour 0-jour 4) avec des milieux changent tous les jours. </li><li> Après l&#39;induction DE était complète, l&#39;induction progénitrices du pancréas a été induite en changeant les médias pour DMEM: F12 supplémenté avec B27, 0,2% de BSA et KAAD-cyclopamine à 0,2 uM de concentration pendant 24 heures (Jour 4 Jour 5). </li><li> Après 24 heures les médias a été changé pour DMEM: F12 supplémenté avec B27, 0,2% de BSA, KAAD-cyclopamine à concentration de 0,2 uM et acide tout-trans rétinoïque une concentration de 2 uM pendant 3 jours avec les médias changent tous les jours (Jour 5 Jour 8) . </li></ol> 4. La maturation du pancréas <ol><li> Après l&#39;induction de PP, tous les groupes ont été modifiées pour les milieux de maturation composé de DMEM: F12 supplémenté avec B27, 0,2% de BSA, 10 mM Nicotinamide, 25 pg / ml d&#39;insuline, 30 nM Na 2 SeO 3 pg et 50 / ml de transferrine pour 2 days avec les médias changent tous les jours (Jour 8 Jour 10). </li><li> Après 2 jours dans un milieu de maturation, l&#39;étape de maturation finale est effectuée en parallèle en utilisant plusieurs conditions différentes pour effectuer des comparaisons. Différenciation a été induite dans les conditions suivantes: (i) à l&#39;aide cran inhibiteur de DAPT (ii) à l&#39;aide de co-culture des médias seulement, sans les cellules endothéliales que le contrôle et (iii) à l&#39;aide de contact co-culture avec des cellules RHMVEC. Les cellules ont été maintenues dans les médias DAPT ou de co-culture pendant une semaine (Jour 10-Jour 17) avec les médias changent tous les jours. <ol><li> Médias DAPT a été préparé par les milieux de maturation complétant avec 30 uM DAPT. Les cellules de ces groupes ont d&#39;abord été exposée à compléter MCDB131 pendant 24 heures, puis exposée aux médias DAPT pendant 6 jours (jour 11 jours 17). </li><li> Co-culture multimédia a été préparé par complétant MCDB 131-support avec B27, 0,2% de BSA, 10 mM de nicotinamide, 10 ng / ml EGF, 1 pg / ml d&#39;hydrocortisone, 10 mg EndoGro, 90 pg / ml d&#39;héparine. Pour la condition contrôle des médias les cellules différenciées ont été exposésà MCDB-131 milieu complet pendant 24 heures (jour 10-Day 11), après quoi les médias a été changé à la co-culture des médias pendant 6 jours (jour 11 jours 17) (pas de cellules endothéliales). </li><li> En cas de contact co-culture l&#39;état, un million de RHMVEC a été ajouté à des cellules différenciées dans complètes MCDB-131 médias (technologies VEC) pour 24 heures (jour 10-Jour 11) pour permettre la fixation. Après les médias 24 heures a été changé à la co-culture des médias pendant 6 jours (jour 11 jours 17) avec les médias changent tous les jours. </li></ol></li></ol> 5. qRT-PCR Analyse <ol><li> À la fin de chaque étape de la différenciation (endoderme; progénitrices du pancréas; îlot maturité) ont été lysées et l&#39;ARN a été extrait en utilisant l&#39;ARN NucleoSpin kit d&#39;extraction II selon les instructions du fabricant. </li><li> ARN de qualité a été analysée en vérifiant absorbance ARN à 260 nm et 280 nm, suivi par la quantification d&#39;ARN en utilisant un spectrophotomètre SmartSpec plus. </li><li> La transcription inverse a été réalisée à l&#39;aide ImProm II k transcription inverseil selon les instructions du fabricant. Toutes les réactions ont été réalisées avec 100 ng d&#39;ARN. </li><li> qRT-PCR a été réalisée en utilisant le système de Mx3005P QPCR (Agilent) et Brilliant II SYBR Green QPCR Master Mix selon les instructions du fabricant. Les amorces utilisées sont énumérées dans le tableau 1. L&#39;étape d&#39;initialisation a été effectuée à 50 ° C pendant 2 minutes, suivie par 95 ° C pendant 10 minutes. 50 cycles d&#39;amplification ont été réalisées comme suit: 95 ° C pendant 30 secondes, 54 ° C pendant 30 secondes et 72 ° C pendant 1 minute. </li><li> Changement pli de l&#39;expression des ARNm cible sur des cellules indifférenciées a été calculée à partir de valeurs de CT en utilisant les formules suivantes: ΔCT (Marker i) = CT (Marker i) - CT (GAPDH) Δ ΔCT (Marker i) = ΔCT (Marker i) (Exemple) - ΔCT (Marker i) (cellules indifférenciées) Expression relative (Marker i) = 2-ΔΔCT(Marqueur de i) </li></ol> 6. Immunocytochimie <ol><li> À la fin de chaque étape de la différenciation (endoderme; progénitrices du pancréas; îlot mature) cellules ont été fixées dans du formol à 4% pendant 15 minutes à température ambiante. </li><li> Cellules ont été perméabilisées fixes en utilisant 0,25% de Triton X-100 (TX) pendant 15 minutes. </li><li> Non-spécifique de coloration a été bloquée par une incubation dans le sérum âne de 10% en 0,05% TX pendant 30 minutes. </li><li> D&#39;incubation d&#39;anticorps primaire a été réalisée pendant une nuit à 4 ° C dans un tampon de blocage une dilution d&#39;anticorps recommandée (voir tableau 1). </li><li> Les cellules ont été lavées avec 0,05% de TX trois fois pendant 5 minutes. </li><li> D&#39;incubation d&#39;anticorps secondaire a été effectuée pendant une heure à température ambiante dans l&#39;obscurité avec des anticorps appropriés dilués dans un tampon de blocage. </li><li> Les cellules ont été lavées avec 0,05% de TX trois fois pendant 5 minutes. </li><li> Coloration nucléaire a été réalisée par incubation avec Hoescht tache au 1:1000 dilution en PBSpendant 5 minutes, suivie de 3 lavages avec du PBS. </li><li> Cellules fixées et colorées ont été imagées par Olympus IX81 microscope inversé et Metamorph logiciel d&#39;imagerie. </li></ol> 7. Les résultats représentatifs Ajout de l&#39;activine A et Wortmannin à CSEh indifférenciées pendant 4 jours induit endoderme définitif tel que confirmé par qRT-PCR analyse des marqueurs DE Sox17, CXCR4, et Foxa2 et immunomarquage pour Sox17 comme illustré à la figure 2. Différenciation de cellules souches pancréatiques après l&#39;addition d&#39;acide rétinoïque et cyclopamine a été confirmée par qRT-PCR de marqueurs progénitrices pancréatiques et immunocoloration de PDX1 comme illustré à la figure 3. Au stade final de différenciation, contactez la co-culture avec des cellules RHMVEC fortement incités régulation à la hausse de l&#39;expression d&#39;insuline dans les CSEh dérivées de cellules souches pancréatiques. L&#39;efficacité de la différenciation induite co-culture a été analysé par la coopérationmparing avec la condition de contrôle en utilisant DAPT. DAPT a été utilisé comme un contrôle positif, car il est actuellement l&#39;une des méthodes les plus couramment utilisés pour parvenir à la maturation du pancréas. Depuis la co-culture a été effectuée dans un milieu modifiés complétées par des facteurs de soutien des cellules endothéliales, un contrôle supplémentaire a été réalisée avec les médias en l&#39;absence de cellules endothéliales afin de vérifier l&#39;effet des médias sur la différenciation. Les détails de cette analyse sont présentés dans la figure 4. <img alt="Figure 1." src="/files/ftp_upload/3759/3759fig1.jpg" /> Figure 1. Multi-étape du protocole de différenciation des CSEh en cellules productrices d&#39;insuline exprimant. <img alt="Figure 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> Figure 2. Induction endoderme définitif de cellules souches embryonnaires humaines. A) qRT-PCR de marqueurs dans les cellules représentatives DE CSEh exposés à l&#39;activine A et Wortmannin pendant 4 jours. Résultats ar<html> e normalisé par rapport à CSEh indifférenciée. B) Sox17 coloration (vert) et DAPI (bleu) montrent une expression nucléaire de Sox17. La barre d&#39;échelle: 50 um. <img alt="Figure 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> Figure 3. Induction progénitrices du pancréas de la cellule souche embryonnaire de cellules dérivées endoderme. A) qRT-PCR de marqueurs dans les cellules pancréatiques début de CSEh dérivées endoderme exposés à l&#39;acide rétinoïque et cyclopamine pendant 4 jours après l&#39;induction DE. Les résultats normalisés par rapport à CSEh indifférenciée. B) PDX1 coloration (violette) et DAPI (bleu) montrent une expression nucléaire de PDX1. La barre d&#39;échelle: 50 um. &quot;&gt; <img alt="Figure 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> Figure 4. Stade de maturation du pancréas A) qRT-PCR analyse des hormones pancréatiques dans les CSEh après la maturation du pancréas en utilisant DAPT, contacter les médias de co-culture ou de co-culture (contrôle). Les résultats normalisés par rapport à CSEh indifférenciée. p valeurs obtenues par test t de Student. B) La co-culture avec Dil-Ac-LDL marqué RHMVEC (Rouge) montrent les régions où EC attachent à la plaque, si il ya des espaces vides (en haut), RHMVEC autre peut être trouvée en contact direct avec la différenciation ESC (en bas). C) C-peptide (vert) de coloration pour des cellules différenciées en utilisant la méthode de co-culture. La barre d&#39;échelle: 12,5 um (Haut) et 50 um (Bas) D) Immunomarquage de RHMVEC ne démontre aucune expression de l&#39;insuline dans le RHMVEC. <table border="1"><tbody><tr><td> Marqueur </td><td> Primer1 (5 &#39;à 3&#39;) &lt;/ Td&gt; <td> Primer2 (5 &#39;à 3&#39;) </td><td> Réf </td></tr><tr><td> Sox17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> FOXA2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> PDX1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> ISL1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> GLUCAGON </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> INSULINE </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> Primaires Tableau 1. Utilisé pour des réactions qPCR.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

Nous n&#39;avons rien à communiquer.

Au cours du développement du pancréas, de différenciation des cellules pancréatiques sont en étroite proximité avec les cellules endothéliales de l&#39;aorte; outre, les îlots pancréatiques sont densément vascularisé de promouvoir l&#39;échange rapide de glucose dans le sang et les hormones des îlots de Langerhans. Compte tenu de ces faits, il n&#39;est pas surprenant que les cellules endothéliales jouent un rôle important dans le processus d&#39;organogenèse du pancréas. Bien que l&#39;importance des c...

<table border="1"><tbody><tr><td> Nom du réactif </td><td> Entreprise </td><td> Numéro de catalogue </td><td> Les concentrations </td></tr><tr><td> mTeSR1 (avec supplément) </td><td> Technologies des cellules souches </td><td> 5850 </td><td></td></tr><tr><td> CSEh qualifiée matrigel </td><td> BD Biosciences </td><td> 354277 </td><td></td></tr><tr><td> DMEM: F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (complet) </td><td> Technologies VEC </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 Supplément </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> Activine A </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1 uM </td></tr><tr><td> KAAD-Cyclopamie </td><td> Sigma-Aldrich </td><td> C4116 </td><td> 0,2 um </td></tr><tr><td> Acide tout-trans rétinoïque </td><td> Sigma-Aldrich </td><td> R2625 </td><td> 2 pm </td></tr><tr><td> DAPT </td><td> Sigma-Aldrich </td><td> D5942 </td><td> 30 microns </td></tr><tr><td> Nicotinamide </td><td> Sigma-Aldrich </td><td> N0636 </td><td> 10 mM </td></tr><tr><td> Sélénite de sodium </td><td> Sigma-Aldrich </td><td> S5261 </td><td> 30 nM </td></tr><tr><td> Insuline </td><td> Sigma-Aldrich </td><td> I1882 </td><td> 25 pg / ml </td></tr><tr><td> La transferrine </td><td> Sigma-Aldrich </td><td> T8158 </td><td> 50 pg / ml </td></tr><tr><td> EGF </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10ng/ml </td></tr><tr><td> EndoGro </td><td> Technologies VEC </td><td> ENDOGRO </td><td> 10mg </td></tr><tr><td> Héparine </td><td> Sigma-Aldrich </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> Hydrocortisone </td><td> Sigma-Aldrich </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin II de l&#39;ARN </td><td> Macherey Nagel </td><td> 740955 </td><td></td></tr><tr><td> ImProm II Système de transcription inverse </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> Brilliant II SYBR Green QPCR Master Mix </td><td> Straragene </td><td> 600548 </td><td></td></tr><tr><td> Sox17 polyclonal de chèvre IgG </td><td> Santa Cruz </td><td> sc-17355 </td><td> 1/500 </td></tr><tr><td> PDX1 polyclonal de chèvre IgG </td><td> Santa Cruz </td><td> sc-14662 </td><td> 1/500 </td></tr><tr><td> C-Peptide polyclonal de lapin </td><td> Signalisation cellulaire </td><td> 4593 </td><td> 1/500 </td></tr><tr><td> Alexa Fluor 488 d&#39;âne anti-IgG de lapin </td><td> Invitrogen </td><td> Un-21206 </td><td> 1/1000 </td></tr><tr><td> Alexa Fluor 647 d&#39;âne anti-IgG de chèvre </td><td> Invitrogen </td><td> Un-21447 </td><td> 1/1000 </td></tr></tbody></table> Tableau 2. Réactifs et kits.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

Les cellules souches embryonnaires (ESC) ont deux caractéristiques principales: elles peuvent être indéfiniment propagées in vitro dans un état ​​indifférencié et elles sont pluripotentes, ayant ainsi le potentiel de se différencier en plusieurs lignées. Ces propriétés font CES extrêmement attractif pour la thérapie cellulaire à base et les applications de traitement de régénération 1. Toutefois, pour son plein potentiel à réaliser les cellules doivent être différenciées en phénotypes matures et fonctionnelles, ce qui est une tâche ardue. Une approche prometteuse dans l&#39;induction de la différenciation cellulaire est à suivre de près imiter le chemin de l&#39;organogenèse dans le cadre in vitro. Le développement du pancréas est connu pour se produire dans des stades spécifiques 2, à commencer par l&#39;endoderme, qui peut se développer dans plusieurs organes, y compris le foie et le pancréas. L&#39;induction endoderme peut être obtenue par modulation de la voie nodale par addition de l&#39;activine A 3 en combinaison avec plusieurs facteurs de croissance 4-7 </sup&gt;. Cellules endodermiques définitives sont alors soumis à l&#39;engagement du pancréas par inhibition de l&#39;inhibition Sonic Hedgehog, qui peut être obtenu in vitro par addition d&#39;Cyclopamine 8. La maturation du pancréas est médiée par plusieurs événements parallèles dont l&#39;inhibition de la signalisation Notch; l&#39;agrégation des progéniteurs pancréatiques en 3-dimensionnelles grappes; induction de la vascularisation; pour n&#39;en nommer que quelques-uns. De loin le plus de succès dans la maturation in vitro de l&#39;ESC dérivés des cellules progénitrices du pancréas ont été atteints par l&#39;inhibition de la signalisation Notch par la supplémentation DAPT 9. Malgré son succès, il en résulte un faible rendement de l&#39;phénotype mature avec des fonctionnalités réduites. Une zone moins étudié est l&#39;effet de signalisation des cellules endothéliales dans la maturation du pancréas, ce qui est de plus en plus apprécié comme un facteur important qui contribue à la maturation in vivo des îlots pancréatiques 10,11. L&#39;étude actuelle explore un tel effet de endothelial de signalisation cellulaire dans la maturation de l&#39;homme ESC dérivés des cellules progénitrices pancréatiques productrices d&#39;insuline dans l&#39;îlot des cellules semblables à. Nous rapportons un protocole multi-stade de différenciation dirigée où les CES de l&#39;homme sont d&#39;abord induite par l&#39;activine vers l&#39;endoderme A avec l&#39;inhibition de la voie de la PI3K. Spécification de cellules pancréatiques endodermiques est réalisée par l&#39;inhibition de la signalisation par Sonic Hedgehog cyclopamine avec l&#39;induction rétinoïde par addition d&#39;acide rétinoïque. La dernière étape de maturation est induite par la signalisation cellulaire endothéliale réalisée par une configuration co-culture. Alors que plusieurs cellules endothéliales ont été testés dans la co-culture, ici, nous présentons nos données avec des cellules de rat cardiaques microvasculaires endothéliales (RHMVEC), principalement pour la facilité de l&#39;analyse.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

La présente étude décrit une approche différenciation dirigée dans l&#39;induction de la différenciation du pancréas de cellules souches embryonnaires humaines. D&#39;une grande importance est le fait que des cellules endothéliales de co-culture de maturation de la médiation sur les cellules souches embryonnaires humaines dérivées des progéniteurs pancréatiques en cellules exprimant l&#39;insuline.

Cellules endothéliales co-culture de maturation de la médiation de l&#39;homme les cellules souches embryonnaires à des cellules productrices d&#39;insuline du pancréas dans une approche différenciation dirigée

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K vues.  University of Pittsburgh. La présente étude décrit une approche différenciation dirigée dans l'induction de la différenciation du pancréas de cellules souches embryonnaires humaines. D'une grande importance est le fait que des cellules endothéliales de co-culture de maturation de la médiation sur les cellules souches embryonnaires humaines dérivées des progéniteurs pancréatiques en cellules exprimant l'insuline.

Vidéo: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

Dérivation de cellules souches hématopoïétiques de cellules souches embryonnaires murines

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Recherche

Biologie

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Dérivation des cellules souches embryonnaires humaines par Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Les cellules souches embryonnaires des cellules dérivées endothéliales pour traitement de l&#39;ischémie des membres postérieurs

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

L&#39;isolement et expansion à grande échelle des cellules adultes humaines Colony Forming progénitrices endothéliales

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

Isolement et animale expansion sans sérum du cordon ombilical humain dérivé cellules stromales mésenchymateuses (CSM) et des cellules endothéliales progénitrices Colony Forming (CPEF)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

Vidéo analyse bioinformatique des droits de croissance de la tige colonie de cellules embryonnaires

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

La différenciation des cellules souches embryonnaires en précurseurs d&#39;oligodendrocytes

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Cartographie sort des cellules souches embryonnaires humaines par la formation de tératome

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

Dérivation efficace des ressources humaines précurseurs cardiaques et les cardiomyocytes à partir pluripotentes cellules souches embryonnaires humaines à l&#39;induction de petites molécules

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Reprogrammation des cellules somatiques humaines dans cellules souches pluripotentes induites (CISP) Utilisation vecteur rétroviral avec la GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...