우리는 116,520 DP2와 ORAU 랄프 포웨 주니어 학부 향상 수상 NIH 새로운 혁신 상을로부터 지원을 인정합니다.

1. 세포 유지 보수 <ol><li> 미디어가 매일 변화와 H1의 hESC (WiCell)는 mTeSR1 미디어 hESC 자격 matrigel 코팅 우물을 유지했다. F12을 : 웰스는 DMEM의 25 ML에 hESC의 matrigel 300 μl를 추가하여 준비 묽은 matrigel 솔루션에 의해 덮여 있었다. 이 matrigel 솔루션 1 ML은 여섯 잘 접시의 각 음에 추가하거나, 400 μl는 12 잘 접시의 각도에 추가하고 실온에서 1 시간 코트에 허용되었다. 전지는 기계들이 1 일, 직경 1.5mm에 도달 한 번 식민지를 위해서 힘든하여 1시 4분의 분할 비율에 passaged되었다. </li><li> RHMVEC은 (VEC 기술) 미디어가 매일 변화 MCDB-131 미디어에서 유지되었다. 80 % 합류가 1시 3분의 분할 비율에 도달한 후에는 세포 trypsinization에 의해 분할되었다. 단락 3과 7 사이의 내피 세포가이 연구에 사용되었다. </li></ol> 2. 증권 솔루션의 작성 <ol><li> Activin은이 무균 P에서 50 μg / ML로 재구성되었다BS는 소 혈청 알부민은 0.1 %를 포함. 솔루션은 -20 ° C.에 aliquoted 및 보관되었다 </li><li> EGF는 멸균 10 밀리미터 초산 500 μg / ML로 재구성되었다. 솔루션은 -20 ° C.에 aliquoted 및 보관되었다 </li><li> 인슐린은 물 10 ML의 0.1 ML 빙초산가 추가로 준비 acidified H 2 O (산도 ≤ 2), 추가로 10 밀리그램 / ML로 재구성되었다. </li><li> DAPT 18 밀리그램 / ML에서 DMSO로 재구성되었다. F12는 aliquoted 및 -20 ° C.에 저장된 : 그것은 더욱 DMEM에 300 μm의 농도로 희석되었다 </li><li> KAAD-Cyclopamine는 5mg/ml에서 DMSO로 재구성되었다. F12는 aliquoted 및 -20 ° C.에 저장된 : 그것은 더욱 DMEM 2 μm의 농도로 희석되었다 </li><li> 모든 트랜스 retinoic 산성은 95 % 에탄올에서 2.7 밀리그램 / ML로 재구성되었다. , F12 aliquoted 및 -80 ° C.에 저장된 : 그것은 더욱 DMEM에 2mM 농도로 희석되었다 </li></ol> 3. 최종 Endoderm (DE) 및 췌장 시조 (PP) 유도 <ol><li> H 한 번ESC의 식민지는 1, 직경 1.5mm 사이에 도달, DE 유도는 DMEM을 추가하여 수행되었다 : F12은 B27, 0.2 % BSA, 4 일 동안 1 μm의의 Wortmannin (주 0 주 4) 미디어 100 NG / ML Activin로 보충 매일 변경합니다. </li><li> DE 유도가 완료가 된 후에, 췌장 전구 유도는 DMEM으로 미디어를 변경하여 의도한 : F12는 24 시간 동안 0.2 μm의 농도 (일 4 일 5)에서 B27, 0.2 % BSA 및 KAAD-Cyclopamine으로 보충. </li><li> 24 시간 이내에 미디어는 DMEM으로 변경되었습니다 : F12 같이 보충 B27, 0.2 % BSA, 미디어가 매일 변화가있는 3 일간 0.2 μm의 농도 및 2 μm의 농도에서 모든 트랜스 retinoic 산 (주 5 일 8)에서 KAAD-Cyclopamine . </li></ol> 4. 췌장 성숙 <ol><li> PP 유도 후 모든 그룹은 DMEM으로 구성된 성숙 미디어로 변경되었습니다 F12 2 D를 위해 B27, 0.2 % BSA, 10 밀리미터 니코틴, 25 μg / ML 인슐린, 30 NM 나이 SEO 세 및 50 μg / ML 트랜스페린로 보충매체와 ays은 (주 8 주 10) 매일 변경합니다. </li><li> 성숙 미디어 2 일 후에 최종 성숙 단계는 병렬 비교를 위해 여러 가지 조건을 사용하여 수행됩니다. 은 (i) 제어와 같은 내피 세포없이, 오직 공동의 문화 미디어를 사용하여 그리고 (iii) RHMVEC 세포와 접촉 공동 문화를 사용하여 노치 억제제 DAPT (2)를 사용하여 차별화는 다음 조건 하에서 유도되었다. 전지는 미디어가 매일 변화와 함께 (주 10 주 17) 주일 동안 DAPT 또는 공동의 문화 매체에 유지되었다. <ol><li> DAPT 미디어는 30 μm의 제품 DAPT으로 성숙 미디어를 보완하여 작성됐다. 이 그룹에있는 세포는 6 일 (주 11 주 17)에 대해 처음 24 시간 동안 MCDB131를 완료하기 위해 노출하고 DAPT 미디어에 노출되었다. </li><li> 공동 문화 미디어와 MCDB-131 미디어를 보완하여 준비되었다 B27, 0.2 % BSA, 10 밀리미터 니코틴, 10 NG / ML EGF, 1 μg / ML의 하이드로코티손, 10 밀리그램 EndoGro, 90 μg / ML의 헤파린. 미디어 제어 조건의 경우 차별 세포가 노출되었다미디어 육일 (주 11 주 17) (없음 내피 세포)에 대한 공동의 문화 미디어로 변경되었습니다 그 이후 24 시간 동안 MCDB-131 완전한 매체 (일 10 일 11)에. </li><li> 연락처 공동 배양 조건의 경우 백만 RHMVEC은 첨부 파일을 허용하도록 24 시간 동안 완전한 MCDB-131 미디어의 차별화 세포 (VEC 기술) (주 10 주 11)에 추가되었습니다. 24 시간 미디어 매체 6 일 (주 11 주 17)에 대해 공동의 문화 미디어로 변경되었습니다 후 매일 변경합니다. </li></ol></li></ol> 5. qRT-PCR 분석 <ol><li> 분화의 각 단계 (; 췌장 전구, endoderm 성숙 섬)의 끝에 lysed되었으며 RNA는 제조 업체의 지침에 따라 NucleoSpin RNA II 추출 키트를 사용하여 추출되었습니다. </li><li> RNA 품질 SmartSpec 플러스 분광 광도계를 사용하여 RNA의 양을 정함 다음, 260 nm의 및 280 nm의에서 RNA의 흡광도를 선택하여 분석되었다. </li><li> 역방향 전사는 ImProm II 리버스 전사 K를 사용하여 수행되었다그것은 제조 업체의 지시에 따라. 모든 반응은 RNA의 100 NG로 수행되었다. </li><li> qRT-PCR은 제조 업체의 지시에 따라 Mx3005P QPCR 시스템 (애질런트)와 브릴리언트 II SYBR 녹색 QPCR 마스터 믹스를 사용하여 수행되었다. 사용된 primers는 표 1에 나열됩니다. 초기화 단계 50에서 수행된 10 분 동안 95 ° C이어서 2 분을 ° C에서. 50 증폭주기는 다음과 같이 수행되었다 : 95 ° 30 초 C 54 ° 30 초 1 분 72 ° C에 대한 C #. </li><li> undifferentiated 세포 이상의 타겟 mRNA의 표현의 공간 변경 사항은 다음과 같은 수식을 사용하여 중부 표준시 값으로부터 계산되었다 : ΔCT (마커 I) = 중부 표준시 (마커 I) - 중부 표준시 (GAPDH) Δ ΔCT (마커 I) = ΔCT (마커 I) (샘플) - ΔCT (마커 I) (Undifferentiated 세포) 상대 표현 (마커 I) = 2-ΔΔCT(마커 I) </li></ol> 6. Immunocytochemistry <ol><li> 분화의 각 단계 (; 췌장 전구, endoderm 성숙 섬)의 끝에서 전지는 상온에서 15 분 동안 4 % 포름 알데히드에서 수정되었습니다. </li><li> 고정 세포는 트리톤 X-100 (TX) 15 분 동안 0.25 %를 사용 permeabilized되었다. </li><li> 비 특정 염색법은 30 분 동안 TX 0.05 %에서 10 % 당나귀 혈청에서 부화에 의해 차단되었습니다. </li><li> 일차 항체 배양은 4에서 하룻밤을 수행한 권장 항체 희석 (표 1 참조)에서 버퍼를 차단에서 ° C #. </li><li> 셀은 5 분 동안 0.05 %, 텍사스 세 번 함께 씻겨 있었다. </li><li> 차 항체 보육는 버퍼를 차단에 희석 적절한 항체와 어두운 실내 온도에 하나의 시간 동안 수행되었다. </li><li> 셀은 5 분 동안 0.05 %, 텍사스 세 번 함께 씻겨 있었다. </li><li> 핵 염색법은 PBS에서 1:1000 희석에 얼룩 Hoescht과 부화에 의해 수행되었다PBS로 3 세차장 뒤에는 15 분. </li><li> 고정 및 스테인드 세포 올림푸스 IX81 거꾸로 현미경과 Metamorph 이미징 소프트웨어를 사용하여 몇 군데 있었다. </li></ol> 7. 대표 결과 드 마커 Sox17, Cxcr4 및 Foxa2위한 qRT-PCR 분석에 의해 확인 및 그림 2에 그림과 같이 Sox17 위해 immunostaining로 Activin의 추가는 4 일 동안 undifferentiated hESC에 Wortmannin 확실한 endoderm을 유도합니다. cyclopamine 및 retinoic 산성의 추가 후 췌장 전구 세포로 분화가 췌장 전구 마커와 그림 3 그림과 같이 Pdx1 위해 Immunostaining의 qRT-PCR에 의해 확인되었다. 분화의 마지막 단계에서는 강력히 hESC 파생된 췌장 전구 세포에서 인슐린 표현의 upregulation을 유도 RHMVEC 세포와 공동 문화를 문의하십시오. 공동 문화 매개 차별의 효율성을 공동으로 분석되었다DAPT를 사용하여 컨트롤 상태와 mparing. 그것이 현재 췌장 성숙을 달성하는 데 가장 널리 사용되는 방법 중 하나이기 때문에 DAPT는 긍정적인 제어로 사용되었다. 공동 문화 내피 세포의 지원 요인에 의해 보완 수정된 미디어에서 수행된 이후, 추가적인 컨트롤은 차별화에 대한 미디어의 영향을 확인하는 내피 세포의 부재에서 미디어로 수행되었다. 이 분석의 세부 내용은 그림 4에 표시됩니다. <img alt="1 그림." src="/files/ftp_upload/3759/3759fig1.jpg" /> 그림 1. 인슐린 표현 세포로 hESC의 차별 화를위한 다단 프로토콜. <img alt="그림 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> 그림 2. 인간 배아 줄기 세포의 확실한 endoderm 유도. 그리고 Wortmannin 4 일동안 Activin에 노출 hESC 세포의 대표 드 마커) qRT-PCR 분석. 결과 AR<html> e는 undifferentiated hESC에 대하여 정규화. B) Sox17 염색법 (녹색) 및 DAPI는 (파란색) Sox17의 핵 표현을 보여줍니다. 스케일 바 : 50 μm의. <img alt="그림 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> endoderm 세포를 파생 배아 줄기 세포의 그림 3. 췌장 전구 유도. DE 유도 후 4 일동안 cyclopamine 및 retinoic 산성에 노출된 hESC 파생된 endoderm 세포를 초기에 췌장 마커) qRT-PCR 분석. 결과 undifferentiated hESC에 대하여 정규화. B) Pdx1 염색법 (보라색) 및 DAPI는 (파란색) Pdx1의 핵 표현을 보여줍니다. 스케일 바 : 50 μm의. &quot;&gt; <img alt="4 그림." src="/files/ftp_upload/3759/3759fig4.jpg" /> 그림 4. 췌장 성숙 단계) qRT-PCR의 hESC의 췌장 호르몬 분석 DAPT을 사용하여 췌장 성숙 후, 공동 문화 또는 공동 문화 미디어 (제어)에게 문의하십시오. 결과 undifferentiated hESC에 대하여 정규화. P는 학생 T-시험에 의해 얻은 값. Dil-AC-LDL로 분류 RHMVEC (적색)와 B) 공동 문화가 빈 공간 (위)가있는 경우 내장 컴퓨터 시스템은 플레이트에 연결 영역을 보여주고, 다른 RHMVEC은 차별 ESC (아래)와 직접 접촉에서 찾을 수 있습니다. 공동 배양 방법을 사용하여 차별화된 세포를위한 C) C-펩타이드 (녹색) 염색법. 스케일 바 : 12.5 μm의 (위)와 50 μm의 (아래) D) RHMVEC의 Immunostaining은 RHMVEC에는 인슐린 표현을 보여줍니다 않습니다. <table border="1"><tbody><tr><td> 마커 </td><td> Primer1 (5 &#39;3&#39;) &lt;/ TD&gt; <td> Primer2 (5 &#39;3&#39;) </td><td> 심판 </td></tr><tr><td> SOX17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> FOXA2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> PDX1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> ISL1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> 글루카곤 </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> 인슐린 </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> 표 1. Primers는 qPCR 반응을 위해 사용됩니다.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

우리는 공개 할게 없다.

췌장 개발 과정, 차별 췌장 세포는 대동맥의 내피 세포와 근접 거리에 있습니다, 또한, 췌장 islets은 혈당과 섬 호르몬의 신속한 교환을 촉진하기 위해 밀도가 높은 vascularized 있습니다. 이러한 사실을 감안할 때, 그것은 내피 세포가 췌장 organogenesis의 과정에서 중요한 역할을하는 놀라운 일이 아닙니다. 췌장 개발하는 동안 내피 세포의 중요성이 점점 더 높이 평가되는 반면 배아 세포의 시험 관...

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 농도 </td></tr><tr><td> mTeSR1 (보충제 포함) </td><td> 셀 기술을 막기 </td><td> 5850 </td><td></td></tr><tr><td> hESC 자격 matrigel </td><td> BD Biosciences </td><td> 354,277 </td><td></td></tr><tr><td> DMEM : F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (완료) </td><td> VEC 기술 </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 보충 </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> 를 Activin </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1μM </td></tr><tr><td> KAAD-Cyclopamie </td><td> 시그마 - 올드 리치 </td><td> C4116 </td><td> 0.2μM </td></tr><tr><td> 모든 거래 Retinoic 산성 </td><td> 시그마 - 올드 리치 </td><td> R2625 </td><td> 2μM </td></tr><tr><td> DAPT </td><td> 시그마 - 올드 리치 </td><td> D5942 </td><td> 30μM </td></tr><tr><td> 니코틴 </td><td> 시그마 - 올드 리치 </td><td> N0636 </td><td> 10 MM </td></tr><tr><td> 나트륨 Selenite </td><td> 시그마 - 올드 리치 </td><td> S5261 </td><td> 30 NM </td></tr><tr><td> 인슐린 </td><td> 시그마 - 올드 리치 </td><td> I1882 </td><td> 25 μg / ML </td></tr><tr><td> 트랜스페린 </td><td> 시그마 - 올드 리치 </td><td> T8158 </td><td> 50 μg / ML </td></tr><tr><td> EGF </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10ng/ml </td></tr><tr><td> EndoGro </td><td> VEC 기술 </td><td> ENDOGRO </td><td> 10mg </td></tr><tr><td> 헤파린 </td><td> 시그마 - 올드 리치 </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> 하이드로코티손 </td><td> 시그마 - 올드 리치 </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin RNA II </td><td> Macherey Nagel </td><td> 740,955 </td><td></td></tr><tr><td> ImProm II의 역방향 전송 시스템 </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> 똑똑 II SYBR 녹색 QPCR 마스터 믹스 </td><td> Straragene </td><td> 600,548 </td><td></td></tr><tr><td> Sox17 염소 polyclonal IgG </td><td> 산타 크루즈 </td><td> SC-17355 </td><td> 500분의 1 </td></tr><tr><td> PDX1 염소 polyclonal IgG </td><td> 산타 크루즈 </td><td> SC-14662 </td><td> 500분의 1 </td></tr><tr><td> polyclonal C-펩타이드의 토끼 </td><td> 세포 시그널링 </td><td> 4593 </td><td> 500분의 1 </td></tr><tr><td> 알렉사 형석 488 당나귀 안티 - 토끼 IgG </td><td> Invitrogen </td><td> -21206 </td><td> 1,000분의 1 </td></tr><tr><td> 알렉사 형석 647 당나귀 안티 산양 IgG </td><td> Invitrogen </td><td> -21447 </td><td> 1,000분의 1 </td></tr></tbody></table> 표 2. 시약 및 키트.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

배아 줄기 세포 (ESC)는 두 가지 주요 특징이있다 : 그들은 무기한 따라서 여러 lineages으로 차별화하는 잠재력을 가지고, undifferentiated 상태로 체외에서 증식들이 pluripotent가 될 수 있습니다. 이러한 속성은 세포 기반 치료 및 재생 치료에 응용 1 ESCs 매우 매력적합니다. 그러나 실현하기위한 잠재력을 위해 전지 발굴 작업입니다 성숙하고 기능적인 phenotypes,로 구분해야합니다. 세포 분화를 유도에서 유망한 접근 방법은 밀접하게 관련 체외 환경에서 organogenesis의 경로를 모방하는 것입니다. 췌장 개발은 간, 췌장 등 여러 장기,로 개발할 수 endoderm,로 시작하는 구체적인 단계 2에서 발생하는 것으로 알려져 있습니다. Endoderm 유도는 여러 가지 성장 요인 4-7과 함께 3 Activin의 추가를 통해 결절 통로의 변조에 의해 달성될 수 </&gt;를 한모금. 최종 endoderm 세포 그러면 cyclopamine 8 이외에 의해 체외로 얻을 수있는 소닉 고슴도치 억제의 억제에 의해 췌장 약속을 받고있다. 췌장 성숙은 노치 신호 전달의 억제 등 여러 병렬 이벤트에 의해 매개되며 췌장 progenitors의 집합 3-dimentional 클러스터로, vascularization의 유도, 몇 이름을 지정합니다. 지금까지 가장 성공적인 ESC 파생 췌장 전구 세포의 체외의 성숙에 의해 DAPT의 보완 9 신호를 노치의 억제를 통해 달성되었습니다. 성공 있지만, 기능 제한이있는 성숙한 표현형의 낮은 수확량이 발생합니다. 덜 연구 영역은 점점 더 인 - 생체내 췌장 섬의 성숙 10,11에 중요한 기여 요인으로 평가되고 췌장 성숙에 신호 내피 세포의 효과입니다. 현재의 연구는 endothel 같은 효과를 탐구ial 세포는 섬 같은 세포를 생산하는 인슐린으로 인간의 Esc를 파생 췌장 전구 세포의 성숙에 신호. 우리가 인간 ESCs 처음 PI3K 경로의 억제와 함께를 Activin하여 endoderm 향해 유도되는 다단 감독 차별 프로토콜을보고합니다. endoderm 세포의 췌장 사양 Retinoic 산성의 추가에 의해 retinoid 유도와 함께 Cyclopamine에 의한 음파 고슴도치 신호의 억제에 의해 이루어진다. 성숙의 마지막 단계는 공동 문화 구성에 의해 달성될 내피 세포 신호에 의해 유도된다. 여러 내피 세포가 공동 문화에 테스트한 동안 본 우리는 주로 분석의 용이성을 위해, 쥐 심장 microvascular 내피 세포 (RHMVEC)와 함께 우리의 데이터를 제시.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

현재의 연구는 인간 배아 줄기 세포를 췌장 분화를 유도으로 이동 차별화 접근 방식에 대해 설명합니다. 큰 의미 중 인슐린을 표현하는 세포로 췌장 progenitors을 얻은​​ 인간 배아 줄기 세포를 찾는 것이 내피 세포 공동 배양 mediates의 성숙입니다.

인간 배아의 내피 세포 공동 배양 Mediates의 성숙은 감독 차별화 접근법에서 췌장 인슐린 생산 세포로 세포를 줄기

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K 조회수.  University of Pittsburgh. 현재의 연구는 인간 배아 줄기 세포를 췌장 분화를 유도으로 이동 차별화 접근 방식에 대해 설명합니다. 큰 의미 중 인슐린을 표현하는 세포로 췌장 progenitors을 얻은​​ 인간 배아 줄기 세포를 찾는 것이 내피 세포 공동 배양 mediates의 성숙입니다.

비디오: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

Murine 배아 줄기 세포로부터 조혈 줄기 세포의 유도

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

연구

생물학

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Immunosurgery에 의해 인간 배아 줄기 세포의 유도

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

Hindlimb 국소 빈혈의 치료를위한 배아 줄기 세포 유래 내피 세포

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

분리 및 성인 인간 내피 콜로니 형성 전구 세포의 대규모 확장

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

인간 탯줄의 분리 및 동물 혈청 무료 확장 Mesenchymal Stromal 세포 (MSCS)와 내피 콜로니 형성 전구 세포 (ECFCs)을 유래

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

비디오 생물 정보학 인간의 배아 줄기 세포 콜로니 성장 분석

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Oligodendrocyte 엽 성의 전구 물질로 배아 줄기 세포의 분화

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

기형 종의 형성에 의해 인간 배아 줄기 세포의 운명 매핑

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

작은 분자와 유도 Pluripotent 인간 배아 줄기 세포로부터 인간 심장 엽 성의 전구 물질과 Cardiomyocytes의 효율 유도

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

GFP와 Retroviral 벡터를 사용하여 유도 Pluripotent 줄기 세포 (iPSCs)로 인간 체세포를 프로그래밍

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...