אנו מכירים תמיכה פרס חדש ממציא NIH DP2 116520 ו ORAU ראלף powe שיפור Junior פרס הפקולטה.

1. תא תחזוקה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> HESC H1 (WiCell) נשמרו על בארות hESC מוסמכים מצופה matrigel mTeSR1 עם התקשורת, עם התקשורת לשנות כל יום. וולס היו מכוסות על ידי הפתרון matrigel לדלל, שהוכן על ידי הוספת 300 μl של matrigel hESC ב 25 מ&quot;ל של DMEM: F12. 1 מ&quot;ל של פתרון זה matrigel נוספה גם כל צלחת גם 6, או 400 μl להוסיף גם כל צלחת 12 באר מותר המעיל 1 שעה בטמפרטורת החדר. התאים היו passaged מכנית על ידי גירוד מושבות כשהגיעו בין 1 ל 1.5mm בקוטר ביחס פיצול של 1:04. </li><li style=";text-align:right;direction:rtl"> RHMVEC (VEC טכנולוגיות) נשמר ב-MCDB 131 התקשורת עם התקשורת לשנות כל שני וחמישי. תאים חולקו על ידי trypsinization פעם מפגש 80% הושג ביחס פיצול של 1:03. לתאי אנדותל בין קטעים 3 ו -7 שימשו במחקר זה. </li></ol> 2. הכנת מאגר פתרונות <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Activin היה מחדש ב 50 מיקרוגרם / מ&quot;ל ​​P סטריליתBS המכיל 0.1% אלבומין בסרום שור. הפתרון היה aliquoted ומאוחסנים ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> EGF היה מחדש על 500 מיקרוגרם / מ&quot;ל ​​חומצה אצטית 10 סטרילית מ&quot;מ. הפתרון היה aliquoted ומאוחסנים ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> אינסולין היה מחדש ב 10 מ&quot;ג / מ&quot;ל על ידי הוספת acidified H 2 O (pH ≤ 2), שהוכן על ידי תוספת של חומצה אצטית קרחונית 0.1 מ&quot;ל ל 10 מ&quot;ל מים. </li><li style=";text-align:right;direction:rtl"> DAPT היה מחדש ב DMSO ב 18 מ&quot;ג / מ&quot;ל. זה היה עוד יותר מדולל לריכוז 300 מיקרומטר DMEM: F12, aliquoted ומאוחסנים ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> KAAD-Cyclopamine היה מחדש ב DMSO על 5mg/ml. זה היה עוד יותר מדולל לריכוז 2 מיקרומטר DMEM: F12, aliquoted ומאוחסנים ב -20 ° C. </li><li style=";text-align:right;direction:rtl"> All-טרנס החומצה הרטינואית היה מחדש ב 2.7 מ&quot;ג / מ&quot;ל ​​אתנול 95%. זה היה עוד יותר מדולל לריכוז 2 מ&quot;מ ב DMEM: F12, aliquoted ומאוחסנים ב -80 ° C. </li></ol> 3. האנדודרם מכריע (DE) ו אבי הלבלב (PP) אינדוקציה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר שמושבות חברתיות ותרבותיות שהושג בין 1 ל 1.5mm קוטר, אינדוקציה DE נערך על ידי הוספת DMEM: F12 השלימו עם B27, BSA 0.2%, 100 ng / mL Activin ו 1 מיקרומטר Wortmannin במשך 4 ימים (יום 0-Day 4) עם התקשורת לשנות בכל יום. </li><li style=";text-align:right;direction:rtl"> לאחר הגיוס DE היה שלם, אבי אינדוקציה הלבלב הושרה על ידי שינוי התקשורת DMEM: F12 השלימו עם B27, BSA 0.2% ו-KAAD Cyclopamine בריכוז 0.2 מיקרומטר ל -24 שעות (יום 4 יום 5). </li><li style=";text-align:right;direction:rtl"> לאחר 24 שעות מדיה שונה DMEM: F12 השלימו עם B27, 0.2% BSA, KAAD-Cyclopamine בריכוז 0.2 מיקרומטר ו-All-טרנס החומצה הרטינואית בריכוז 2 מיקרומטר במשך 3 ימים עם התקשורת לשנות כל יום (יום יום 5-8) . </li></ol> 4. הלבלב ההבשלה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לאחר הגיוס PP, הקבוצות שונו למדיה התבגרות מורכב DMEM: F12 השלימו עם B27, 0.2% BSA, Nicotinamide 10 מ&quot;מ, 25 מיקרוגרם / מ&quot;ל אינסולין, 30 ננומטר מיקרוגרם Na SEO 3 ו -50 / 2 מ&quot;ל transferrin עבור 2 דays עם התקשורת לשנות כל יום (יום 8 הימים 10). </li><li style=";text-align:right;direction:rtl"> אחרי 2 ימים בתקשורת ההתבגרות, שלב ההבשלה הסופית נעשית במקביל באמצעות תנאים שונים להשוואה. בידול הושרה בתנאים הבאים: (i) באמצעות חריץ מעכב DAPT (ii) באמצעות שיתוף תרבות מדיה בלבד, ללא בתאי האנדותל כמו מלאה (iii) באמצעות יצירת קשר ושיתוף עם התרבות תאים RHMVEC. תאים נשמרו בתקשורת DAPT או שיתוף תרבות במשך שבוע (יום 10 הימים 17) עם התקשורת לשנות כל יום. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> התקשורת DAPT הוכן על ידי השלמת אמצעי התקשורת ההתבגרות עם DAPT 30 מיקרומטר. תאים בקבוצות אלה נחשפו לראשונה להשלים MCDB131 למשך 24 שעות ולאחר מכן נחשף למדיה DAPT במשך 6 ימים (יום 11 יום 17). </li><li style=";text-align:right;direction:rtl"> שיתוף תרבות התקשורת הוכן על ידי השלמת MCDB-131 לתקשורת עם B27, 0.2% BSA, Nicotinamide 10 מ&quot;מ, 10 ng / ml EGF, 1 מיקרוגרם / הידרוקורטיזון מ&quot;ל, 10 מ&quot;ג EndoGro, 90 מיקרוגרם / מ&quot;ל ​​הפרין. למצב בקרת מדיה התאים המבדילים נחשפועד בינוני 131 MCDB המלא ל 24 שעות (יום 10 יום 11) לאחר מכן בתקשורת שונה שיתוף תרבות התקשורת במשך 6 ימים (יום 11 יום 17) (אין לתאי אנדותל). </li><li style=";text-align:right;direction:rtl"> למצב קשר שיתוף תרבות, 1000000 RHMVEC נוספה התאים המבדילים ב שלמים MCDB-131 המדיה (VEC טכנולוגיות) למשך 24 שעות (יום 10 יום 11) כדי לאפשר המצורף. לאחר 24 שעות מדיה שונה שיתוף תרבות התקשורת במשך 6 ימים (יום 11 הימים 17) עם התקשורת לשנות כל יום. </li></ol></li></ol> 5. qRT-PCR ניתוח <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בסוף כל שלב התמיינות (האנדודרם, אבי הלבלב, איון בוגרת) היו lysed ו-RNA הופק באמצעות NucleoSpin RNA ערכת החילוץ השנייה על פי הוראות היצרן. </li><li style=";text-align:right;direction:rtl"> RNA איכות נותח על ידי בדיקת ספיגת RNA ב 260 ננומטר ו -280 ננומטר, ואחריו כימות RNA באמצעות SmartSpec פלוס ספקטרופוטומטר. </li><li style=";text-align:right;direction:rtl"> שעתוק לאחור בוצעה באמצעות ImProm K II שעתוק לאחורזאת על פי הוראות היצרן. כל התגובות בוצעו עם ng 100 של RNA. </li><li style=";text-align:right;direction:rtl"> qRT-PCR בוצעה באמצעות QPCR Mx3005P המערכת (Agilent) ומבריק II SYBR ירוק תערובת QPCR מאסטר פי הוראות היצרן. פריימרים המשמשים מפורטים על השולחן 1. צעד האתחול בוצע על 50 מעלות צלזיוס במשך 2 דקות ואחריה 95 מעלות צלזיוס במשך 10 דקות. 50 מחזורים הגברה בוצעו באופן הבא: 95 מעלות צלזיוס למשך 30 שניות, 54 ° C למשך 30 שניות ו 72 מעלות צלזיוס למשך דקה 1. </li><li style=";text-align:right;direction:rtl"> שינוי פולד ביטוי mRNA היעד על תאים שלא עברו התמיינות חושב מערכי ה-CT בעזרת הנוסחאות הבאות: ΔCT (דה מרקר i) = CT (דה מרקר אני) - CT (GAPDH) Δ ΔCT (סמן i) = ΔCT (דה מרקר אני) (לדוגמה) - ΔCT (דה מרקר אני) (תאים שלא עברו התמיינות) הביטוי יחסית (דה מרקר i) = 2-ΔΔCT(סמן ט) </li></ol> 6. Immunocytochemistry <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> בסוף כל שלב התמיינות (האנדודרם, אבי הלבלב, איון בוגרת) התאים תוקנו בפורמלין 4% למשך 15 דקות בטמפרטורת החדר. </li><li style=";text-align:right;direction:rtl"> תאים קבוע היו permeabilized באמצעות 0.25% טריטון X-100 (TX) במשך 15 דקות. </li><li style=";text-align:right;direction:rtl"> הלא ספציפית מכתים נחסמה על ידי הדגירה בסרום חמור של 10% .05% TX במשך 30 דקות. </li><li style=";text-align:right;direction:rtl"> הדגירה הנוגדן העיקרי בוצע במשך הלילה על 4 מעלות צלזיוס חסימת חיץ בדילול נוגדנים המומלצת (ראה טבלה 1). </li><li style=";text-align:right;direction:rtl"> תאים נשטפו עם 0.05% טקסס שלוש פעמים במשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> הדגירה נוגדנים משני בוצעה שעה אחת בטמפרטורת החדר בחושך עם נוגדנים מתאימים בדילול בחסימת המאגר. </li><li style=";text-align:right;direction:rtl"> תאים נשטפו עם 0.05% טקסס שלוש פעמים במשך 5 דקות. </li><li style=";text-align:right;direction:rtl"> מכתים גרעינית נערך על ידי הדגירה Hoescht עם כתם על דילול 1:1000 ב PBSבמשך 5 דקות ואחריו 3 שוטף עם PBS. </li><li style=";text-align:right;direction:rtl"> תאים קבוע ומוכתמת היו צילמו באמצעות מיקרוסקופ אולימפוס IX81 הפוך ותוכנה Metamorph הדמיה. </li></ol> 7. נציג תוצאות תוספת של Activin ו Wortmannin כדי hESC מובחן במשך 4 ימים גורם האנדודרם סופי כמו אושר על ידי ניתוח qRT-PCR עבור סמנים דה Sox17, CXCR4 ו Foxa2 ו immunostaining עבור Sox17 כפי שמודגם באיור 2. התמיינות לתאי אבות הלבלב לאחר תוספת של חומצה cyclopamine ו retinoic אושרה על ידי qRT-PCR של אב סמנים הלבלב ו Immunostaining עבור Pdx1 כפי שמודגם באיור 3. בשלב הסופי של בידול, פנה שיתוף תרבות עם תאים RHMVEC המושרה מאוד upregulation הביטוי אינסולין hESC את התאים שמקורם בלבלב אב. היעילות של בידול שיתוף תרבות בתיווך נותח על ידי שיתוףmparing עם מצב שליטה באמצעות DAPT. DAPT שימש פקד חיובי שכן הוא נמצא כעת באחת השיטות בשימוש נרחב ביותר להשגת ההתבגרות הלבלב. מאז שיתוף תרבות בוצעה מדיה שונה בתוספת גורמים תומכים בתאי אנדותל, שליטה נוספת בוצעה עם התקשורת על העדר בתאי האנדותל כדי לאמת את ההשפעה של התקשורת על בידול. פרטים של ניתוח זה מוצגים באיור 4. <img alt="באיור 1." src="/files/ftp_upload/3759/3759fig1.jpg" /> באיור 1. רב שלבית פרוטוקול התמיינות לתאים hESC אינסולין המבטאים. <img alt="איור 2." src="/files/ftp_upload/3759/3759fig2.jpg" /> איור 2. אינדוקציה האנדודרם מכריע של בתאי גזע עובריים אנושיים. א) qRT-PCR ניתוח של סמנים נציג דה hESC תאים שנחשפו Activin ו Wortmannin למשך 4 ימים. תוצאות ar<html> דואר מנורמל ביחס hESC מובחן. ב) Sox17 מכתים (ירוק) ו DAPI (כחול) הצג ביטוי הגרעין של Sox17. סרגל קנה מידה: 50 מיקרומטר. <img alt="איור 3." src="/files/ftp_upload/3759/3759fig3.jpg" /> 3. איור הלבלב אבי אינדוקציה של תא גזע עוברי נגזר תאים האנדודרם. א) qRT-PCR ניתוח של סמנים מוקדמים הלבלב שמקורם בתאי hESC האנדודרם שנחשפו חומצה cyclopamine ו retinoic במשך 4 ימים לאחר הגיוס DE. תוצאות מנורמל ביחס hESC מובחן. ב) Pdx1 מכתים (סגול) ו DAPI (כחול) מראים ביטוי של Pdx1 גרעינית. סרגל קנה מידה: 50 מיקרומטר. &quot;&gt; <img alt="באיור 4." src="/files/ftp_upload/3759/3759fig4.jpg" /> איור 4. התבגרות בשלב הלבלב) qRT-PCR ניתוח של הורמוני הלבלב ב hESC לאחר ההבשלה הלבלב באמצעות DAPT, פנה לתקשורת ושיתוף תרבות או תרבות משותפת (שליטה). תוצאות מנורמל ביחס hESC מובחן. עמ &#39;ערכים מתקבל על ידי התלמיד מבחן t. ב) משותף עם התרבות דיל-AC-LDL RHMVEC שכותרתו (האדום) הצג באזורים בהם ECS לצרף צלחת אם יש חללים ריקים (למעלה), RHMVEC השני ניתן למצוא קשר ישיר עם ESC הבחנה (למטה). ג) C-peptide (ירוק) מכתים עבור תאים המבדילות באמצעות שיתוף תרבות השיטה. סרגל קנה מידה: 12.5 מיקרומטר (למעלה) ו -50 מיקרומטר (למטה) D) Immunostaining של RHMVEC מדגים שום ביטוי אינסולין RHMVEC. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> סמן </td><td> Primer1 (5 &#39;ל 3&#39;) &lt;/ Td&gt; <td> Primer2 (5 &#39;ל 3&#39;) </td><td> Ref </td></tr><tr><td> SOX17 </td><td> CTCTGCCTCCTCCACGAA </td><td> CAGAATCCAGACCTGCACAA </td><td> 12 </td></tr><tr><td> CXCR4 </td><td> CACCGCATCTGGAGAACCA </td><td> GCCCATTTCCTCGGTGTAGTT </td><td> 4 </td></tr><tr><td> FOXA2 </td><td> GGAGCGGTGAAGATGGAA </td><td> TACGTGTTCATGCCGTTCAT </td><td> 12 </td></tr><tr><td> PDX1 </td><td> AAGTCTACCAAAGCTCACGCG </td><td> GTAGGCGCCGCCTGC </td><td> 4 </td></tr><tr><td> PTF1 </td><td> CATAGAGAACGAAACCACCCTTTGAG </td><td> GCACGGAGTTTCCTGGACAGAGTTC </td><td> 12 </td></tr><tr><td> HLXB9 </td><td> CACCGCGGGCATGATC </td><td> ACTTCCCCAGGAGGTTCGA </td><td> 4 </td></tr><tr><td> HNF6 </td><td> TGTGGAAGTGGCTGCAGGA </td><td> TGTGAAGACCAACCTGGGCT </td><td> 5 </td></tr><tr><td> PAX6 </td><td> CGAATTCTGCAGGTGTCCAA </td><td> ACAGACCCCCTCGGACAGTAAT </td><td> 5 </td></tr><tr><td> NKX6.1 </td><td> AGACCCACTTTTTCCGGACA </td><td> CCAACGAATAGGCCAAACGA </td><td> 5 </td></tr><tr><td> ISL1 </td><td> GATCTATGTCACCTCGCAAGG </td><td> TACAACCACCATTTCACTG </td><td> 12 </td></tr><tr><td> גלוקגון </td><td> AGGCAGACCCACTCAGTGA </td><td> AACAATGGCGACCTCTTCTG </td><td> 4 </td></tr><tr><td> אינסולין </td><td> AAGAGGCCATCAAGCAGATCA </td><td> CAGGAGGCGCATCCACA </td><td> 12 </td></tr></tbody></table> Primers לוח 1. המשמש תגובות QPCR.

<ol>
	<li>De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Les+cellules+souches+embryonnaires+humaines+:+de+la+transgression+de+l'embryon+humain+&#225;+la+m&#233;decine+r&#233;g&#233;n&#233;ratrice+de+demain.">Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain &#225; la m&#233;decine r&#233;g&#233;n&#233;ratrice de demain.</a> Gyn&#233;cologie Obst&#233;trique &#38; Fertilit&#233;. 37, 620-626 (2009).</li><li>Murtaugh, L. C., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes,+Signals,+and+Lineages+in+Pancreas+Development.">Genes, Signals, and Lineages in Pancreas Development.</a> Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).</li><li>Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+definitive+endoderm+from+embryonic+stem+cells+in+culture.">Development of definitive endoderm from embryonic stem cells in culture.</a> Development. 131, 1651-1662 (2004).</li><li>D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+pancreatic+hormone-expressing+endocrine+cells+from+human+embryonic+stem+cells.">Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells.</a> Nat. Biotech. 24, 1392-1401 (2006).</li><li>Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+differentiation+of+human+ES+cells+and+iPS+cells+into+mature+pancreatic+insulin-producing+cells.">Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells.</a> Cell Res. 19, 429-438 (2009).</li><li>Basma, H., Soto-Guti&#233;rrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+and+Transplantation+of+Human+Embryonic+Stem+Cell-Derived+Hepatocytes.">Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes.</a> Gastroenterology. 136, 990-999 (2009).</li><li>Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -. P., Chipperfield, H., Tan, E. -. K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+Differentiation+of+Human+Embryonic+Stem+Cells+into+the+Pancreatic+Endocrine+Lineage.">Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage.</a> Stem Cells and Development. 16, 561-578 (2007).</li><li>Kim, S. K., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreas+development+is+promoted+by+cyclopamine,+a+Hedgehog+signaling+inhibitor.">Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor.</a> Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).</li><li>Docherty, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Growth+and+development+of+the+islets+of+Langerhans:+implications+for+the+treatment+of+diabetes+mellitus.">Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus.</a> Current Opinion in Pharmacology. 1, 641-649 (2001).</li><li>Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., F&#228;ssler, R., Gu, G., Gerber, H. -. P., Ferrara, N., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Vascular+Basement+Membrane:+A+Niche+for+Insulin+Gene+Expression+and+[beta]&gt;+Cell+Proliferation.">The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]&gt; Cell Proliferation.</a> Developmental Cell. 10, 397-405 (2006).</li><li>Yoshitomi, H., Zaret, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endothelial+cell+interactions+initiate+dorsal+pancreas+development+by+selectively+inducing+the+transcription+factor+Ptf1a.">Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a.</a> Development. 131, 807-817 (2004).</li><li>Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marked+differences+in+differentiation+propensity+among+human+embryonic+stem+cell+lines.">Marked differences in differentiation propensity among human embryonic stem cell lines.</a> Nat. Biotech. 26, 313-315 (2008).</li><li>Banerjee, I., Sharma, N., Yarmush, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+co-culture+on+pancreatic+differentiation+of+embryonic+stem+cells.">Impact of co-culture on pancreatic differentiation of embryonic stem cells.</a> J. Tissue Eng. Regen. Med. 5, 313-323 (2010).</li></ol>

אין לנו מה למסור.

במהלך התפתחות הלבלב, תאים בלבלב המבדילים נמצאים בסמיכות עם לתאי אנדותל של אבי העורקים, יתר על כן, איים הלבלב הם בצפיפות vascularized לקדם חילופי מהירה של רמת הסוכר בדם והורמונים איון. לאור עובדות אלה, אין זה מפתיע כי תאי אנדותל למלא תפקיד חשוב בתהליך של organogenesis הלבלב. למרות ה...

<table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td> שם מגיב </td><td> חברה </td><td> מספר קטלוגי </td><td> ריכוזים </td></tr><tr><td> mTeSR1 (עם תוספת) </td><td> גזע התא טכנולוגיות </td><td> 5850 </td><td></td></tr><tr><td> hESC מוסמך matrigel </td><td> BD Biosciences </td><td> 354277 </td><td></td></tr><tr><td> DMEM: F12 </td><td> Invitrogen </td><td> 11330-032 </td><td></td></tr><tr><td> MCDB-131 </td><td> Invitrogen </td><td> 10372019 </td><td></td></tr><tr><td> MCDB-131 (השלם) </td><td> VEC טכנולוגיות </td><td> MCDB-131 </td><td></td></tr><tr><td> B27 מוסף </td><td> Invitrogen </td><td> 17504044 </td><td></td></tr><tr><td> Activin </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/338-ac.pdf">338-AC</a> </td><td> 100ng/ml </td></tr><tr><td> Wortmannin </td><td> Invitrogen </td><td> W3144 </td><td> 1μM </td></tr><tr><td> KAAD-Cyclopamie </td><td> Sigma-Aldrich </td><td> C4116 </td><td> 0.2μM </td></tr><tr><td> כל טרנס retinoic חומצה </td><td> Sigma-Aldrich </td><td> R2625 </td><td> 2μM </td></tr><tr><td> DAPT </td><td> Sigma-Aldrich </td><td> D5942 </td><td> 30μM </td></tr><tr><td> Nicotinamide </td><td> Sigma-Aldrich </td><td> N0636 </td><td> 10 mM </td></tr><tr><td> נתרן סלניום </td><td> Sigma-Aldrich </td><td> S5261 </td><td> 30 ננומטר </td></tr><tr><td> אינסולין </td><td> Sigma-Aldrich </td><td> I1882 </td><td> 25 מיקרוגרם / מ&quot;ל </td></tr><tr><td> Transferrin </td><td> Sigma-Aldrich </td><td> T8158 </td><td> 50 מיקרוגרם / מ&quot;ל </td></tr><tr><td> EGF </td><td> R &amp; D </td><td> <a href="http://www.rndsystems.com/pdf/236-eg.pdf">236-EG</a> </td><td> 10ng/ml </td></tr><tr><td> EndoGro </td><td> VEC טכנולוגיות </td><td> ENDOGRO </td><td> 10 מ&quot;ג </td></tr><tr><td> הפרין </td><td> Sigma-Aldrich </td><td> H3149 </td><td> 90μg/ml </td></tr><tr><td> הידרוקורטיזון </td><td> Sigma-Aldrich </td><td> H0888 </td><td> 1μg/ml </td></tr><tr><td> NucleoSpin RNA II </td><td> Macherey נגל </td><td> 740955 </td><td></td></tr><tr><td> ImProm שעתוק II הפוכה מערכת </td><td> Promega </td><td> A3800 </td><td></td></tr><tr><td> מבריק II SYBR גרין QPCR מאסטר מיקס </td><td> Straragene </td><td> 600548 </td><td></td></tr><tr><td> Sox17 עז IgG polyclonal </td><td> סנטה קרוז </td><td> SC-17355 </td><td> 1/500 </td></tr><tr><td> PDX1 עז polyclonal IgG </td><td> סנטה קרוז </td><td> SC-14662 </td><td> 1/500 </td></tr><tr><td> C-peptide polyclonal הארנב </td><td> התא איתות </td><td> 4593 </td><td> 1/500 </td></tr><tr><td> Alexa פלואוריד 488 נגד ארנב החמור IgG </td><td> Invitrogen </td><td> A-21206 </td><td> 1/1000 </td></tr><tr><td> Alexa פלואוריד 647 חמור נגד עז IgG </td><td> Invitrogen </td><td> A-21447 </td><td> 1/1000 </td></tr></tbody></table> טבלה 2. ריאגנטים וערכות.

endothelial cell co-culture mediates maturation of human embryonic stem cell to pancreatic insulin producing cells in a directed differentiation approach

לתאי גזע עובריים (ESC) יש שני מאפיינים עיקריים: הם יכולים להיות מופצים ללא הגבלת זמן במבחנה במצב מובחן והם pluripotent, ובכך שיש פוטנציאל להתמיין שושלות רבות. מאפיינים אלה להפוך ESCs אטרקטיבי ביותר עבור טיפול בתאי מבוסס, במהלך טיפולים משובי 1. עם זאת עבור מלוא הפוטנציאל שלו להתממש התאים צריך להיות מובחן לתוך פנוטיפים בוגרים ופונקציונלי, שהוא משימה מרתיעה. גישה מבטיחה בגרימת התמיינות הוא לעקוב מקרוב לחקות את דרך organogenesis בסביבה חוץ גופית ב. התפתחות הלבלב ידוע להתרחש בשלבים מסוימים 2, החל האנדודרם, אשר יכול להתפתח לאיברים שונים, לרבות הכבד והלבלב. אינדוקציה האנדודרם ניתן להשיג על ידי אפנון של מסלול קטרי באמצעות תוספת של Activin 3 בשילוב עם גורמי גידול מספר 4-7 </sup&gt;. תאים האנדודרם מוחלטות ואז לעבור המחויבות הלבלב על ידי עיכוב של עיכוב קיפוד קולי, אשר יכולה להיות מושגת במבחנה על ידי תוספת של cyclopamine 8. התבגרות הלבלב מתווך על ידי אירועים מקבילים מספר כולל עיכוב של חריץ איתות, מצטבר של אבות הלבלב לתוך 3-dimentional אשכולות: אינדוקציה של כלי הדם, עד כמה שם. ללא ספק המצליחה ביותר הבשלה חוץ גופית של חברתיות ותרבותיות ובתאים הנגזרות הלבלב הושגו באמצעות עיכוב ברמה הגבוהה מאותתת על ידי תוספת DAPT 9. אמנם מוצלח, הדבר גורם התשואה הנמוכה של הפנוטיפ בוגרת עם פונקציונליות מופחתת. אזור למד פחות היא ההשפעה של תא האנדותל איתות ההתבגרות הלבלב, אשר יותר ויותר מוערך כגורם תורם חשוב ההתבגרות in-vivo הלבלב איון 10,11. המחקר הנוכחי בוחן אפקט כזה של endothelתא ial איתות ההבשלה של האדם חברתיות ותרבותיות ובתאים הנגזרות הלבלב לייצר אינסולין תוך איון דמויי תאים. אנו מדווחים על פרוטוקול רב שלבית בידול מכוון שבו ESCs האדם הנגרמת על ידי 1 Activin יחד עם עיכוב של מסלול PI3K כלפי האנדודרם. מפרט הלבלב של תאים האנדודרם מושגת על ידי עיכוב של סוניק הקיפוד איתות ידי Cyclopamine יחד עם אינדוקציה retinoid על ידי תוספת של החומצה הרטינואית. השלב האחרון של ההתבגרות הוא המושרה על ידי איתות תא האנדותל מושגת על ידי תצורת שיתוף תרבות. בעוד בתאי האנדותל כמה נבדקו בתרבות משותפת, כאן אנו מציגים הנתונים שלנו בלב החולדה תאים אנדותל כלי הדם (RHMVEC), בעיקר על מנת להקל על ניתוח.

Watch this Scientific Journal Video about Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach at J

Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

המחקר הנוכחי מתאר גישה בידול מכוון של גרימת הבחנה הלבלב של בתאי גזע עובריים אנושיים. חשיבות רבה היא מציאת תא האנדותל שיתוף תרבות מתווכת ההבשלה של תא גזע עובריים אנושיים נגזר אבות לתאי הלבלב אינסולין המבטאים.

תא האנדותל שיתוף תרבות מתווכת ההבשלה של עובריים אנושיים לתאי גזע לאינסולין בתאי לבלב הפקת בגישה הבחנה בימוי

Embryonic stem cells (ESC) have two main characteristics: they can be indefinitely propagated in vitro in an undifferentiated state and they are ...

endothelial-cell-co-culture-mediates-maturation-human-embryonic-stem

Research

JoVE Journal

Biology

16.2K Views.  University of Pittsburgh. המחקר הנוכחי מתאר גישה בידול מכוון של גרימת הבחנה הלבלב של בתאי גזע עובריים אנושיים. חשיבות רבה היא מציאת תא האנדותל שיתוף תרבות מתווכת ההבשלה של תא גזע עובריים אנושיים נגזר אבות לתאי הלבלב אינסולין המבטאים.

Video: Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach

Derivation of Hematopoietic Stem Cells from Murine Embryonic Stem Cells

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are derived from the blastocyst of the early embryo and are pluripotent in differentiative ability.  Their vast differentiative potential has made them the focus of much research centered on deducing how to coax them to generate clinically useful cell types.  The successful derivation of hematopoietic stem cells (HSC) from mouse ESC has recently been accomplished and can be visualized in this video protocol.  HSC, arguably the most clinically exploited cell population, are used to treat a myriad of hematopoietic malignancies and disorders.  However, many patients that might benefit from HSC therapy lack access to suitable donors.  ESC could provide an alternative source of HSC for these patients.  The following protocol establishes a baseline from which ESC-HSC can be studied and inform efforts to isolate HSC from human ESC.  In this protocol, ESC are differentiated as embryoid bodies (EBs) for 6 days in commercially available serum pre-screened for optimal hematopoietic differentiation.  EBs are then dissociated and infected with retroviral HoxB4.  Infected EB-derived cells are plated on OP9 stroma, a bone marrow stromal cell line derived from the calvaria of  M-CSF-/- mice, and co-cultured in the presence of hematopoiesis promoting cytokines for ten days.  During this co-culture, the infected cells expand greatly, resulting in the generation a heterogeneous pool of 100s of millions of cells.  These cells can then be used to rescue and reconstitute lethally irradiated mice.

This protocol details the derivation of transplantable hematopoietic stem cells from mouse embryonic stem cells (ESC) and their subsequent injection into lethally irradiated recipient mice. Briefly, ESC are differentiated as embryoid bodies, which are then infected with retroviral HoxB4 and co-cultured with OP9 stromal cells and hematopoietic cytokines.

גזירת בתאי גזע hematopoietic מ Murine בתאי גזע עובריים

A stem cell is defined as a cell with the capacity to both self-renew and generate multiple differentiated progeny.  Embryonic stem cells (ESC) are ...

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

גזירת בתאי גזע עובריים אנושיים על ידי Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Embryonic Stem Cell-Derived Endothelial Cells for Treatment of Hindlimb Ischemia

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This pathology causes symptoms such as intermittent claudication (pain with walking), painful ischemic ulcerations, or even limb-threatening gangrene. It is generally believed that the vascular endothelium, a monolayer of endothelial cells that invests the luminal surface of all blood and lymphatic vessels, plays a dominant role in vascular homeostasis and vascular regeneration. As a result, stem cell-based regeneration of the endothelium may be a promising approach for treating PAD.In this video, we demonstrate the transplantation of embryonic stem cell (ESC)-derived endothelial cells for treatment of unilateral hindimb ischemia as a model of PAD, followed by non-invasive tracking of cell homing and survival by bioluminescence imaging. The specific materials and procedures for cell delivery and imaging will be described. This protocol follows another publication in describing the induction of hindlimb ischemia by Niiyama et al.1

The surgical procedure for delivery of embryonic stem cell-derived endothelial cells to the ischemic hindlimb is demonstrated, with non-invasive tracking by bioluminescence imaging.

עובריים, נגזר גזע לתאי אנדותל לטיפול איסכמיה Hindlimb

Peripheral arterial disease (PAD) results from narrowing of the peripheral arteries that supply oxygenated blood and nutrients to the legs and feet, This ...

Isolation and Large Scale Expansion of Adult Human Endothelial Colony Forming Progenitor Cells

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult human peripheral blood within a mean of 12 days. After large scale expansion &gt;1x108 ECFCs can be obtained for further tests. Advantageously by using pHPL the contact of human cells with bovine serum antigens can be excluded. By flow cytometry and immunohistochemistry the isolated cells can be characterized as ECFC and their in vitro functionality to form vascular like structures can be tested in a matrigel assay. Further these cells can be subcutaneously injected in a mouse model to form functional, perfused vessels in vivo. After long term expansion and cryopreservation proliferation, function and genomic stability appear to be preserved. 3,4
This animal-protein free isolation and expansion method is easily applicable to generate a large quantity of ECFCs.

Endothelial colony forming progenitor cells (ECFCs) are a promising tool to study vascular homeostasis and repair.1,2 This paper introduces a novel animal-serum free method for isolation and expansion of ECFC from heparinised adult human peripheral blood with pooled human platelet lysate (pHPL) diminishing the risk of anti-bovine immunisation.

בידוד הרחבת בקנה מידה גדול של תאים אנושיים למבוגרים האנדותל המושבה יצירת אב

This paper introduces a novel recovery strategy for endothelial colony forming progenitor cells (ECFCs) from heparinized but otherwise unmanipulated adult ...

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells (MSCs) and Endothelial Colony Forming Progenitor Cells (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal stem cells, MSCs) and endothelial colony forming progenitor cells (ECFCs). Both cell types are key players in maintaining the integrity of tissue and are probably also involved in regenerative processes and tumor formation.
To study their biology and function in a comparative manner it is important to have both cells types available from the same donor. It may also be beneficial for regenerative purposes to derive MSCs and ECFCs from the same tissue.
Because cellular therapeutics should eventually find their way from bench to bedside we established a new method to isolate and further expand progenitor cells without the use of animal protein. Pooled human platelet lysate (pHPL) replaced fetal bovine serum in all steps of our protocol to completely avoid contact of the cells to xenogeneic proteins.
This video demonstrates a methodology for the isolation and expansion of progenitor cells from one umbilical cord.
All materials and procedures will be described.

Isolation and Animal Serum Free Expansion of Human Umbilical Cord Derived Mesenchymal Stromal Cells MSCs and Endothelial Colony Forming Progenitor Cells ECFCs

This protocol describes the isolation and subsequent expansion of mesenchymal stromal cells and endothelial colony forming cells without the use of animal serum to generate autologous pairs for experimental transplantation purposes.

בידוד בעלי חיים הרחבת חינם סרום של טבורי האדם נגזר תאים סטרומה mesenchymal (MSCs) ו האנדותל יצירת המושבה ובתאים (ECFCs)

The umbilical cord is a rich source for progenitor cells with high proliferative potential including mesenchymal stromal cells (also termed mesenchymal ...

Video Bioinformatics Analysis of Human Embryonic Stem Cell Colony Growth

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software.  Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT.  To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images.  To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time.  The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.  

Video bioinformatics is the automated processing, analysis, understanding, and data mining of biological spatio-temporal data extracted from microscopic videos. The purpose of this article is to demonstrate a method for measuring human embryonic stem cell colony growth using a video bioinformatics method.

וידאו ביואינפורמטיקה ניתוח גדילה אנושי בתאי גזע עובריים קולוני

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

התמיינות של תאים עובריים לתוך מבשרי Oligodendrocyte

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

הגורל מיפוי בתאי גזע עובריים אנושיים על ידי גיבוש תפלצת

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

גזירת יעיל של מבשרי לב cardiomyocytes האדם מן האדם תאים pluripotent גזע עובריים עם אינדוקציה מולקולה קטנה

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

תכנות מחדש האדם תאים סומטיים תוך המושרה בתאי גזע pluripotent (iPSCs) באמצעות וקטור retroviral עם GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...