Ce travail a été soutenu par les Instituts nationaux de la santé (NIH) Subventions CA127231 et la Fondation Damon Runyon Clinical Investigator Award (CI 1502) (SM). Nous tenons à remercier le professeur Zdenek Dvorak de Palacky University Olomouc, République tchèque pour ses renseignements utiles sur la portabilité discuter de cette technique à leur institution et standardisation du protocole.

Une. Construction de PXR et SRC-1 Fusions dans les vecteurs de levure <ol><li> Amplification par PCR de l&#39;homme PXR LBD (107-434 acides aminés) et Human SRC-1 pleine longueur (1-1401 acides aminés). <ol><li> Utilisez pSG5-hPXR plasmide 8 comme PXR LBD modèle, utilisez plasmide pCMX-SRC1 que SRC-1 modèles. </li><li> SuperMix PCR dégel, des matrices d&#39;ADN et des amorces (voir Matériaux), gardez-les sur de la glace. </li><li> Ajouter 0,25 pg / pl matrice d&#39;ADN 1 pi, 10 mM paires d&#39;amorces 2 pi chacun, SuperMix PCR 45 pi et ajouter H 2 O pour porter le volume total à 50 pi. </li><li> Set PCR à un cycle de 94 ° C pendant 2 min, 20 cycles de 94 ° C pendant 30 s, 55 ° C pendant 30 sec et 72 ° C pendant 2 min, puis un cycle de 72 ° C pendant 10 minutes pour l&#39;extension. Voir les produits de PCR en exécutant sur gel d&#39;agarose à 1%. </li></ol></li><li> Les produits de PCR clonage dans des vecteurs Y2H. <ol><li> Purifier les produits de PCR à partir de gel d&#39;agarose à 1%. Digest PXR, LBD, PCR, et Y2H vecteur PSH2-1 avecBamHI et Sali; digérer SRC-1 PCR et Y2H vecteur pGADNOT avec NotΙ et SalΙ. Pour ce faire, ajouter 1 pg d&#39;ADN, 3 ul de tampon de réaction 10 x, 1 ul d&#39;enzymes de restriction et finalement H 2 O pour amener le volume total à 30 ul. </li><li> Placer les échantillons dans de digestion à 37 ° C bain d&#39;eau pendant 1 heure. Vérifier la digestion en exécutant sur gel d&#39;agarose à 1%. </li><li> Purifier les échantillons de digestion de gel d&#39;agarose à 1%, ligaturer digéré les produits de PCR et des vecteurs Y2H et à transformer des cellules compétentes DH5a. </li><li> Choisissez les colonies et isoler l&#39;ADN plasmidique. </li></ol></li><li> Identifier l&#39;ADN plasmidique PSH2-1-PXR par BamHI / Sall digestion, identifier pGADNOT-SRC-1 ADN plasmidique par Notl / Sall digestion. Vérifiez tout l&#39;ADN plasmidique positif par séquençage. </li></ol> 2. Yeast Two-hybrid dosages <ol><li> Inoculer la souche de levure dans 5 ml YPAD et incuber pendant une nuit par une agitation constante (220 rpm à 30 ° C). Remarque: La souche Saccharomyces cerevisiae était CTY10-5d(MAT une ade2 trp 1-901 leu2-3, 112 his3-200 ga l4 - GAL80 - URA3 :: lexA-lacZ) qui contient un gène intégré GAL1-lacZ avec lexA opérateur 10. Pour obtenir des cellules de levure viables résistantes au kétoconazole, mais ceux qui ne portent pas des altérations de transporteur en tant que cause de la résistance azole 18 à 20, de nouvelles souches de levure CTY10-5d ont été obtenus selon la première erg 3 de suppression (erg 3 de Δ) et en introduisant ensuite la suppression supplémentaire en ERG11 (erg 3 Δ / erg11 Δ) gènes par recombinaison homologue. Les détails de construction ont été décrits dans un manuscrit déjà publié 6. </li><li> Le lendemain (le matin), ensemencer la levure (01h20) dans 5 ml YAPD et incuber à obtenir une DO 600 ~ 0,2 par agitation constante (220 rpm à 30 ° C). </li><li> Sédimenter les cellules à 2.000 tours par minute dans une microcentrifugeuse pendant 2 minutes et éliminer le surnageant. Laver ensuite la pellet deux fois avec de l&#39;eau autoclave et une fois avec 0,1 M LiAc. </li><li> Après le dernier lavage, éliminer le surnageant et ajouter les réactifs suivants au culot cellulaire: 240 ul de PEG 3500 à 50% p / v, 36 pi de 1 M de LiAc, 50 pi de 2 mg / ml de bouillie ADNsb de sperme de saumon, H 2 O 34 ul. Vortex à mélanger, ajouter 1 pg PSH-PXR et 1 pg pGADNOT-SRC-1 ADN et mélanger. </li><li> Transférer le mélange de polystyrène tube rond-bas, agiter la transformation, mélanger (220 rpm à 30 ° C) pendant 30 min. Déplacer le tube à 42 ° C bain d&#39;eau et incuber pendant 30 min supplémentaires. </li><li> Centrifuger le tube à 2000 tours par minute pendant 2 min et éliminer le surnageant. Laver culot fois à l&#39;eau autoclave. </li><li> Ajouter 100 pi d&#39;eau stérile dans le tube, remettre en suspension les cellules par le doigt doux tapant et pipetage, puis la plaque sur des plaques de -His/-Leu Dropout moyen (Formulation par litre -His/-Leu Dropout moyen: 20 g de dextrose, YNB 1,7 g, 0,67 g CSM-His/-Leu, 5 g de sulfate d&#39;ammonium, 1,5% de gélose) et incUbate à 30 ° C pendant 3-4 jours pour isoler les transformants. </li></ol> 3. X-gal Filtre Assay <ol><li> Couper une membrane de nitrocellulose à la taille d&#39;une partie de boîte de Pétri. Étiqueter la membrane de nitrocellulose pour marquer l&#39;orientation. </li><li> Placer une membrane de nitrocellulose de rupture en colonies de levure, de s&#39;assurer que la membrane est en contact avec la surface du support de plaque. </li><li> Retirer la membrane, le placer côté colonie vers le haut sur un papier filtre de 3 mm, et placer la membrane et le papier-filtre à -80 ° C pendant 15 min. </li><li> Préparer une solution X-gal. Ajouter 50 ul de 20 mg / ml de X-gal et 15 ul de β-mercaptoéthanol à 5 ml de tampon Z (1 L de tampon contient 16,1 g de Na 2 HPO 4, 7H 2 O, 5,5 g de NaH 2 PO 4 H 2 O, 0,75 g KCl, 0,25 g MgSO 4 7H 2 O •). Si Z tampon a été maintenu à 4 ° C, l&#39;amener à la température ambiante avant l&#39;addition de ces réactifs. </li><li> Placer deux cercles de papier filtre de 3 mmdans une boîte de Pétri et les faire tremper avec 5 ml de solution X-gal. Drainer l&#39;excès de tampon à partir de la boîte de Pétri et placer la membrane de nitrocellulose avec la colonie côté vers le haut. </li><li> Fermez le couvercle, s&#39;assurer que la membrane est en contact avec le papier filtre et il est complètement humide. Enveloppez la boîte de Petri dans une feuille et incuber à 37 ° C pendant 30 min à la nuit. </li></ol> 4. Liquide β-gal Assay <ol><li> Cultivez levure dans un milieu liquide -His/-Leu Dropout à DO 600 de 0,7. </li><li> Transférer 1 ml de milieu dans un tube de 1,5 ml et centrifuger à 3000 rpm pendant 2 min. Jeter le surnageant. </li><li> Ajouter 1 ml de tampon Z à remettre le culot, centrifuger à 3000 rpm à nouveau pendant 2 min. Jeter le surnageant. </li><li> Ajouter 150 ul de tampon Z avec 2ME pour remettre en suspension le culot cellulaire, mélanger puis ajouter 50 ul de chloroforme et 20 pi de 0,1% de SDS. Vigoureusement vortex l&#39;échantillon pendant 15 secondes. </li><li> Ajouter 700 ul de solution ONPG (1 mg / ml dans Z buffer). Réglez la minuterie, incuber à 30 ° C assez longtemps pour permettre à la couleur jaune de développer et de noter le temps de réaction total. </li><li> Ajouter 500 ul de 1 M de Na 2 CO 3 pour arrêter la réaction et déterminer l&#39;absorbance à 420 nm. Le flan est une solution de 700 ul d&#39;ONPG plus 500 ul de 1 M de Na 2 CO 3. </li></ol> Calculer unités Miller comme suit: Miller Unités = (A420 * 1000) / (A600 * min * ml) A420: unités d&#39;absorbance à 420 nanomètres; A600: unités d&#39;absorbance à 600 nanomètres; min: le temps de réaction en minutes; ml: le volume en ml de la réaction

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

Aucun conflit d&#39;intérêt déclaré.

Dans notre analyse de Y2H modifié, nous avons identifié des résidus importants pour les interactions de kétoconazole sur PXR 6. Etant donné que SRC-1 est un co-activateur (et a été clone dans le vecteur d&#39;pGADNot), nous avons également testé si SRC-1 pouvait activer l&#39;expression de lacZ lorsque clone dans le système de vecteur PSH et si cela modifie le profil d&#39;activation et / ou affecter la perméabilité de la levure de dosage à deux hybrides. Grâce à nos plasmides redessinés nous ...

La levure double hybride (Y2H) test est largement utilisé pour découvrir des interactions protéine-protéine et, plus récemment, à la découverte de nouvelles petites molécules qui perturbent les complexes protéine-protéine interaction 7, 8, 9, 10, 11. Cependant, les approches conventionnelles de ce test, utilisé pour la découverte de médicaments ou &quot;hits&quot;, ne permettent pas la détection de résidus d&#39;interaction allostériques de composés chimiques dans les surfaces protéine-protéine, que s&#39;il est modifié encore interagir et de permettre l&#39;interrogatoire des résidus modifiés 11 . En effet, un tel procédé (s), si possible de développer, permettrait un système de levure docile pour l&#39;évaluation à haut débit de résidus d&#39;interaction allostériques critiques pour interaction protéine-protéine perturbation. Dans le cadre de la découverte de médicaments, la façon la plus directe d&#39;établir une interaction des composés avec des protéines impliquerait détermination de la structure (par exemple la cristallisation de la protéine complexe inhibiteur). Ces méthodes sont cumbersome, utiliser les ressources élaborées et il n&#39;est pas techniquement possible de réaliser des études structurelles sur chaque protéine. Systèmes de dépistage génétique de la drogue tractables ont été établis dans des bactéries 1, 2 et d&#39;autres systèmes modèles comme mammifère double-hybride. Cependant, ces systèmes doivent optimisation et les systèmes alternatifs comme Y2H sont toujours les plus testés dans la découverte de médicaments. Il ya des limites qui comprennent une faible sensibilité et la fiabilité des interactions à l&#39;aide de méthodes singulières 13, cependant, un essai de Y2H unique peut être modifié pour répondre à des questions spécifiques concernant les résidus d&#39;interaction. Dans le domaine de la recherche sur le récepteur nucléaire, Y2H a été utilisé pour définir des protéines qui interagissent 14, cependant, ces interactions protéiques ont rarement été utilisé pour définir la nature, dans lequel les ligands / antagonistes interagissent avec des complexes récepteur-protéine nucléaire. Ainsi, notre laboratoire a concentré ses efforts sur la définition d&#39;une méthode, en particulier pour les protéines réceptrices qui ne sont pasprête facilement à des méthodes basées protéomique, ce serait déterrer nouveau ligand / antagoniste interaction résidus en utilisant un Y2H à base plate-forme de découverte inversée. Sur la base de notre conclusion précédente selon laquelle le kétoconazole perturbe PXR et son activateur SRC-1, nous avons développé un nouveau système de Y2H inverse qui nous permettent de définir interroger et résidus de kétoconazole interagir sur PXR 6. Notre procédé est basé sur les propriétés de la protéine GAL4 de levure qui se compose de domaines séparables responsables de l&#39;activation de la liaison à l&#39;ADN et la transcription. La protéine PXR LBD est exprimé comme une fusion au domaine LexA liaison à l&#39;ADN (DNA-BD), tandis que la longueur des co-activateurs pleins SRC-1 (coactivateurs de récepteur de stéroïde 1) les protéines sont exprimées sous forme de fusions au domaine d&#39;activation de GAL4 (AD ). L&#39;interaction entre PXR et SRC-1 des protéines de fusion conduit à l&#39;activation de la transcription GAL4 de sites de liaison contenant gène rapporteur Lac Z-β qui est intégré dans le génome de la levuree. Le kétoconazole, un antagoniste PXR, perturbe PXR et SRC-1 interaction 15, 16, 17 et on peut détecter l&#39;interaction de PXR et SRC-1 en présence ou en l&#39;absence de kétoconazole après coloration des colonies sur des filtres pour l&#39;activité X-gal. Le principe de Y2H est illustré sur la figure 1 et la procédure expérimentale est résumée sur la figure 2.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

En tant que régulateur essentiel du métabolisme des médicaments et de l&#39;inflammation, Pregnane X Receptor (PXR), joue un rôle important dans la physiopathologie de la maladie reliant le métabolisme et l&#39;inflammation (par exemple, de la stéatose hépatique) 1,2. Il a eu beaucoup de progrès dans l&#39;identification des ligands agonistes pour PXR, cependant, il ya des descriptions limitées des antagonistes de la drogue comme et leurs sites de liaison sur PXR 3,4,5. Un obstacle majeur a été l&#39;incapacité à purifier efficacement la protéine de longueur totale pour des études structurales avec des antagonistes malgré le fait que PXR a été clonée et caractérisée en 1998. Notre laboratoire a développé une nouvelle levure à haut débit à base de dosage à deux hybrides de définir un antagoniste, le kétoconazole de résidus de liaison sur PXR 6. Notre méthode consiste à créer des bibliothèques de mutation qui sauver l&#39;effet des mutations simples sur la surface AF-2 de PXR prévu pour interagir avec le kétoconazole. Sauvetage ou «gain de fonction» second mutations peuvent être effectuées de telle sorte que des conclusions en ce qui concerne l&#39;interaction génétique du kétoconazole et le résidu (s) de surface sur PXR sont réalisables. Ainsi, nous avons développé un haut débit écran de deux hybrides de levure de mutants PXR interagissant avec son coactivateur SRC-1. En utilisant cette approche, dans laquelle la levure a été modifié pour tenir compte de l&#39;étude de la drogue antifongique, le kétoconazole, nous avons pu démontrer mutations spécifiques sur PXR enrichies en clones incapables de se lier au kétoconazole. Par la logique inverse, nous concluons que les résidus d&#39;origine sont des résidus d&#39;interaction directe avec le kétoconazole. Ce test représente un roman, essai génétique docile à l&#39;écran pour les sites de liaison antagonistes sur les surfaces des récepteurs nucléaires. Cet essai peut être appliqué à n&#39;importe quel médicament, indépendamment de son potentiel cytotoxique de la levure ainsi que de la protéine cellulaire (s) qui ne peut être étudiée en utilisant la biologie structurale standard ou les méthodes à base de protéomiques. Pièges potentiels incluent l&#39;interprétation de données (méthodes complémentaires utiles), reliment sur la méthode unique de Y2H, expertise dans le traitement de levure ou d&#39;effectuer des essais levure à deux hybrides, et l&#39;optimisation des essais.

Nous avons effectué un test pour voir si nous pouvions détecter une lecture colorimétrique de l&#39;association de PXR et récepteur des stéroïdes coactivateur-1 (SRC-1). Etant donné que la levure a une production importante de stérol, il a été montré précédemment que l&#39;expression de lacZ dans la levure peut être induite sans la nécessité d&#39;un ligand exogène supplémentaire. Nous avons trouvé que l&#39;expression de lacZ (colonies bleues) est également induite dans la souche de levure transform...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Kétoconazole se lie à et antagonise Pregnane X Receptor (RPX) activation. Levure haute écrans de débit de mutants PXR définissent une région unique pour la liaison kétoconazole. Cette méthode génétique à base de levure découvre interactions avec les récepteurs nucléaires de nouveaux avec des ligands qui s&#39;associent avec les sites de liaison surface.

Inverser levure système à deux hybrides pour identifier les mammifères Nuclear Receptor résidus qui interagissent avec des ligands et / ou antagonistes

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

reverse-yeast-two-hybrid-system-to-identify-mammalian-nuclear

Research

JoVE Journal

Biology

12.7K vues.  Albert Einstein College of Medicine.  Kétoconazole se lie à et antagonise Pregnane X Receptor (RPX) activation. Levure haute écrans de débit de mutants PXR définissent une région unique pour la liaison kétoconazole. Cette méthode génétique à base de levure découvre interactions avec les récepteurs nucléaires de nouveaux avec des ligands qui s'associent avec les sites de liaison surface. 

Vidéo: Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys loop, the glutamate-gated and the P2X receptor channels2. In each case binding of transmitter leads to the opening of a pore through which ions flow down their electrochemical gradients. Many ligand-gated channels are also permeable to calcium ions3, 4, which have downstream signaling roles5 (e.g. gene regulation) that may exceed the duration of channel opening. Thus ligand-gated channels can signal over broad time scales ranging from a few milliseconds to days. Given these important roles it is necessary to understand how ligand-gated ion channels themselves are regulated by proteins, and how these proteins may tune signaling. Recent studies suggest that many, if not all, channels may be part of protein signaling complexes6. In this article we explain how to identify the proteins that bind to the C-terminal aspects of the P2X2 receptor cytosolic domain.
P2X receptors are ATP-gated cation channels and consist of seven subunits (P2X1-P2X7). P2X receptors are widely expressed in the brain, where they mediate excitatory synaptic transmission and presynaptic facilitation of neurotransmitter release7. P2X receptors are found in excitable and non-excitable cells and mediate key roles in neuronal signaling, inflammation and cardiovascular function8. P2X2 receptors are abundant in the nervous system9 and are the focus of this study. Each P2X subunit is thought to possess two membrane spanning segments (TM1 &amp; TM2) separated by an extracellular region7 and intracellular N and C termini (Fig 1a)7. P2X subunits10 (P2X1-P2X7) show 30-50% sequence homology at the amino acid level11. P2X receptors contain only three subunits, which is the simplest stoichiometry among ionotropic receptors. The P2X2 C-terminus consists of 120 amino acids (Fig 1b) and contains several protein docking consensus sites, supporting the hypothesis that P2X2 receptor may be part of signaling complexes. However, although several functions have been attributed to the C-terminus of P2X2 receptors9 no study has described the molecular partners that couple to the intracellular side of this protein via the full length C-terminus. In this methods paper we describe a proteomic approach to identify the proteins which interact with the full length C-terminus of P2X2 receptors.

We describe a simple protocol to identify brain proteins that bind to the full length C terminus of ATP-gated P2X2 receptors. The extension and systematic application of this approach to all P2X receptors is expected to lead to a better understanding of P2X receptor signaling.

Protéomique pour identifier les protéines interagissant avec P2X2 canaux cationiques ligand-dépendants

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Recherche

Biologie

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput identification of protein-protein interactions (PPI) for full-length transmembrane proteins. To this end, our lab developed the split-ubiquitin based Membrane Yeast Two-Hybrid (MYTH) system. This technology allows for the sensitive detection of transient and stable protein interactions using Saccharomyces cerevisiae as a host organism. MYTH takes advantage of the observation that ubiquitin can be separated into two stable moieties: the C-terminal half of yeast ubiquitin (Cub) and the N-terminal half of the ubiquitin moiety (Nub). In MYTH, this principle is adapted for use as a 'sensor' of protein-protein interactions. Briefly, the integral membrane bait protein is fused to Cub which is linked to an artificial transcription factor. Prey proteins, either in individual or library format, are fused to the Nub moiety. Protein interaction between the bait and prey leads to reconstitution of the ubiquitin moieties, forming a full-length 'pseudo-ubiquitin' molecule. This molecule is in turn recognized by cytosolic deubiquitinating enzymes, resulting in cleavage of the transcription factor, and subsequent induction of reporter gene expression. The system is highly adaptable, and is particularly well-suited to high-throughput screening. It has been successfully employed to investigate interactions using integral membrane proteins from both yeast and other organisms.

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

MYTH allows the sensitive detection of transient and stable interactions between proteins that are expressed in the model organism Saccharomyces cerevisiae. It has been successfully applied to study exogenous and yeast integral membrane proteins in order to identify their interacting partners in a high throughput manner.

Split-ubiquitine membrane à base de levure double hybride (MYTH) Système: Un outil puissant pour identifier les interactions entre protéines

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

Analyse de la cinétique ARNm exportation nucléaire dans les cellules de mammifères par micro-injection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated tools and resources for studies in this system are facilitating continued discovery of genes with more subtle phenotypes or roles. 
Here we present a generalized protocol we adapted for identifying C. elegans genes with postembryonic phenotypes of interest using RNAi2. This procedure is easily modified to assay the phenotype of choice, whether by light or fluorescence optics on a dissecting or compound microscope. This screening protocol capitalizes on the physical assets of the organism and molecular tools the C. elegans research community has produced. As an example, we demonstrate the use of an integrated transgene that expresses a fluorescent product in an RNAi screen to identify genes required for the normal localization of this product in late stage larvae and adults. First, we used a commercially available genomic RNAi library with full-length cDNA inserts. This library facilitates the rapid identification of multiple candidates by RNAi reduction of the candidate gene product. Second, we generated an integrated transgene that expresses our fluorecently tagged protein of interest in an RNAi-sensitive background. Third, by exposing hatched animals to RNAi, this screen permits identification of gene products that have a vital embryonic role that would otherwise mask a post-embryonic role in regulating the protein of interest. Lastly, this screen uses a compound microscope equipped for single cell resolution.

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

We describe a sensitized method to identify postembryonic regulators of protein expression and localization in C. elegans using an RNAi-based genomic screen and an integrated transgene that expresses a functional, fluorescently tagged protein.

Dépistage ARNi pour identifier les phénotypes postembryonnaires dans C. elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role in a variety of physiologic and disease processes, including early embryogenesis, wound healing 1, inflammation 2, 3, and host defense 4. PGRN also functions as a neurotrophic factor 5, and mutations in the PGRN gene resulting in partial loss of the PGRN protein cause frontotemporal dementia 6, 7. Our recent studies have led to the isolation of PGRN as an important regulator of cartilage development and degradation 8-11. Although PGRN, discovered nearly two decades ago, plays crucial roles in multiple physiological and pathological conditions, efforts to exploit the actions of PGRN and understand the mechanisms involved have been significantly hampered by our inability to identify its binding receptor(s). To address this issue, we developed a modified yeast two-hybrid (MY2H) approach based on the most commonly used GAL4 based 2-hybrid system. Compared with the conventional yeast two-hybrid screen, MY2H dramatically shortens the screen process and reduces the number of false positive clones. In addition, this approach is reproducible and reliable, and we have successfully employed this system in isolating the binding proteins of various baits, including ion channel 12, extracellular matrix protein 10, 13, and growth factor14. In this paper, we describe this MY2H experimental procedure in detail using PGRN as an example that led to the identification of TNFR2 as the first known PGRN-associated receptor 14, 15.

We have modified the conventional yeast two-hybrid screening, an effective genetic tool in identifying protein interaction. This modification markedly shortens the process, reduces the workload, and most importantly, reduces the number of false positives. In addition, this approach is reproducible and reliable.

Mise à jour de levure-système à deux hybrides pour identifier les protéines qui interagissent avec le facteur de croissance progranuline

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

siRNA contrôle pour la ubiquitine et les régulateurs du système ubiquitine-comme des voies biologiques dans des cellules de mammifères en culture

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.

Détection des Ligands oestrogéniques dans les produits de soins personnels à l’aide d’une levure oestrogène écran optimisé pour le laboratoire d’enseignement de premier cycle

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling contributes to the progression of many diseases. The ligand/receptor pair CXC chemokine ligand 12 (CXCL12)/CXC chemokine receptor 4 (CXCR4) has raised significant clinical interest, for instance as a potential target for the treatment of cancer and inflammatory diseases. Small molecules as well as therapeutic antibodies that specifically target CXCR4 and inhibit the receptor&#39;s function are therefore considered to be valuable pharmacological tools. Here, a flow cytometry-based cellular assay that allows identification of compounds (e.g., small molecules) that abrogate CXCL12 binding to CXCR4, is described. Essentially, the assay relies on the competition for receptor binding between a fixed amount of fluorescently labeled CXCL12, the natural chemokine agonist for CXCR4, and unlabeled compounds. Hence, the undesirable use of radioactively labeled probes is avoided in this assay. In addition, living cells are used as the source of receptor (CXCR4) instead of cell membrane preparations. This allows easy adaptation of the assay to a plate format, which increases the throughput. This assay has been shown to be a valuable generic drug discovery assay to identify CXCR4-targeting compounds. The protocol can likely be adapted to other GPCRs, at least if fluorescently labeled ligands are available or can be generated. Prior knowledge concerning the intracellular signaling pathways that are induced upon activation of these GPCRs, is not required.

A flow cytometry-based cellular binding assay is described that is primarily used as a screening tool to identify compounds that inhibit the binding of a fluorescently labeled CXC chemokine ligand 12 (CXCL12) to the CXC chemokine receptor 4 (CXCR4).

Un test Flow Cytometry d’identifier des composés qui perturbent la fixation du Ligand de chimiokines CXC fluorescent marqué 12 au récepteur de chimiokines CXC 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling ...

Examination of Mitotic and Meiotic Fission Yeast Nuclear Dynamics by Fluorescence Live-cell Microscopy

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does not interfere with cell physiology, and requires minimal experimental handling. The low levels of technical interference enable researchers to study cells across multiple cycles of mitosis and to observe meiosis from beginning to end. Using fluorescent tags such as Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP), researchers can analyze different factors whose functions are important for processes like transcription, DNA replication, cohesion, and segregation. Coupled with data analysis using Fiji (a free, optimized ImageJ version), live-cell imaging offers various ways of assessing protein movement, localization, stability, and timing, as well as nuclear dynamics and chromosome segregation. However, as is the case with other microscopy methods, live-cell imaging is limited by the intrinsic properties of light, which put a limit to the resolution power at high magnifications, and is also sensitive to photobleaching or phototoxicity at high wavelength frequencies. However, with some care, investigators can bypass these physical limitations by carefully choosing the right conditions, strains, and fluorescent markers to allow for the appropriate visualization of mitotic and meiotic events.

Here, we present live-cell imaging which is a non-toxic microscopy method that allows researchers to study protein behavior and nuclear dynamics in living fission yeast cells during mitosis and meiosis.

Examen de la dynamique nucléaire de levure de fission mitotique et méiotique par fluorescence Microscopie à cellules vivantes

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does ...

A Two-Step Strategy that Combines Epigenetic Modification and Biomechanical Cues to Generate Mammalian Pluripotent Cells

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe a new strategy that combines the use of chemical epigenetic erasing with mechanosensing-related cues, to generate mammalian pluripotent cells. Two main steps are required. In the first step, adult mature (terminally differentiated) cells are exposed to the epigenetic eraser 5-aza-cytidine to drive them into a pluripotent state. This part of the protocol was developed, based on the increasing understanding of the epigenetic mechanisms controlling cell fate and differentiation, and involves the use of the epigenetic modifier to erase cell differentiated state and then drive into a transient high plasticity window.
In the second step, erased cells are encapsulated in polytetrafluoroethylene (PTFE) micro-bioreactors, also known as Liquid Marbles, to promote 3D cell rearrangement to extend and stably maintain the acquired high plasticity. PTFE is a non-reactive hydrophobic synthetic compound and its use permits the creation of a cellular microenvironment, which cannot be achieved in traditional 2D culture systems. This system encourages and boosts the maintenance of pluripotency though bio-mechanosensing-related cues.
The technical procedures described here are simple strategies to allow for the induction and maintenance of a high plasticity state in adult somatic cells. The protocol allowed the derivation of high plasticity cells in all mammalian species tested. Since it does not involve the use of gene transfection and is free of viral vectors, it may represent a notable technological advance for translational medicine applications. Furthermore, the micro-bioreactor system provides a notable advancement in stem cell organoid technology by in vitro re-creating a specific micro-environment that allows for the long-term culture of high plasticity cells, namely as ESCs, iPSCs, epigenetically erased cells and MSCs.

We here present a method that combines the use of chemical epigenetic erasing with mechanosensing-related cues to efficiently generate mammalian pluripotent cells, without the need of gene transfection or retroviral vectors. This strategy is, therefore, promising for translational medicine and represents a notable advancement in stem cell organoid technology.

Une stratégie en deux étapes qui combine la modification épigénétique et les indices biomécaniques pour générer des cellules pluripotentes de mammifères

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe ...