We thank the Bloomington Drosophila Stock Center, Kyoto Drosophila Stock Center, and FlyBase for their resources. This work was supported by start-up funds provided by the Stony Brook University Department of Biochemistry and Cell Biology and the Renaissance School of Medicine (JON).

1. Preparation of buffers and reagents
NOTE: RNase-free technique is to be used throughout steps 1, 3, and 4, and certified RNase-free reagents should be used.
<ol>
	<li>In a chemical hood, prepare 40 mL of 4% formaldehyde in 1x PBS fixation solution by adding 10 mL of 16% formaldehyde and 4 mL RNase-free 10x PBS to 26 mL of RNase-free water. Distribute into 1 mL aliquots and store at -20 &#176;C within 30 min of preparing. Fixation solution can be stored at -20 &#176;C for up to 6 months. 
	CAUTION: The solution contains formaldehyde. Handle with gloves and appropriate PPE and safely dispose of it.</li>
	<li>Prepare 10 mL of hybridization buffer by mixing 1 mL of 20x RNase-free saline-sodium citrate (SSC), 1 g dextran sulfate, 100 &#181;L of 100 mg/mL Saccharomyces cerevisiae tRNA, 100 &#181;L of 200 mM Vanadyl ribonucleoside complex, 1 mL of 5% RNase-free BSA, 1 mL of deionized formamide combined with 6 mL of RNase-free water. Distribute into 1 mL aliquots in 1.5 mL microfuge tubes and store at -20&#160;&#176;C for up to 1 month.</li>
	<li>Prepare 50 mL of wash buffer by adding 5 mL of 20x RNase-free SSC, 5 mL of deionized formamide, 50 &#181;L of Triton-X to 40 mL of RNase-free water. Store at room temperature in the dark for up to 1 month.</li>
	<li>Prepare 10 mL of DNA isolation buffer by adding 100 &#181;L of 1M Tris-HCl pH 7.5-8.0, 20 &#181;L of 0.5M EDTA, and 50 &#181;L of 5M NaCl to 9.8 mL of water.</li>
</ol>
2. Sample genotyping for X- and Y-specific rRNA SNPs
<ol>
	<li>Collect individual unmated homozygous X female and male harboring the same X chromosome in 0.2 mL tubes and chill on ice.</li>
	<li>Combine 50 &#181;L of DNA isolation buffer with 0.5 &#181;L of 20 mg / mL Proteinase K per sample.</li>
	<li>Add 50 &#181;L of DNA isolation buffer / Proteinase K to the Drosophila sample and homogenize the sample using a pipette tip.</li>
	<li>Incubate samples at 37&#176;C for 30 minutes, followed by 95&#176;C for 2 minutes. Transfer 40 mL of sample (avoid animal debris) to a clean 1.5 mL tube.</li>
	<li>Separately amplify each SNP target region from each DNA sample by PCR using 10 &#181;M concentration of the following primer pairs: 18S SNP Forward + Reverse; ITS1 SNP Forward + Reverse; 28S SNP Forward + Reverse. The primer sequence and expected PCR amplicon size are found in Table 1.</li>
	<li>Use gel electrophoresis to separate the entire PCR sample on a 1% agarose 1x TAE gel to confirm the expected PCR product. Expected product sizes are listed in Table 1.</li>
	<li>Isolate PCR product from the gel using any commercially available gel extraction kit.</li>
	<li>Sequence PCR products by Sanger sequencing. Sequence samples in both directions using separate individual reactions for the F and R primer for each target.</li>
	<li>Determine the X chromosome SNP variant at the positions in Table 2 in an unmated female DNA sample. The expected X haplotype is described in Table 2.</li>
	<li>Observe SNP positions in male DNA sample sequencing chromatogram. Infer Y chromosome SNP variant based on the already determined X SNP variant at each SNP position. The expected Y haplotype is described in Table 2.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer name</td>
			<td>Sequence</td>
			<td>Expected Amplicon Size</td>
		</tr>
		<tr>
			<td>18S SNP F</td>
			<td>GACTACCATGGTTGCAACGG</td>
			<td rowspan="2">652 bp</td>
		</tr>
		<tr>
			<td>18S SNP R</td>
			<td>TTCACCTCTCGCGTCGTAAT</td>
		</tr>
		<tr>
			<td>ITS1 SNP F</td>
			<td>CTTGCGTGTTACGGTTGTTTC</td>
			<td rowspan="2">955 bp</td>
		</tr>
		<tr>
			<td>ITS1 SNP R</td>
			<td>ACAGCATGGACTGCGATATG</td>
		</tr>
		<tr>
			<td>28S SNP F</td>
			<td>ATGCGTAGAAGTGTTTGGCG</td>
			<td rowspan="2">598 bp</td>
		</tr>
		<tr>
			<td>28S SNP R</td>
			<td>GCCGACTTCCCTTACCTACA</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences for sequencing rDNA SNPs. Primer pairs to amplify rDNA regions that contain previously characterized SNPs in the 18S, ITS1, and 28S rDNA regions. Primer oligonucleotide sequence and expected PCR amplicon size are listed.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Haplotype</td>
			<td>SNP Position</td>
			<td colspan="3">Sequence</td>
		</tr>
		<tr>
			<td rowspan="4">X rDNA</td>
			<td>18S</td>
			<td colspan="3">1603-ATACTTGTATTTTTTCATATG-1625</td>
		</tr>
		<tr>
			<td>ITS1-1</td>
			<td colspan="3">2873-CGTTAATAAATATTTGTAATT-2895</td>
		</tr>
		<tr>
			<td>ITS1-2</td>
			<td colspan="3">3115-GAAAATCGAAGAAACAAAATT-3137</td>
		</tr>
		<tr>
			<td>28S</td>
			<td colspan="3">5932-AACAAAAATGCCTAACTATAT-5954</td>
		</tr>
		<tr>
			<td rowspan="4">Y rDNA</td>
			<td>18S</td>
			<td colspan="3">1603-ATACTTGTATCTTTTCATATG-1624</td>
		</tr>
		<tr>
			<td>ITS1-1</td>
			<td colspan="3">2873-CGTTAATAAACATTTGTAATT-2895</td>
		</tr>
		<tr>
			<td>ITS1-2</td>
			<td colspan="3">3115-GAAAATCGAAAAAACAAAATT-3137</td>
		</tr>
		<tr>
			<td>28S</td>
			<td colspan="3">5932-AACAAAAATGGCTAACTATAT-5954</td>
		</tr>
	</tbody>
</table>
Table 2: Expected rDNA haplotypes. Expected SNPs at X and Y chromosome rDNA loci in the y1w1 Drosophila strain. SNP indicated in bold and underlined. Position listed based on consensus 45S rRNA sequence (Supplementary file 1).
3. Testis dissection, fixation, and permeabilization
<ol>
	<li>Clean stereomicroscope, workstation, dissecting dish, and dissecting forceps with 70% ethanol (or another RNase treatment).</li>
	<li>Under a stereomicroscope, dissect Drosophila to isolate testes in 1x RNAse-free PBS. Grasp the middle of the animal&#39;s abdomen with one pair of forceps and grasp the end of the abdomen with another pair of forceps to gently pull the animal apart. Testes will dissociate from the animal and can be further separated using forceps. Collect 30 - 40 testes per sample.</li>
	<li>Using forceps, pick up testes and transfer them from the dissecting dish to a 1.5 mL microfuge tube containing 0.5 mL of 1x RNase-free PBS.</li>
	<li>Aspirate PBS and add 1mL of fixation solution. Incubate at room temperature on a nutating shaker for 30 min. Aspirate fixative.</li>
	<li>Wash 2x with 1 mL of 1x RNase-free PBS for 5 min each on a nutating shaker. Aspirate 1x PBS and add 1 mL of RNase-free 70% ethanol (EtOH). Incubate at 4 &#176;C overnight on a nutating shaker.</li>
</ol>
4. SNP-sensitive ribosomal RNA FISH
<ol>
	<li>Aspirate ethanol and add 1 mL of wash buffer. Incubate at room temp for 3 min on a nutating shaker, followed by 2 min of tube resting upright.</li>
	<li>Mix probes and masks with hybridization buffer, making 100 &#181;L of total volume per sample. Probe, mask sequences, and fluorophore labels are listed in Table 3. When using all 4 SNPs, prepare 80 &#181;L of hybridization buffer, 1 &#181;L each of 10 &#181;M Y-SNP probe (4 &#181;L total), 1 &#181;L each of 10 &#181;M X-SNP probe (4 &#181;L total), and 3 &#181;L each of 10 &#181;M common mask (12 &#181;L total)</li>
	<li>Aspirate wash buffer, then add 100 &#181;L of hybridization solution. Apply transparent film on the edges of the tube, wrap in aluminum foil to protect from light, and incubate in a 37 &#176;C water bath for at least 24 h.</li>
	<li>Add 1 mL of wash buffer to the sample without aspirating the hybridization solution. Incubate in a 37 &#176;C water bath for 30 min in the dark.</li>
	<li>Aspirate wash buffer, then add 1 mL of wash buffer to the sample. Incubate in a 37 &#176;C water bath for 30 min in the dark.</li>
	<li>Aspirate wash buffer and add 50 &#181;L of mounting media. Samples can be immediately mounted on slides or stored for up to 1 week at 4 &#176;C prior to mounting.</li>
</ol>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>SNP Position</td>
			<td>Oligonucleotide</td>
			<td colspan="2">Sequence</td>
			<td>3&#8217; conjugated Fluorophore</td>
		</tr>
		<tr>
			<td rowspan="3">18S</td>
			<td>X SNP probe</td>
			<td colspan="2">AAAAAATACAAGTATTTAATCACATA</td>
			<td>Alexa 488</td>
		</tr>
		<tr>
			<td>Y SNP probe</td>
			<td colspan="2">AAAAGATACAAGTATTTAATCACATA</td>
			<td>Alexa 647</td>
		</tr>
		<tr>
			<td>Mask</td>
			<td colspan="2">TATGTGATTAAATACT</td>
			<td></td>
		</tr>
		<tr>
			<td rowspan="3">ITS1-1</td>
			<td>X SNP probe</td>
			<td colspan="2">AAATATTTATTAACGGTAAGGATATT</td>
			<td>Alexa 488</td>
		</tr>
		<tr>
			<td>Y SNP probe</td>
			<td colspan="2">AAATGTTTATTAACGGTAAGGATATT</td>
			<td>Alexa 647</td>
		</tr>
		<tr>
			<td>Mask</td>
			<td colspan="2">AATATCCTTACCGTTA</td>
			<td></td>
		</tr>
		<tr>
			<td rowspan="3">ITS1-2</td>
			<td>X SNP probe</td>
			<td colspan="2">GTTTCTTCGATTTTCATGTTCGAAAC</td>
			<td>Alexa 488</td>
		</tr>
		<tr>
			<td>Y SNP probe</td>
			<td colspan="2">GTTTTTTCGATTTTCATGTTCGAAAC</td>
			<td>Alexa 647</td>
		</tr>
		<tr>
			<td>Mask</td>
			<td colspan="2">GTTTCGAACATGAAAA</td>
			<td></td>
		</tr>
		<tr>
			<td rowspan="3">28S</td>
			<td>X SNP probe</td>
			<td colspan="2">TTAGGCATTTTTGTTTTACTTGAAAA</td>
			<td>Alexa 488</td>
		</tr>
		<tr>
			<td>Y SNP probe</td>
			<td colspan="2">TTAGCCATTTTTGTTTTACTTGAAAA</td>
			<td>Alexa 647</td>
		</tr>
		<tr>
			<td>Mask</td>
			<td colspan="2">TTTTCAAGTAAAACAA</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 3: Probe and mask sequences for rDNA SNP-FISH. SNP positions are highlighted in bold. The probe portion that binds to mask oligonucleotide is underlined. Examples of suitable 3&#39; conjugated fluorophores are listed, but any compatible fluorophores can be used.
5. Preparation of samples for imaging
<ol>
	<li>Working under a dissecting stereomicroscope, use a wide-orifice pipette to transfer the sample to a microscope slide.</li>
	<li>Using forceps, arrange testes in a line for ease to find samples when imaging (no specific orientation required). Cover sample with a coverslip. Blot coverslip edges with a tissue wipe to remove excess mounting media.</li>
	<li>Seal the edges of the coverslip with nail polish. Leave slide in dark at room temp for 10 min for nail polish to dry. Slides can be used immediately for confocal imaging or be stored for up to one month at 4 &#176;C prior to imaging.</li>
</ol>

<ol>
	<li>Ba&#223;ler, J., Hurt, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eurokaryotic+ribosome+assembly.">Eurokaryotic ribosome assembly.</a> Ann Rev Biochem. 88 (1), 1-26 (2018).</li><li>Hall, A. N., Morton, E., Queitsch, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+discovered,+long+out+of+sight,+finally+visible:+ribosomal+DNA.">First discovered, long out of sight, finally visible: ribosomal DNA.</a> Trend Genet. 38 (6), 587-597 (2022).</li><li>Srivastava, R., Srivastava, R., Ahn, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epigenetic+pathways+to+ribosomal+DNA+silencing.">The epigenetic pathways to ribosomal DNA silencing.</a> Microbiol Mol Biol Rev. 80 (3), 545-563 (2016).</li><li>Kuo, B. A., Gonzalez, I. L., Gillespie, D. A., Sylvester, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+ribosomal+RNA+variants+from+a+single+individual+and+their+expression+in+different+tissues.">Human ribosomal RNA variants from a single individual and their expression in different tissues.</a> Nucl Acid Res. 24 (23), 4817-4824 (1996).</li><li>Tseng, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+ribosomal+RNA+genes+contain+multiple+differentially+regulated+variants.">Mouse ribosomal RNA genes contain multiple differentially regulated variants.</a> PLoS ONE. 3 (3), e1843 (2008).</li><li>Locati, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+distinct+maternal+and+somatic+5.8S,+18S,+and+28S+rRNA+types+during+zebrafish+development.">Expression of distinct maternal and somatic 5.8S, 18S, and 28S rRNA types during zebrafish development.</a> RNA. 23 (8), 1188-1199 (2017).</li><li>Roussel, P., Andr&#233;, C., Comai, L., Hernandez-Verdun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+rDNA+transcription+machinery+is+assembled+during+mitosis+in+active+NORs+and+absent+in+inactive+NORs.">The rDNA transcription machinery is assembled during mitosis in active NORs and absent in inactive NORs.</a> J Cell Biol. 133 (2), 235-246 (1996).</li><li>Pontes, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postembryonic+establishment+of+megabase-scale+gene+silencing+in+nucleolar+dominance.">Postembryonic establishment of megabase-scale gene silencing in nucleolar dominance.</a> PLoS ONE. 2 (11), e1157 (2007).</li><li>Earley, K. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+HDA6-mediated+rRNA+gene+silencing:+suppression+of+intergenic+Pol+II+transcription+and+differential+effects+on+maintenance+versus+siRNA-directed+cytosine+methylation.">Mechanisms of HDA6-mediated rRNA gene silencing: suppression of intergenic Pol II transcription and differential effects on maintenance versus siRNA-directed cytosine methylation.</a> Gene Dev. 24 (11), 1119-1132 (2010).</li><li>Greil, F., Ahmad, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleolar+dominance+of+the+Y+chromosome+in+Drosophila+melanogaster.">Nucleolar dominance of the Y chromosome in Drosophila melanogaster.</a> Genetics. 191 (4), 1119-1128 (2012).</li><li>Preuss, S., Pikaard, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=rRNA+gene+silencing+and+nucleolar+dominance:+Insights+into+a+chromosome-scale+epigenetic+on/off+switch.">rRNA gene silencing and nucleolar dominance: Insights into a chromosome-scale epigenetic on/off switch.</a> Biochim Biophys Acta. 1769 (5-6), 383-392 (2007).</li><li>Sharifi, S., Bierhoff, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+RNA+pPolymerase+I+transcription+in+development,+disease,+and+aging.">Regulation of RNA pPolymerase I transcription in development, disease, and aging.</a> Ann Rev Biochem. 87 (1), 1-23 (2018).</li><li>Lu, K. L., Nelson, J. O., Watase, G. J., Warsinger-Pepe, N., Yamashita, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+dynamics+of+rDNA+copy+number+in+Drosophila+male+germline+stem+cells.">Transgenerational dynamics of rDNA copy number in Drosophila male germline stem cells.</a> eLife. 7, e32421 (2018).</li><li>Nurk, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complete+sequence+of+a+human+genome.">The complete sequence of a human genome.</a> Science. 376 (6588), 44-53 (2022).</li><li>Ritossa, F. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unstable+redundancy+of+genes+for+ribosomal+RNA.">Unstable redundancy of genes for ribosomal RNA.</a> Proc Natl Acad Sci. 60 (2), 509-516 (1968).</li><li>Nelson, J. O., Slicko, A., Yamashita, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+retrotransposon+R2+maintains+Drosophila+ribosomal+DNA+repeats.">The retrotransposon R2 maintains Drosophila ribosomal DNA repeats.</a> Proc Natl Acad Sci. 120 (23), e2221613120 (2023).</li><li>Warsinger-Pepe, N., Li, D., Yamashita, Y. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+nucleolar+dominance+in+Drosophila+melanogaster.">Regulation of nucleolar dominance in Drosophila melanogaster.</a> Genetics. 214 (4), (2020).</li><li>Levesque, M. J., Ginart, P., Wei, Y., Raj, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+SNVs+to+quantify+allele-specific+expression+in+single+cells.">Visualizing SNVs to quantify allele-specific expression in single cells.</a> Nat Meth. 10 (9), 865-867 (2013).</li><li>Davis, M. W., Jorgensen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ApE,+a+plasmid+editor:+A+freely+available+DNA+manipulation+and+visualization+program.">ApE, a plasmid editor: A freely available DNA manipulation and visualization program.</a> Front Bioinfo. 2, 818619 (2022).</li><li>Qazi, M. C. B., Heifetz, Y., Wolfner, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+developments+between+gametogenesis+and+fertilization:+ovulation+and+female+sperm+storage+in+Drosophila+melanogaster.">The developments between gametogenesis and fertilization: ovulation and female sperm storage in Drosophila melanogaster.</a> Dev Biol. 256 (2), 195-211 (2003).</li><li>Rogers, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+features+of+the+large+subunit+rRNA+expressed+in+Plasmodium+falciparum+sporozoites+that+distinguish+it+from+the+asexually+expressed+subunit+rRNA.">Structural features of the large subunit rRNA expressed in Plasmodium falciparum sporozoites that distinguish it from the asexually expressed subunit rRNA.</a> RNA. 2 (2), 134-145 (1996).</li><li>Potapova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+control+and+inheritance+of+rDNA+arrays.">Epigenetic control and inheritance of rDNA arrays.</a> bioRxiv. , (2024).</li><li>Tang, Y. Z., Gin, K. Y. H., Lim, T. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-temperature+fluorescent+in+situ+hybridization+for+detecting+Escherichia+coli+in+seawater+samples,+using+rRNA-targeted+oligonucleotide+probes+and+flow+cytometry.">High-temperature fluorescent in situ hybridization for detecting Escherichia coli in seawater samples, using rRNA-targeted oligonucleotide probes and flow cytometry.</a> Appl Environ Microbiol. 71 (12), 8157-8164 (2005).</li></ol>

The authors do not have any conflicts of interest to disclose.

Here, we describe a method to use SNP-FISH to distinguish 45S rRNA transcripts derived from the X and Y chromosome rDNA loci in Drosophila melanogaster tissues. The most critical step in this protocol is the accurate genotyping of 45S SNPs to be used as SNP-FISH targets. We provide primers and protocol to genotype four known Drosophila 45S SNPs, but other sequencing methods may reveal novel SNPs that could alternatively be used for the assay. Any SNP positions found to be identical between X and Y chromosome rDNA loci (i.e., there is a single sequencing peak in male DNA samples) cannot be used for SNP FISH. Some SNP positions may be found to be heterogeneous within a single rDNA locus (i.e., sequencing results do not give a single SNP variant for XX samples or only a very minor second sequencing peak in XY samples). SNPs that are heterogenous within a single rDNA locus are also not suitable for this assay since one of the variants would be shared between the two rDNA loci, making transcription from a single locus or multiple loci indistinguishable. Furthermore, due to female sperm storage20, DNA isolated from mated females may contain Y chromosome rDNA. Thus, it is critical that unmated females are used for XX sequencing analysis. Importantly, this method requires at least two chromosome-specific SNPs to enable at least two locus-specific probes to bind each rRNA molecule for detection, limiting its application to rDNA loci with at least two distinguishing SNPs between them. The availability of more SNPs allows for more probes to bind each rRNA and can provide greater signal effectiveness. Interestingly, this method only labels rRNA in the nucleolus, despite two probe pairs targeting SNPs in the 18S and 28S rRNAs which are exported to the cytoplasm (rRNA containing the two ITS1 target sites only exists in the nucleolus). The lack of cytoplasmic FISH signal suggests two non-exclusive possibilities: 1) the 18S and 28S probes alone are insufficient to detect cytoplasmic rRNA, perhaps because rRNA is more dispersed throughout the cytoplasm than in the nucleolus, or 2) there is lower probe binding efficiency to rRNAs integrated into the mature ribosomal subunits than to the unprocessed 45S rRNA. Additional SNPs within the 18S and 28S rRNAs may enable SNP-sensitive FISH detection of cytoplasmic rRNAs.
Other methods to assess locus-specific rRNA transcription include rRNA sequencing approaches that differentiate the expression of rRNA variants that are assigned to specific loci6. Similarly, qPCR can differentially assess the expression of rRNA variants that are distinct enough to enable unique detection5,21, though it is unclear if the silencing of these variants represents the silencing of an entire rDNA locus. While these methods can be effective in quantifying the expression of specific rRNA variants, they cannot be done with single-cell resolution. The heterogeneity of X chromosome rDNA silencing in Drosophila tissues suggests that there is strong cell-to-cell variation in rDNA locus transcription17 and highlights the need for techniques that can account for this variability. Imaging features associated with active transcription at rDNA loci, such as the H3.3 histone variant10 or the Pol I transcription factor UBF22, have been used to identify locus-specific rRNA transcription with single-cell resolution. However, both of these methods require the condensed chromosomes of mitotic cells in order to distinguish transcription occurring at any particular rDNA locus. In Drosophila cells, rDNA loci at the X and Y chromosomes may be identified by chromosome shape10, but identification of transcriptionally active rDNA loci in human cells also requires co-staining with chromosome-specific labels22. The SNP-FISH method does not require either chromosome-specific co-labeling or labeling of transcriptional markers and can be assessed in any cell cycle stage or post-mitotic cells, providing flexibility for use in diverse tissues and experimental conditions.
This rRNA SNP-FISH method may be modified for use with other SNPs that distinguish between Drosophila rRNAs or potentially be applied to SNPs that distinguish between rDNA loci in other organisms. Applying this method to organisms with more than two rDNA loci will require a locus to have a unique rDNA variant haplotype containing at least two SNPs that are not present on any other rDNA locus and that are shared between all 45S copies at that locus. This requirement means the method will only be able to specify transcription from one specific locus compared to all others (i.e., rRNA SNPs from locus 1 compared to SNPs shared by loci 2 and 3). However, if each rDNA locus has a compatible haplotype, multiple experiments could be combined to individually assess the transcription of each locus one at a time. The relatively low stringency of the hybridization temperature (37 &#176;C) used in this protocol allows for strong probe binding, particularly given the short, unmasked portion of the probe, though hybridization at higher temperatures (50-75 &#176;C) has been shown to enhance the signal of some FISH probes23. Higher hybridization temperatures may enhance mask strand displacement and increase probe binding, but too high temperatures may destabilize probe-mask binding and lose SNP-specificity. For this reason, we do not expect SNP-FISH to specifically label DNA because the temperatures needed to melt double-stranded DNA targets to enable probe binding would also destabilize probe-mask binding and eliminate SNP-sensitive target specificity. Still, optimization of hybridization temperature for new rRNA SNP probes may increase the signal, particularly when only two SNP sites are available. Loss of X chromosome rDNA silencing is associated with rDNA copy number reduction in Drosophila13, so the development of SNP-FISH assays to characterize locus-specific rRNA transcription in other systems may serve as a useful tool to evaluate the integrity of rDNA and ribosome function. Furthermore, this method has been modified for use with a deletion variant in Drosophila, and this single structural rRNA variant was suitable for detection (perhaps due to greater target binding affinity without a probe mask)17. The use of structural rRNA variants potentially combined with SNP variants broadens the potential for application in other systems. Since the mechanisms that regulate rDNA locus transcription remain largely unclear, the flexibility and potential adaptability of rRNA SNP-FISH to other systems make it a powerful tool for future studies to investigate rRNA transcription.

The 18S, 5.8S, and 28S ribosomal RNAs (rRNAs) required for ribosome function are co-transcribed in a single cistron called the 45S pre-rRNA. The three rRNAs are separated within the 45S pre-rRNA by two internal transcribed spacer sequences (ITS) and flanked by external transcribed spacer sequences (ETS) at the 5&#39; and 3&#39; end. All of these spacer sequences are removed from the 45S pre-rRNA for the mature rRNAs to be incorporated into ribosomes (see1). In order to meet the high demand for rRNA production needed to support ribosome activity, all Eukaryotic genomes contain hundreds of copies of the 45S sequence. These copies are clustered together in tandem repeats, forming genomic regions called ribosomal DNA (rDNA) loci. Most Eukaryotic genomes contain multiple rDNA loci spread across separate chromosomes (see2). The high redundancy of 45S copies means there are typically many more 45S copies than necessary for transcription, and the majority of 45S copies are transcriptionally silent and buried in heterochromatin3. Transcriptional activity is not uniform across rDNA loci, and variation in rDNA locus transcription is widely observed across organisms4,5,6, indicating that 45S transcription is differentially regulated at individual rDNA loci. Locus-wide rDNA silencing has been observed in plants, invertebrates, and vertebrates7,8,9,10, suggesting that locus-wide rDNA silencing is a major mechanism for regulating rRNA dosage11. rRNA transcription is a key regulatory step in ribosome production, and changes to rRNA transcription that modulate translational activity are an important feature of both normal differentiation and disease conditions12. Changes in rDNA locus transcription are also associated with reductions in total rDNA copy number13. Thus, altered locus-specific rDNA transcription may be an important indicator of disrupted cellular physiology.
While locus-specific silencing appears to be a major source of rRNA transcriptional regulation, the mechanisms that establish this&#160;silencing and direct which rDNA loci are transcriptionally active are largely unknown. The homogeneity of rDNA sequences makes it difficult to assess individual rDNA locus transcription, preventing widespread analysis of locus-specific rDNA transcriptional activity. This challenge may be possible to overcome by taking advantage of the structural and single nucleotide sequence variation between rDNA copies within the same genome4,5,6,13. Some of these variants may be shared among most or all copies in an individual locus, creating unique rDNA locus haplotypes of multiple variants that distinguish an rDNA locus. Indeed, recent mapping of rDNA variants to specific loci by the telomere-to-telomere consortium revealed locus-specific shared rDNA variants in the human genome14. Such rDNA locus maps may enable the identification of locus-specific transcription from sequencing datasets; however, the availability of these maps currently remains limited and are not easy to produce. Since rDNA loci only reside on the sex chromosomes in Drosophila melanogaster (one locus on each X and Y chromosome)15, the Y chromosome rDNA locus is absent from XX females. This natural isolation from the Y chromosome locus means single nucleotide polymorphism (SNP) variants between the X and Y rDNA loci can be easily identified in short-read sequencing as any variants that are present in males (XY) but absent from females (XX). Previously identified SNPs can be rapidly tested in ungenotyped Drosophila strains through simple PCR and Sanger sequencing of DNA from males and females. Furthermore, the availability of Drosophila strains with an X chromosome that has no rDNA locus16 means individual X and Y rDNA loci can be individually isolated for even more precise rDNA SNP characterization. This easy identification of SNP variants between the Drosophila rDNA loci makes it possible to determine unique X and Y rDNA loci SNP haplotypes13. X chromosome rDNA loci are also typically completely silent in Drosophila males, but both X chromosome loci are transcribed in females10,17, making Drosophila a useful system to study locus-wide rDNA silencing.
Fluorescence in situ hybridization (FISH) is a powerful tool to visualize the presence of specific RNA or DNA sequences within the individual cells of a tissue. FISH labels target RNA or DNA sequences through antisense oligonucleotide probes conjugated to fluorophores. FISH probes are typically required to be ~20 nucleotides long in order to provide stable enough target binding to be visualized but probes this long can also easily bind to non-target sequences that differ by only a single nucleotide (Figure 1A). Conversely, probes short enough to confer single-nucleotide specificity do not bind stably enough for visualization. To balance specificity and stability, SNP-sensitive FISH (SNP-FISH) combines a ~26 nucleotide long antisense fluorescent probe with a non-fluorescent sense mask oligonucleotide that binds to all but the 5&#39; end of the probe18. This mask leaves only the 10 most 5&#39; nucleotides of the probe single-stranded and available for target binding (Figure 1B). This short single-stranded portion of the probe confers specificity to the target but prevents cross-reactivity with RNAs that have even a single mismatch with these 10 nucleotides (Figure 1B). Once the 5&#39; end of the probe binds its target, passive strand displacement strips the mask from the probe, allowing the 3&#39; region to bind the target and creating stable target labeling (Figure 1B)18. Therefore, SNP-FISH can differentially visualize RNAs that differ by a single SNP by using a pair of probes that have different fluorophores that each complement a different SNP but share a common mask (Figure 1C). Although this method only recruits a single fluorophore-conjugated probe to the target SNP, pooling multiple probe-mask sets to several SNPs within a shared rDNA haplotype can be used to amplify the SNP-sensitive detection of a single rRNA (Figure 1D). Furthermore, because rRNA is so abundantly transcribed, rRNA transcripts can be easily visualized in FISH experiments using a small number of fluorescent labels per RNA. This low requirement for fluorophore per RNA means that SNP-FISH can visualize rRNAs from a specific locus with only a few unique SNPs. This method can easily detect locus-specific rRNA transcription in a variety of Drosophila tissues and developmental stages17. It is particularly effective in Drosophila male germline stem cells, which change between exclusive Y-rDNA transcription and co-expression of X- and Y-chromosome rDNA loci during aging13. Here, we provide an SNP-FISH protocol to visualize distinct X and Y rRNA transcripts in the Drosophila testis to achieve the overall goal of assessing locus-specific rRNA silencing. This method uses four SNPs previously characterized between the rDNA loci on the X and Y chromosomes of the common y1w1 laboratory Drosophila strain (Figure 1D).

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PTC Tempo 96 Thermal Cycler</td>
			<td>Bio Rad</td>
			<td>12015382</td>
			<td>Any thermal cycler can be used</td>
		</tr>
		<tr>
			<td>0.2 mL 8 strip flatcap PCR tubes</td>
			<td>VWR</td>
			<td>89133-912</td>
			<td>Any compatable tubes can be used</td>
		</tr>
		<tr>
			<td>1 kb DNA ladder</td>
			<td>NEB</td>
			<td>N3232S</td>
			<td>To use when checking sequencing PCR amplicon size by gel electrophoresis</td>
		</tr>
		<tr>
			<td>1.5 mL graduated microcentrifuge tubes</td>
			<td>USA Scientific</td>
			<td>1615-5510</td>
			<td>Any certified RNase free tube will do</td>
		</tr>
		<tr>
			<td>2 mM dNTP Mix</td>
			<td>ThermoFisher Scientific</td>
			<td>R0241</td>
			<td></td>
		</tr>
		<tr>
			<td>50x TAE Buffer</td>
			<td>Bio Rad</td>
			<td>1610743</td>
			<td>Used for gel electrophoresis. Any TAE buffer can be used.</td>
		</tr>
		<tr>
			<td>5M NaCl</td>
			<td></td>
			<td></td>
			<td>Any NaCl can be used or prepared from any source</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>VWR</td>
			<td>97064-250</td>
			<td>Any Agarose can be used</td>
		</tr>
		<tr>
			<td>ApE - A plasmid Editor software</td>
			<td>N/A</td>
			<td>N/A</td>
			<td>https://jorgensen.biology.utah.edu/wayned/ape/</td>
		</tr>
		<tr>
			<td>Clear nail polish</td>
			<td></td>
			<td></td>
			<td>Any nail polish from any retailer can be used</td>
		</tr>
		<tr>
			<td>Cover glass, No. 1 Thickness</td>
			<td>Thomas Scientific</td>
			<td>6672A38</td>
			<td></td>
		</tr>
		<tr>
			<td>Deionized Formamide</td>
			<td>Fisher Scientific</td>
			<td>NC9569627</td>
			<td></td>
		</tr>
		<tr>
			<td>Dextran Sulfate Sodium</td>
			<td>Sigma Aldrich</td>
			<td>D8906-10G</td>
			<td></td>
		</tr>
		<tr>
			<td>DreamTaq Green PCR Master Mix</td>
			<td>ThermoFisher Scientific</td>
			<td>K1081</td>
			<td></td>
		</tr>
		<tr>
			<td>Dumont #5 forceps</td>
			<td>Fine Science Tools</td>
			<td>11252-20</td>
			<td>Used for dissecting samples</td>
		</tr>
		<tr>
			<td>EDTA (0.5M), Ph 8.0</td>
			<td>ThermoFisher Scientific</td>
			<td>R1021</td>
			<td>Any comparable product can be used</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>VWR</td>
			<td>89125-172</td>
			<td>Any 200 proof Ethanol can be used. Used for dilution to 70% ethanol for permeabilization and cleaning for Rnase-free conditions</td>
		</tr>
		<tr>
			<td>Ethidium Bromide</td>
			<td>ThermoFisher Scientific</td>
			<td>15585011</td>
			<td></td>
		</tr>
		<tr>
			<td>Horizontal Mini Gel Electrophoresis System</td>
			<td>Fisher Scientific</td>
			<td>14-955-170</td>
			<td>Any gel electrophoresis system can be used</td>
		</tr>
		<tr>
			<td>Kimwipes</td>
			<td>Fisher Scientific</td>
			<td>06-666</td>
			<td></td>
		</tr>
		<tr>
			<td>Micro-Test Staining Dish</td>
			<td>Electron Microscopy Sciences</td>
			<td>71564</td>
			<td>Used for dissecting samples</td>
		</tr>
		<tr>
			<td>Nutating shaker</td>
			<td>Sigma Aldrich</td>
			<td>BMSB3D1020</td>
			<td>Any nutating shaker can be used</td>
		</tr>
		<tr>
			<td>Parafilm</td>
			<td>USA Scientific</td>
			<td>3023-4526</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-Buffered Saline (10X) pH 7.4, RNase-free</td>
			<td>Life Technologies</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce 16% Formaldehyde (w/v), Methanol-free</td>
			<td>Life Technologies</td>
			<td>28908</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision General Purpose Water Bath</td>
			<td>Life Technologies</td>
			<td>TSGP02</td>
			<td>Any water bath can be used</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28704</td>
			<td>Any gel extraction kit can be used</td>
		</tr>
		<tr>
			<td>Recombinant Proteinase K Solution (20 mg/mL)</td>
			<td>Invitrogen</td>
			<td>AM2546</td>
			<td>Any comparable product can be used</td>
		</tr>
		<tr>
			<td>Rnase-free UltraPure BSA</td>
			<td>ThermoFisher Scientific</td>
			<td>AM2618</td>
			<td></td>
		</tr>
		<tr>
			<td>S. cerevisiae tRNA</td>
			<td>Sigma Aldrich</td>
			<td>R8759</td>
			<td></td>
		</tr>
		<tr>
			<td>SSC (20X), RNase-free</td>
			<td>Fisher Scientific</td>
			<td>AM9763</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X 100</td>
			<td>Life Technologies</td>
			<td>A16046.AE</td>
			<td></td>
		</tr>
		<tr>
			<td>UltaPure 1M Tris-HCl Buffer, pH 7.5</td>
			<td>ThermoFisher Scientific</td>
			<td>15567027</td>
			<td>Any comparable product can be used</td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-Free Distilled Water</td>
			<td>Life Technologies</td>
			<td>10977023</td>
			<td></td>
		</tr>
		<tr>
			<td>Vanadyl ribonucleoside complex</td>
			<td>NEB</td>
			<td>S1402S</td>
			<td></td>
		</tr>
		<tr>
			<td>VECTASHIELD mounting media with DAPI</td>
			<td>Vector Laboratories</td>
			<td>H-1200-10</td>
			<td></td>
		</tr>
		<tr>
			<td>VWR Superfrost Microscope Slide</td>
			<td>VWR</td>
			<td>48311-601</td>
			<td></td>
		</tr>
		<tr>
			<td>y[1]w[1] Drosophila melanogaster line</td>
			<td>Bloomington Drosophila Stock Center</td>
			<td>1495</td>
			<td></td>
		</tr>
		<tr>
			<td>Zeiss LSM 980 confocal microscope</td>
			<td>Zeiss microscopy</td>
			<td></td>
			<td>Any confocal microscope with compatable emission and detection can be used</td>
		</tr>
		<tr>
			<td>Zeiss Stemi 2000-C Stereo Microscope and light source</td>
			<td>Microscope Central</td>
			<td>455053</td>
			<td>Any steromicroscope can be used</td>
		</tr>
	</tbody>
</table>

single nucleotide polymorphism-sensitive fish detection of locus-specific ribosomal rna transcription in drosophila melanogaster

In order to ensure sufficient ribosomal RNA (rRNA) is transcribed for ribosome function, genomes contain hundreds of tandem duplications of the sequences that encode rRNAs, composing regions called ribosomal DNA (rDNA) loci. Many organisms' genomes contain more than one rDNA locus distributed across different chromosomes, and rRNA may be transcribed from multiple rDNA loci or only a single locus. Changes in rRNA transcription sources often indicate ribosomal distress. However, the homogeneity of rRNA obstructs distinguishing if rRNA is transcribed from multiple or a single rDNA locus. Here, we describe a method that uses single nucleotide polymorphism-sensitive fluorescence in situ hybridization (SNP-FISH) to distinguish rRNA transcription between Drosophila melanogaster rDNA loci on the X and Y chromosomes. This method leverages locus-specific rRNA variants to enable easy detection of the source of rRNA transcription with single-cell resolution. This assay can be applied to any Drosophila cell type and may be adapted for use in other systems.

Sequencing results from SNP genotyping are expected to detect SNP differences between the X and Y rDNA loci. These SNPs are detected by directly assessing the SNP positions in sequencing chromatograms (Figure 2). Sequencing of female samples is expected to have a single sequencing signal at the SNP position, indicating SNP homozygosity between the two X chromosomes (Figure 2A). Male sample sequencing results are expected to have a double peak at the SNP position (Figure 2B). Based on the X chromosome genotype determined from female sample sequencing, the non-X variant is inferred to be a Y chromosome rDNA SNP (i.e., X = T, Y = C for the 18S SNP sequencing in Figure 2). Alternatively, a single sequencing peak at a SNP position in the male sample would indicate homozygosity between male and female rDNA loci at that SNP position, and that position would not be usable for rRNA SNP-FISH.
Following the protocol for SNP FISH, samples can be visualized by mounting on slides and placed under a sealed cover slip, followed by confocal microscopy. Using the probes listed in Table 3, the Y-derived rRNA signal is detected by Alexa Fluor 647 emission and the X-derived rRNA signal is detected by Alexa Fluor 488 emission. rRNA signals are expected to be observed in the nucleolus, which can be identified as the DAPI-poor hole in the nucleus (Figure 3A). The nucleolus is particularly easy to identify in germ cells due to their large nucleus and nucleolus (Figure 3A). The faint signal can typically also be found in the cytoplasm (Figure 3), but this is a non-specific signal that can also be detected in samples without rRNA containing a complementary SNP (i.e., Y signal in cells lacking Y rDNA or X signal in cells lacking X rDNA; Figure 3B-C). Furthermore, artificial co-labeling of X and Y rRNA can sometimes be detected in the somatic hub, even in samples lacking either X or Y rDNA loci (Figure 3B-C, yellow arrows). Thus, only nuclear signals should be used to assess locus-specific transcription. Most cells, particularly somatic cells, are expected to only have a Y rRNA signal, indicating that rRNA is exclusively transcribed from the Y rDNA locus (Figure 3A, yellow dotted circle, and red arrow)10,17. However, co-expression of X and Y rRNA is often detected in germ cells, particularly germline stem cells13 (Figure 3A, white dotted circles). X and Y rRNA signals in co-expressing cells can be adjacent and form a single nucleolus (Figure 3A top cell) or can be separate, forming two nucleoli (Figure 3A bottom cell).The examples in Figure 3 are provided from rDNA SNP-FISH using probe sets targeting only two SNPs (the two ITS1 SNPs), demonstrating only two SNPs are necessary for rDNA SNP-FISH. However, more robust signals are observed when using probes targeting all four SNPs13.
Negative controls are an important inclusion for this assay to confirm that probes do not cross-react with the wrong SNP target, especially when first troubleshooting the method. X chromosome negative controls include any condition that lacks X chromosome rDNA, such as males harboring an X chromosome with an rDNA deletion. The X chromosome negative controls are expected to only detect Y rRNA signal and no X rRNA (Figure 3B). Y chromosome negative controls include any condition that lacks Y chromosome rDNA. Some examples of these conditions are any XX female tissues, tissue from males lacking a Y chromosome, or males harboring a Y chromosome with an rDNA deletion15. The Y chromosome negative controls are expected to only detect X rRNA signal and have no detectable Y rRNA signal (Figure 3C). Note that these controls are not only important to determine probe specificity, but also to determine any signal background or artifacts. Any novel probes or assay conditions that provide specificity in such controls can be accurately used to detect locus-specific rDNA transcription.
Different genetic, developmental, or environmental conditions may alter the likelihood that rDNA is exclusively transcribed from the Y-chromosome rDNA locus13,17. The frequency of rDNA transcription from a single locus or multiple loci can be quantified and directly compared between samples. In order to quantitatively compare differences in rDNA locus transcription, each cell must be individually categorized as Y-dominant, Co-dominant, or X-dominant. Cells are only categorized as Y- and X-dominant if only that respective signal is detected. Any cell with both Y and X rRNA signals is considered co-dominant, even if one signal is much weaker than the other. Thus, cells containing very strong X and Y signals are qualitatively considered the same as cells with strong Y and weak X or strong X and weak Y signals. The total percentage of all cells across all samples in each category can be compared between samples by chi-squared test. While this assay works well to qualitatively determine if a particular rDNA locus is transcribed or not, we have not observed consistent evaluations between samples when directly quantifying the fluorescence intensity of individual SNP-FISH signals. Thus, we do not recommend making quantitative assessments of FISH signal intensity between samples or the relative intensity of X and Y rDNA signals within a single cell. The source of this inconsistency in fluorescence intensity is unclear, though it may be due to the inefficient binding of masked probes that do not bind to all of the target rRNAs.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/67881/67881fig01.jpg" /> 
Figure 1: Diagram of SNP-FISH method. (A) Traditional FISH antisense oligonucleotide probes cross-react with non-target RNAs that differ by only one nucleotide. (B) The SNP-FISH method uses complementary mask oligonucleotide bound to the 3&#39; region of the oligonucleotide probe. The mask leaves only 10 nucleotides free to bind to the target sequence. An unmasked probe region does not stably bind to non-target sequences that differ by one or more nucleotides. Mask dissociates from probe after probe binds to target, allowing stable binding between probe and target. (C) Differently labeled paired SNP probes combined with a common mask specifically bind targets that differ by a single nucleotide without cross-reacting. (D) Multiple probes can be pooled together to specifically label distinct rRNA haplotypes. Four SNP differences have been characterized between X and Y rDNA loci in the y1w1 Drosophila melanogaster strain. One SNP in the 18S rRNA, one in the 28S rRNA, and two in the ITS1 portion of the pre-rRNA. X and Y-specific rRNA haplotypes used for SNP-FISH are displayed. Probes targeting the X rDNA variant at the four rRNA SNPs are conjugated to a common fluorophore (green), and probes targeting the Y rDNA variants are conjugated to a different fluorophore (magenta). A common mask is used for each SNP (four total). SNP-specific probe binding at each SNP position on the rRNA can specifically label rRNA from the X and Y rDNA loci with up to four FISH oligonucleotide probes. <a href="https://www.jove.com/files/ftp_upload/67881/67881fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/67881/67881fig02.jpg" /> 
Figure 2: Examples of homozygous and heterozygous rDNA SNP sequencing results. Example sequencing chromatograms from 18S SNP sequencing of DNA from (A) female and (B) male samples. 18S SNP position indicated by an asterisk (*). The single thymine (T) signal for the SNP position in the female sample indicates a thymine at the SNP position in the X chromosome rDNA locus. The double signal at the SNP position split between thymine and cytosine (C) in the male sample indicates a cytosine at the SNP position in the Y chromosome rDNA locus (inferred by knowing thymine is at the X chromosome locus). Sequencing results were viewed using ApE &#8211; a plasmid editor software19. <a href="https://www.jove.com/files/ftp_upload/67881/67881fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/67881/67881fig03.jpg" /> 
Figure 3: Examples of SNP-FISH results in the Drosophila testis using only two SNP-FISH probe sets. SNP FISH examples in the testis of animals with (A)both X and Y rDNA,(B) only Y rDNA, or (C)&#160;only X rDNA. These examples only used probe sets labeling the two ITS1 rRNA SNPs, demonstrating that rRNA SNP FISH works with as little as two target SNPs. Germ cells are identified by their large round nucleus, and somatic cells by their smaller and less round nucleus. Germline stem cells are identified by their position directly next to the somatic hub, marked by an asterisk (*). Germ cells that transcribe rDNA from both the X and Y rDNA loci are identified by both X and Y nuclear FISH signals (White dotted circles, A-A&#39;&#39;). Germ cells that transcribe DNA from only the Y rDNA locus only have a Y nuclear FISH signal (Yellow dotted circle). Y-only expressing somatic cells are marked with a red arrow. Artificial co-labeling of X and Y rDNA loci can be observed in the somatic hub (yellow arrow). The scale bar is 10 &#181;m. <a href="https://www.jove.com/files/ftp_upload/67881/67881fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplementary File 1: rRNA sequence of X chromosome locus. <a href="https://www.jove.com/files/ftp_upload/67881/Dm_45S_rRNA.zip" target="_blank">Please click here to download this File.</a>

The protocol describes single nucleotide polymorphisms-sensitive fluorescence in situ hybridization (SNP-FISH) method to distinguish ribosomal RNA transcripts derived from the X or Y chromosome ribosomal DNA locus in Drosophila melanogaster.

Single Nucleotide Polymorphism-sensitive FISH Detection of Locus-specific Ribosomal RNA Transcription in Drosophila melanogaster

In order to ensure sufficient ribosomal RNA (rRNA) is transcribed for ribosome function, genomes contain hundreds of tandem duplications of the sequences ...

single-nucleotide-polymorphism-sensitive-fish-detection-locus

Research

JoVE Journal

Genetics

71 vues.  Stony Brook University. The protocol describes single nucleotide polymorphisms-sensitive fluorescence in situ hybridization (SNP-FISH) method to distinguish ribosomal RNA transcripts derived from the X or Y chromosome ribosomal DNA locus in Drosophila melanogaster.

Vidéo: Single Nucleotide Polymorphism-sensitive FISH Detection of Locus-specific Ribosomal RNA Transcription in Drosophila melanogaster

The Visual Colorimetric Detection of Multi-nucleotide Polymorphisms on a Pneumatic Droplet Manipulation Platform

A simple and visual method to detect multi-nucleotide polymorphism (MNP) was performed on a pneumatic droplet manipulation platform on an open surface. This approach to colorimetric DNA detection was based on the hybridization-mediated growth of gold nanoparticle probes (AuNP probes). The growth size and configuration of the AuNP are dominated by the number of DNA samples hybridized with the probes. Based on the specific size- and shape-dependent optical properties of the nanoparticles, the number of mismatches in a sample DNA fragment to the probes is able to be discriminated. The tests were conducted via droplets containing reagents and DNA samples respectively, and were transported and mixed on the pneumatic platform with the controlled pneumatic suction of the flexible PDMS-based superhydrophobic membrane. Droplets can be delivered simultaneously and precisely on an open-surface on the proposed pneumatic platform that is highly biocompatible with no side effect of DNA samples inside the droplets. Combining the two proposed methods, the multi-nucleotide polymorphism can be detected at sight on the pneumatic droplet manipulation platform; no additional instrument is required. The procedure from installing the droplets on the platform to the final result takes less than 5 min, much less than with existing methods. Moreover, this combined MNP detection approach requires a sample volume of only 10 &#181;l in each operation, which is remarkably less than that of a macro system.

This work presents a simple and visual method to detect multi-nucleotide polymorphisms on a pneumatic droplet manipulation platform. With the proposed method, the entire experiment, including droplet manipulation and detection of multi-nucleotide polymorphisms, can be performed near 23 &#176;C without the aid of advanced instruments.

La détection Colorimétrie visuelle de Multi-nucleotide polymorphismes sur une plate-forme de manipulation pneumatique Droplet

A simple and visual method to detect multi-nucleotide polymorphism (MNP) was performed on a pneumatic droplet manipulation platform on an open surface. ...

Recherche

Génétique

Detection of Copy Number Alterations Using Single Cell Sequencing

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and microbial populations. Traditional methods for assessing genetic heterogeneity have been limited by low resolution, low sensitivity, and/or low specificity. Single cell sequencing has emerged as a powerful tool for detecting genetic heterogeneity with high resolution, high sensitivity and, when appropriately analyzed, high specificity. Here we provide a protocol for the isolation, whole genome amplification, sequencing, and analysis of single cells. Our approach allows for the reliable identification of megabase-scale copy number variants in single cells. However, aspects of this protocol can also be applied to investigate other types of genetic alterations in single cells.

Single cell sequencing is an increasingly popular and accessible tool for addressing genomic changes at high resolution. We provide a protocol that uses single cell sequencing to identify copy number alterations in single cells.

Détection de Copy Number Transformations Utilisation unique cellule de séquençage

Detection of genomic changes at single cell resolution is important for characterizing genetic heterogeneity and evolution in normal tissues, cancers, and ...

Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species.
Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family,&#160;it could be easily used to other prokaryote and eukaryote species

Here, we present a protocol for tracing genomic DNA (gDNA) contamination in RNA samples. The presented method utilizes primers specific for the internal transcribed spacer region (ITS) of ribosomal DNA (rDNA) genes. The method is suited for reliable and sensitive detection of DNA contamination in most eukaryotes and prokaryotes.

Évaluation de la Contamination d’ADN dans les échantillons d’ARN issu de l’ADN ribosomique

One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time ...

Quantifying Abdominal Pigmentation in Drosophila melanogaster

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for understanding the development and evolution of morphological phenotypes. Abdominal pigmentation in Drosophila melanogaster has been particularly useful, allowing researchers to identify the loci that underlie inter- and intraspecific variations in morphology. Hitherto, however, D. melanogaster abdominal pigmentation has been largely assayed qualitatively, through scoring, rather than quantitatively, which limits the forms of statistical analysis that can be applied to pigmentation data. This work describes a new methodology that allows for the quantification of various aspects of the abdominal pigmentation pattern of adult D. melanogaster. The protocol includes specimen mounting, image capture, data extraction, and analysis. All the software used for image capture and analysis feature macros written for open-source image analysis. The advantage of this approach is the ability to precisely measure pigmentation traits using a methodology that is highly reproducible across different imaging systems. While the technique has been used to measure variation in the tergal pigmentation patterns of adult D. melanogaster, the methodology is flexible and broadly applicable to pigmentation patterns in myriad different organisms.

Quantifying Abdominal Pigmentation in Drosophila melanogaster

This work presents a method to quickly and precisely quantify the abdominal pigmentation of Drosophila melanogaster using digital image analysis. This method streamlines the procedures between phenotype acquisition and data analysis and includes specimen mounting, image acquisition, pixel value extraction, and trait measurement.

Quantifier la pigmentation abdominale dans<em&gt; Drosophila melanogaster</em

Pigmentation is a morphologically simple but highly variable trait that often has adaptive significance. It has served extensively as a model for ...

High Fat Diet Feeding and High Throughput Triacylglyceride Assay in Drosophila Melanogaster

Heart disease is the number one cause of human death worldwide. Numerous studies have shown strong connections between obesity and cardiac malfunction in humans, but more tools and research efforts are needed to better elucidate the mechanisms involved. For over a century, the genetically highly tractable model of Drosophila has been instrumental in the discovery of key genes and molecular pathways that proved to be highly conserved across species. Many biological processes and disease mechanisms are functionally conserved in the fly, such as development (e.g., body plan, heart), cancer, and neurodegenerative disease. Recently, the study of obesity and secondary pathologies, such as heart disease in model organisms, has played a highly critical role in the identification of key regulators involved in metabolic syndrome in humans.
Here, we propose to use this model organism as an efficient tool to induce obesity, i.e., excessive fat accumulation, and develop an efficient protocol to monitor fat content in the form of TAGs accumulation. In addition to the highly conserved, but less complex genome, the fly also has a short lifespan for rapid experimentation, combined with cost-effectiveness. This paper provides a detailed protocol for High Fat Diet (HFD) feeding in Drosophila to induce obesity and a high throughput triacylglyceride (TAG) assay for measuring the associated increase in fat content, with the aim to be highly reproducible and efficient for large-scale genetic or chemical screening. These protocols offer new opportunities to efficiently investigate regulatory mechanisms involved in obesity, as well as provide a standardized platform for drug discovery research for rapid testing of the effect of drug candidates on the development or prevention of obesity, diabetes and related metabolic diseases.

High Fat Diet Feeding and High Throughput Triacylglyceride Assay in Drosophila Melanogaster

This is a high fat diet feeding protocol to induce obesity in Drosophila, a model for understanding fundamental molecular mechanisms implicated in lipotoxicity. It also provides a high throughput triacylglyceride assay for measuring fat accumulation in Drosophila and potentially other (insect) models under various dietary, environmental, genetic or physiological conditions.

Alimentation de régime riche en graisses et haut débit triacylglycérides essai chez Drosophila Melanogaster

Heart disease is the number one cause of human death worldwide. Numerous studies have shown strong connections between obesity and cardiac malfunction in ...

Semi-quantitative Detection of RNA-dependent RNA Polymerase Activity of Human Telomerase Reverse Transcriptase Protein

Human telomerase reverse transcriptase (TERT) is the catalytic subunit of telomerase, and it elongates telomere through RNA-dependent DNA polymerase activity. Although TERT is named as a reverse transcriptase, structural and phylogenetic analyses of TERT demonstrate that TERT is a member of right-handed polymerases, and relates to viral RNA-dependent RNA polymerases (RdRPs) as well as viral reverse transcriptase. We firstly identified RdRP activity of human TERT that generates complementary RNA stand to a template non-coding RNA and contributes to RNA silencing in cancer cells. To analyze this non-canonical enzymatic activity, we developed RdRP assay with recombinant TERT in 2009, thereafter established in vitro RdRP assay for endogenous TERT. In this manuscript, we describe the latter method. Briefly, TERT immune complexes are isolated from cells, and incubated with template RNA and rNTPs including radioactive rNTP for RdRP reaction. To eliminate single-stranded RNA, reaction products are treated with RNase I, and the final products are analyzed with polyacrylamide gel electrophoresis. Radiolabeled RdRP products can be detected by autoradiography after overnight exposure.

Human telomerase reverse transcriptase (TERT) synthesizes not only telomeric DNA but also double-stranded RNA through RNA-dependent RNA polymerase activity. Here, we describe a newly established assay to detect RNA-dependent RNA polymerase activity of endogenous TERT.

Détection semi-quantitative de l’activité de l’ARN polymérase ARN-dépendante de protéine de Transcriptase inverse de la télomérase humaine

Human telomerase reverse transcriptase (TERT) is the catalytic subunit of telomerase, and it elongates telomere through RNA-dependent DNA polymerase ...

Measuring Exercise Levels in Drosophila melanogaster Using the Rotating Exercise Quantification System (REQS)

Drosophila melanogaster is a new model organism for studies in exercise biology. To date, two main exercise systems, the Power Tower and the Treadwheel have been described. However, a method to measure the amount of additional animal activity induced through the exercise treatment has been lacking. The Rotating Exercise Quantification System (REQS) fills this need, providing a measure of animal activity for animals experiencing rotational exercise. This protocol details how to use the REQS to assess animal activity during rotational exercise and illustrates the type of data that can be generated. Here, we demonstrate how the REQS is used to measure sex- and strain-specific differences in exercise induced activity. The REQS can also be used to evaluate the impact of various other experimental parameters such as age, diet, or population size on exercise induced activity. In addition, it can be used to compare the efficacy of different exercise training protocols. Importantly, it provides an opportunity to standardize exercise treatments between strains, allowing the researcher to achieve equal amounts of activity between groups if needed. Thus, the REQS is a notable new resource for exercise biologists working with the Drosophila model system and complements existing exercise systems.

Measuring Exercise Levels in Drosophila melanogaster Using the Rotating Exercise Quantification System REQS

The Rotating Exercise Quantification System (REQS) can induce exercise in Drosophila melanogaster through rotation while simultaneously measuring the amount of activity performed by the animals. Here, we present a point-by-point protocol detailing how to measure activity levels of animals experiencing rotational exercise treatments using the REQS.

Mesurer les niveaux de l’exercice chez Drosophila melanogaster en utilisant le système tournant de Quantification à l’exercice (REQS)

Drosophila melanogaster is a new model organism for studies in exercise biology. To date, two main exercise systems, the Power Tower and the Treadwheel ...

The TreadWheel: Interval Training Protocol for Gently Induced Exercise in Drosophila melanogaster

The incidence of complex metabolic diseases has increased as a result of a widespread transition towards lifestyles of increased caloric intake and lowered activity levels. These multifactorial diseases arise from a combination of genetic, environmental, and behavioral factors. One such complex disease is Metabolic Syndrome (MetS), which is a cluster of metabolic disorders, including hypertension, hyperglycemia, and abdominal obesity. Exercise and dietary intervention are the primary treatments recommended by doctors to mitigate obesity and its subsequent metabolic diseases. Exercise intervention, in particular aerobic interval training, stimulates favorable changes in the common risk factors for Type 2 Diabetes Mellitus (T2DM), Cardiovascular Disease (CVD), and other conditions. With the influx of evidence describing the therapeutic effect exercise has on metabolic health, establishing a system that models exercise in a controlled setting provides a valuable tool for assessing the effects of exercise in an experimental context. Drosophila melanogaster is a great tool for investigating the physiological and molecular changes that result from exercise intervention. The flies have short lifespans and similar mechanisms of metabolizing nutrients when compared to humans. To induce exercise in Drosophila, we developed a machine called the TreadWheel, which utilizes the fly&#39;s innate, negative geotaxis tendency to gently induce climbing. This enables researchers to perform experiments on large cohorts of genetically diverse flies to better understand the genotype-by-environment interactions underlying the effects of exercise on metabolic health.

The TreadWheel: Interval Training Protocol for Gently Induced Exercise in Drosophila melanogaster

The TreadWheel uses rotational motion to gently induce exercise in adult Drosophila melanogaster by exploiting flies&#39; innate, negative geotaxis. It allows for analysis of the interactions between exercise and factors, such as genotype, sex, and diet, and their effect on physiological and molecular assays to assess metabolic health.

La médiévale : Interval Training protocole pour doucement les exercice induit chez Drosophila melanogaster

The incidence of complex metabolic diseases has increased as a result of a widespread transition towards lifestyles of increased caloric intake and ...

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), quantitative, real-time RT-PCR (RT-qPCR) and RNA sequencing. When these techniques are performed using a single oocyte or embryo, low-copy mRNAs are not reliably detected. To overcome this problem, oocytes or embryos can be pooled together for analysis; however, this often leads to high variability amongst samples. In this protocol, we describe the use of fluorescence in situ hybridization (FISH) using branched DNA chemistry. This technique identifies the spatial pattern of mRNAs in individual cells. When the technique is coupled with Spot Finding and Tracking&#160;computer software, the abundance of mRNAs in the cell can also be quantified. Using this technique, there is reduced variability within an experimental group and fewer oocytes and embryos are required to detect significant differences between experimental groups. Commercially available branched-DNA SM-FISH kits have been optimized to detect mRNAs in sectioned tissues or adherent cells on slides. However, oocytes do not effectively adhere to slides and some reagents in the kit were too harsh resulting in oocyte lysis. To prevent this lysis, several modifications were made to the FISH kit. Specifically, oocyte permeabilization and wash&#160;buffers designed for the immunofluorescence of oocytes and embryos replaced the proprietary buffers. The permeabilization, washes, and incubations with probes and amplifier were performed in 6-well plates and oocytes were placed on slides at the end of the protocol using mounting media. These modifications were able to overcome the limitations of the commercially available kit, in particular, the oocyte lysis. To accurately and reproducibly count the number of mRNAs in individual oocytes, computer software was used. Together, this protocol represents an alternative to PCR and sequencing to compare the expression of specific transcripts in single cells.

Use of Single Molecule Fluorescent In Situ Hybridization SM-FISH to Quantify and Localize mRNAs in Murine Oocytes

To reproducibly count the numbers of mRNAs in individual oocytes, single molecule RNA fluorescence in situ hybridization (RNA-FISH) was optimized for non-adherent cells. Oocytes were collected, hybridized with the transcript specific probes, and quantified using an image quantification software.

Utilisation d’unique molécule fluorescente hybridation In Situ (FISH-SM) afin de quantifier et Localize ARNm dans les ovocytes murin

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), ...

Evaluation of a Universal Nested Reverse Transcription Polymerase Chain Reaction for the Detection of Lyssaviruses

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription polymerase chain reaction (nested RT-PCR) was developed to detect the conserved region of the nucleoprotein (N) gene of lyssaviruses. The method applies reverse transcription (RT) using viral RNA as template and oligo (dT)15 and random hexamers as primers to synthesize the viral complementary DNA (cDNA). Then, the viral cDNA is used as a template to amplify an 845 bp N gene fragment in first-round PCR using outer primers, followed by second-round nested PCR to amplify the final 371 bp fragment using inner primers. This method can detect different genetic clades of rabies viruses (RABV). The validation, using 9,624 brain specimens from eight domestic animal species in 10 years of clinical rabies diagnoses and surveillance in China, showed that the method has 100% sensitivity and 99.97% specificity in comparison with the direct fluorescent antibody test (FAT), the gold standard method recommended by the World Health Organization (WHO) and the World Organization for Animal Health (OIE). In addition, the method could also specifically amplify the targeted N gene fragment of 15 other approved and two novel lyssavirus species in the 10th Report of the International Committee on Taxonomy of Viruses (ICTV) as evaluated by a mimic detection of synthesized N gene plasmids of all lyssaviruses. The method provides a convenient alternative to FAT for rabies diagnosis and has been approved as a National Standard (GB/T36789-2018) of China.

A pan-lyssavirus nested reverse transcription polymerase chain reaction has been developed to detect specifically all known lyssaviruses. Validation using rabies brain samples of different animal species showed that this method has a sensitivity and specificity equivalent to the gold standard fluorescent antibody test and could be used for routine rabies diagnosis.

Évaluation d’une réaction en chaîne de polymérase de transcription inverse imbriquée universelle pour la détection des lyssavirus

To detect rabies virus and other member species of the genus Lyssavirus within the family Rhabdoviridae, the pan-lyssavirus nested reverse transcription ...