עבודה זו נתמכה על ידי המכונים הלאומיים לבריאות (NIH) מענקי CA127231 ופרס דיימון רניון קרן החוקר קליני (CI 1502) (לSM). ברצוננו להודות לפרופסור זדנק דבוז&#39;ק מPalacky אוניברסיטת אולומוץ, צ&#39;כיה לתובנה מועילות שלו לדיון בניידות של טכניקה זו למוסד וסטנדרטיזציה של פרוטוקול שלהם.

1. בניית PXR וSRC-1 Fusions בוקטורי שמרים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ההגברה PCR של אדם PXR LBD (107-434 חומצות אמינו) וSRC-1 אורך אנוש מלא (1-1,401 חומצות אמינו). <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> השתמש פלסמיד pSG5-hPXR 8 כתבנית PXR LBD, השתמש פלסמיד pCMX-src1 כSRC-1 תבניות. </li><li style=";text-align:right;direction:rtl"> הפשירו PCR Supermix, תבניות ה-DNA ופריימרים (ראה חומרים), לשמור אותם על קרח. </li><li style=";text-align:right;direction:rtl"> הוספת 0.25 מיקרוגרם / תבנית ה-DNA μl μl 1, זוגות פריימר 10 מ&quot;מ 2 μl כל אחד, PCR Supermix 45 μl ולהוסיף H 2 O להביא נפח כולל 50 μl. </li><li style=";text-align:right;direction:rtl"> הגדרת ה-PCR במחזור אחד של 94 מעלות צלזיוס למשך 2 דקות, 20 מחזורים של 94 מעלות צלזיוס במשך 30 שניות, 55 מעלות צלזיוס במשך 30 שניות ו72 מעלות צלזיוס למשך 2 דקות, ולאחר מכן מחזור של 72 ° C אחד עבור 10 דקות להארכה. בדקו מוצרי ה-PCR בריצה על 1% agarose ג&#39;ל. </li></ol></li><li style=";text-align:right;direction:rtl"> מוצרי ה-PCR שיבוט לתוך וקטורי Y2H. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לטהר את מוצרי ה-PCR מ1% agarose ג&#39;ל. Digest PXR, LBD, PCR, וY2H וקטור pSH2-1 עםBamHI וסאלי; לעכל SRC-1-PCR וpGADNOT וקטור Y2H עם NotΙ וSalΙ. כדי לעשות זאת, להוסיף DNA 1 מיקרוגרם, 3 μl חיץ תגובת 10x, אנזימי הגבלת μl 1, ולבסוף H 2 O להביא נפח הכולל עד 30 μl. </li><li style=";text-align:right;direction:rtl"> שים דגימות עיכול ב37 אמבט מים C ° במשך שעה 1. בדוק עיכול על ידי הפעלה על 1% agarose ג&#39;ל. </li><li style=";text-align:right;direction:rtl"> לטהר דגימות עיכול מ1% agarose ג&#39;ל, ולקשור מתעכלים מוצרי ה-PCR ווקטורי Y2H ולהפוך לתאים המוסמכים DH5α. </li><li style=";text-align:right;direction:rtl"> פיק המושבות ולבודד את ה-DNA פלסמיד. </li></ol></li><li style=";text-align:right;direction:rtl"> זיהוי ה-DNA פלסמיד pSH2-1-PXR ידי עיכול BamHI / סאלי, לזהות פלסמיד דנ&quot;א pGADNOT-SRC-1 על ידי עיכול NotI / סאלי. ודא שכל פלסמיד דנ&quot;א החיובי על ידי רצף. </li></ol> 2. מבחני דו היברידי שמרים <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לחסן זן השמרים לתוך 5 YPAD מיליליטר ו דגירה במשך הלילה על ידי תסיסה מתמדת (220 סל&quot;ד ב30 מעלות צלזיוס). הערה: זן שמר האפייה היה CTY10-5D(MAT TRP ade2 1-901 LEU2-3, 112 his3-200 ga l4 - gal80 - URA3 :: LexA-lacZ) המכיל גן GAL1-lacZ משולב עם LexA מפעיל 10. כדי להשיג תאי שמרי קיימא עמידים לketoconazole, אבל אלה שלא נשאו שינויי טרנספורטר כגורם להתנגדות azole 18-20, זנים חדשים של שמרי CTY10-5D התקבלו על ידי ERG3 הראשון מחיקה (Δ erg3) ולאחר מכן החדרת מחיקה נוספת ב ERG11 (erg3 Δ / Δ erg11) גנים על ידי רקומבינציה הומולוגית. פרטי הבנייה תוארו בכתב יד שפורסם בעבר 6. </li><li style=";text-align:right;direction:rtl"> למחרת (בבוקר), לחסן שמרים (1:20) ב5 YAPD מיליליטר דגירה להשיג OD 600 ~ 0.2 ידי תסיסה מתמדת (220 סל&quot;ד ב30 מעלות צלזיוס). </li><li style=";text-align:right;direction:rtl"> גלולה התאים ב 2,000 סל&quot;ד בmicrocentrifuge למשך 2 דקות וזורקים supernatant. לאחר מכן לשטוף את פלהפעמיים עם מים autoclaved ופעם אחת עם 0.1 M LiAc לא. </li><li style=";text-align:right;direction:rtl"> לאחר לשטוף הסופי, להשליך supernatant ולהוסיף את ריאגנטים הבאים לתא גלולה: 240 μl PEG 3,500 50% w / v, 36 μl 1 M LiAc, 50 μl 2 מ&quot;ג / ssDNA זרע סלמון מבושל מיליליטר, H 2 O 34 μl. מערבולת לערבב, להוסיף 1 מיקרוגרם הפש-PXR ו-DNA pGADNOT-SRC-1 1 מיקרוגרם ומערבבים. </li><li style=";text-align:right;direction:rtl"> מעביר את התערובת לפוליסטירן צינור עגול תחתון, להתסיס את השינוי, לערבב (220 סל&quot;ד ב30 מעלות צלזיוס) במשך 30 דקות. העבר את הצינור ל42 אמבט המים C ° דגירה במשך 30 דקות נוספות. </li><li style=";text-align:right;direction:rtl"> צנטריפוגות הצינור ב2,000 סל&quot;ד במשך 2 דקות ולהסיר את supernatant. לשטוף גלולה פעם אחת עם מים autoclaved. </li><li style=";text-align:right;direction:rtl"> מים סטריליים 100 μl פיפטה לתוך הצינור, מחדש להשעות את התאים על ידי אצבע עדינה הקשה וpipetting, אז צלחת על גבי צלחות של -His/-Leu נשירה בינונית (גיבוש לליטר אחד -His/-Leu נשירה בינוני: 20 דקסטרוז גרם, 1.7 YNB גרם, CSM-His/-Leu 0.67 גרם, אמוניום סולפט 5 גרם, אגר 1.5%) וincubate ב30 מעלות צלזיוס במשך 3-4 ימים לבודד transformants. </li></ol> 3. Assay סינון X-gal <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> חותכים קרום ניטרוצלולוזה לגודל של חלק מצלחת פטרי. תווית קרום ניטרוצלולוזה כדי לסמן את הכיוון. </li><li style=";text-align:right;direction:rtl"> מקום קרום ניטרוצלולוזה premarked על שמרי מושבות, לוודא כי הקרום נמצא במגע עם פני השטח של מדיום הצלחת. </li><li style=";text-align:right;direction:rtl"> להסיר את הקרום, למקם אותו בצד מושבה על נייר סינון 3 מ&quot;מ, ולמקם את הקרום ונייר הסינון ב -80 מעלות צלזיוס במשך 15 דקות. </li><li style=";text-align:right;direction:rtl"> הפוך פתרון X-gal. הוסף 50 μl 20 מ&quot;ג / מיליליטר X-gal ו -15 μl β-mercaptoethanol עד 5 מיליליטר של Z-חיץ (חיץ L 1 מכיל 16.1 גרם Na 2 HPO 4 7H 2 O, 2 PO 4 H 2 O, גרם 0.75 5.5 אא g KCl, 0.25 גרם MgSO 4 • 7H 2 O). אם Z הצפת נשמרה על 4 מעלות צלזיוס, להביא אותו לטמפרטורת חדר לפני הוספת חומרים כימיים אלה. </li><li style=";text-align:right;direction:rtl"> הנח שני עיגולים של נייר סינון 3 מ&quot;מבצלחת פטרי ולהשרות אותם עם 5 מיליליטר פתרון X-gal. מסננים חיץ עודף מצלחת פטרי והנח את קרום ניטרוצלולוזה עם הצד עד המושבה. </li><li style=";text-align:right;direction:rtl"> סגור את המכסה, להבטיח כי הממברנה היא מגע מלא עם נייר הסינון והוא רטוב לגמרי. עטוף את צלחת פטרי בנייר כסף ולדגור על 37 מעלות צלזיוס במשך 30 דקות ללילה. </li></ol> 4. Assay β-gal הנוזלי <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> לגדול שמרים במדיום נוזלי -His/-Leu נשירה לOD 600 0.7. </li><li style=";text-align:right;direction:rtl"> בינוני מיליליטר העברת 1 לתוך צינור 1.5 מיליליטר microcentrifuge ו צנטריפוגות ב 3,000 סל&quot;ד במשך 2 דקות. בטל supernatant. </li><li style=";text-align:right;direction:rtl"> הוסף 1 מיליליטר של Z הצפת לresuspend את הכדור, צנטריפוגות ב 3,000 סל&quot;ד שוב למשך 2 דקות. בטל supernatant. </li><li style=";text-align:right;direction:rtl"> הוסף 150 μl של Z הצפת עם 2ME לresuspend התא גלולה, לערבב ולאחר מכן להוסיף 50 כלורופורם μl ו20 μl SDS .0.1%. במרץ מערבולת המדגם עבור 15 שניות. </li><li style=";text-align:right;direction:rtl"> הוסף 700 μl של ONPG פתרון (1 מ&quot;ג / מיליליטר בbuf Zfer). לכוון את השעון, דגירה על 30 מעלות צלזיוס ארוכות מספיק כדי לאפשר את הצבע הצהוב כדי לפתח ולב כולל זמן תגובה. </li><li style=";text-align:right;direction:rtl"> הוסף 500 μl של 1 M Na 2 CO 3 כדי לעצור את התגובה ולקבוע את הספיגה ב 420 ננומטר. הריק הוא פתרון 700 μl ONPG תוספת 500 μl 1 M Na 2 CO 3. </li></ol> חישוב יחידות מילר כדלקמן: מילר יחידות = (Å420 * 1,000) / (A600 * דקות מיליליטר *) Å420: יחידות הספיגה ב 420 ננומטר; A600: יחידות הספיגה ב 600 ננומטר; דקות: זמן התגובה בדקות; מיליליטר: נפח התגובה במ&quot;ל

<ol>
	<li>Kliewer, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+orphan+nuclear+receptor+activated+by+pregnanes+defines+a+novel+steroid+signaling+pathway.">An orphan nuclear receptor activated by pregnanes defines a novel steroid signaling pathway.</a> Cell. 92 (1), 73-82 (1998).</li><li>Blumberg, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=a+novel+steroid+and+xenobiotic-sensing+nuclear+receptor.">a novel steroid and xenobiotic-sensing nuclear receptor.</a> Genes Dev. 12 (20), 3195-3205 (1998).</li><li>Biswas, A., Mani, S., Redinbo, M. R., Krasowski, M. D., Li, H., Ekins, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Elucidating+the+'Jekyll+and+Hyde'+Nature+of+PXR:+The+Case+for+Discovering+Antagonists.">Elucidating the 'Jekyll and Hyde' Nature of PXR: The Case for Discovering Antagonists.</a> Pharm. Res. 26 (8), 1807-1815 (2009).</li><li>Pondugula, S. R., Mani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pregnane+xenobiotic+receptor+in+cancer+pathogenesis+and+therapeutic+response.">Pregnane xenobiotic receptor in cancer pathogenesis and therapeutic response.</a> Cancer Lett. 328 (1), 1-9 (2013).</li><li>Mani, S., Dou, V., Redinbo, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PXR+antagonists+and+implications+for+drug+metabolism.">PXR antagonists and implications for drug metabolism.</a> Drug Metab. Rev. 45 (1), 60-72 (2013).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Yeast-Based+Strategy+Unveils+Antagonist+Binding+Regions+on+the+Nuclear+Xenobiotic+Receptor+PXR.">Novel Yeast-Based Strategy Unveils Antagonist Binding Regions on the Nuclear Xenobiotic Receptor PXR.</a> J. Biol. Chem. 288 (19), 13655-13668 (2013).</li><li>Hollenberg, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+new+family+of+tissue-specific+basic+helix-loop-helix+proteins+with+a+two-hybrid+system.">Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system.</a> Mol. Cell. Biol. 15 (7), 3813-3822 (1995).</li><li>Vojtek, A. B., Hollenberg, S. M., Cooper, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+Ras+interacts+directly+with+the+serine/threonine+kinase+Raf.">Mammalian Ras interacts directly with the serine/threonine kinase Raf.</a> Cell. 74 (1), 205-214 (1993).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+phytoestrogen+coumestrol+is+a+naturally+occurring+antagonist+of+the+human+pregnane+X+receptor.">The phytoestrogen coumestrol is a naturally occurring antagonist of the human pregnane X receptor.</a> Mol. Endocrinol. 22 (4), 838-857 (2008).</li><li>Kalpana, G. V., Goff, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+homomeric+interactions+of+human+immunodeficiency+virus+type+1+integrase+using+the+yeast+two-hybrid+system.">Genetic analysis of homomeric interactions of human immunodeficiency virus type 1 integrase using the yeast two-hybrid system.</a> Proc. Natl. Acad. Sci. U.S.A. 90 (22), 10593-10597 (1993).</li><li>Hamdi, A., Colas, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yeast+two-hybrid+methods+and+their+applications+in+drug+discovery.">Yeast two-hybrid methods and their applications in drug discovery.</a> TiPS. 33 (2), 109-118 (2012).</li><li>Battesti, A., Bouveret, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+bacterial+two-hybrid+system+based+on+adenylate+cyclase+reconstitution+in+Escherichia+coli.">The bacterial two-hybrid system based on adenylate cyclase reconstitution in Escherichia coli.</a> Methods. 58 (4), 325-334 (2012).</li><li>Caufield, J. H., Sakhawalkar, N., Uetz, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+and+optimization+of+yeast+two-hybrid+systems.">A comparison and optimization of yeast two-hybrid systems.</a> Methods. 58 (4), 317-324 (2012).</li><li>Albers, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Automated+yeast+two-hybrid+screening+for+nuclear+receptor-interacting+proteins.">Automated yeast two-hybrid screening for nuclear receptor-interacting proteins.</a> Mol. Cell Proteomics. 4 (2), 205-213 (2005).</li><li>Takeshita, A., Taguchi, M., Koibuchi, N., Ozawa, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Putative+role+of+the+orphan+nuclear+receptor+SXR+(steroid+and+xenobiotic+receptor)+in+the+mechanism+of+CYP3A4+inhibition+by+xenobiotics.">Putative role of the orphan nuclear receptor SXR (steroid and xenobiotic receptor) in the mechanism of CYP3A4 inhibition by xenobiotics.</a> J. Biol. Chem. 277 (36), 32453-32458 (2002).</li><li>Huang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+drug+metabolism+by+blocking+the+activation+of+nuclear+receptors+by+ketoconazole.">Inhibition of drug metabolism by blocking the activation of nuclear receptors by ketoconazole.</a> Oncogene. 26 (2), 258-268 (2007).</li><li>Wang, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activated+pregnenolone+X-+receptor+is+a+target+for+ketoconazole+and+Its+analogs.">Activated pregnenolone X- receptor is a target for ketoconazole and Its analogs.</a> Clin. Cancer Res. 13 (8), 2488-2495 (2007).</li><li>Ghannoum, M. A., Rice, L. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antifungal+agents:+mode+of+action,+mechanisms+of+resistance,+and+correlation+of+these+mechanisms+with+bacterial+resistance.">Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance.</a> Clin. Microbiol. Rev. 12 (4), 501-517 (1999).</li><li>Kaur, R., Bachhawat, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+yeast+multidrug+resistance+pump,+Pdr5p,+confers+reduced+drug+resistance+in+erg+mutants+of+Saccharomyces+cerevisiae.">The yeast multidrug resistance pump, Pdr5p, confers reduced drug resistance in erg mutants of Saccharomyces cerevisiae.</a> Microbiology. 145, 809-818 (1999).</li><li>White, T. C., Marr, K. A., Bowden, R. A., cellular, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical,+cellular,+and+molecular+factors+that+contribute+to+antifungal+drug+resistance.">Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.</a> Clin. Microbiol. Rev. 11 (2), 382-402 (1998).</li><li>Serebriiskii, I. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+peptides,+proteins,+and+drugs+that+selectively+interact+with+protein+targets.">Detection of peptides, proteins, and drugs that selectively interact with protein targets.</a> Genome Res. 12, 1785-1791 (2002).</li><li>Yang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+role+for+PELP1+in+nonandrogenic+activation+of+the+androgen+receptor+in+prostate+cancer.">Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer.</a> Mol Endocrinol. 26 (4), 550-561 (2012).</li><li>Zhan, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+orphan+nuclear+receptor+Nur77+regulates+LKB1+localization+and+activates+AMPK.">The orphan nuclear receptor Nur77 regulates LKB1 localization and activates AMPK.</a> Nat Chem Biol. 8 (11), 897-904 (2012).</li></ol>

אין ניגודי האינטרסים הכריזו.

ב assay Y2H שונה שלנו, זיהינו שאריות חשובות לאינטראקציות ketoconazole על PXR 6. מאז SRC-1 הוא coactivator (ושובט לתוך וקטור pGADNot), אנחנו גם בדקנו האם SRC-1 יכול להפעיל ביטוי lacZ כאשר משובט למערכת הווקטור הפשה והאם זה הייתי משנה את פרופיל ההפעלה ו / או להשפיע על הדליפות של assay שני היברידי ה?...

Assay השמרים שני ההיברידי (Y2H) נעשה שימוש נרחב כדי לגלות אינטראקציות בין חלבונים ולאחרונה לגילוי של מולקולות קטנות, רומן המשבשות קומפלקסי חלבונים אינטראקציה 7, 8, 9, 10, 11. עם זאת, הגישות קונבנציונליות של assay זה, המשמש לגילוי סמים או &quot;להיטים&quot;, אינן מאפשרות זיהוי של שאריות allosteric אינטראקציה של תרכובות כימיקלים בתוך משטחי חלבונים, שכאשר שינו עדיין אינטראקציה ולאפשר לחקירה של השאריות שינו 11 . ואכן, שיטה (ים) כזה, אם אפשרי לפתח, תאפשר מערכת שמרים צייתנית להערכת תפוקה גבוהה של שאריות האינטראקציה allosteric קריטיות לשיבוש אינטראקציה בין חלבונים. בהקשר של גילוי תרופות, הדרך הישירה ביותר להקים אינטראקציה של תרכובות עם חלבונים תהיה כרוכה בקביעה מבנית (למשל התגבשות של קומפלקס חלבון מעכב). שיטות אלה הן בהצטיינותbersome, להשתמש במשאבים משוכללים וזה לא אפשרי מבחינה טכנית לבצע מחקרים מבניים על כל חלבון. מערכות הקרנת סמים גנטיות צייתניות הוקמו בחיידקים 1, 2 ומערכות מודל אחרות כמו שתי ההיברידי של יונקים. עם זאת, מערכות אלו זקוקות לאופטימיזציה ומערכות חלופיות כמו Y2H עדיין נבדקו ביותר בגילוי תרופות. ישנן מגבלות הכוללות רגישות ואמינות של אינטראקציות בשימוש בשיטות ייחודיות 13 עניים, לעומת זאת, assay Y2H אחד יכול להיות שונה כדי לענות על שאלות ספציפיות בנוגע לשאריות אינטראקציה. בתחום מחקר קולטן גרעיני, Y2H נעשה שימוש כדי להגדיר את חלבוני אינטראקציה 14, לעומת זאת, אינטראקציות חלבון אלה רק לעתים נדירות נעשו שימוש כדי להגדיר את האופי שבו ligands / יריבים אינטראקציה עם מתחמי קולטן חלבונים גרעיניים. לפיכך, המעבדה שלנו התמקדה מאמצים בהגדרת שיטה, במיוחד לחלבוני הקולטן שאינםנוח בקלות לproteomic שיטות מבוססות, שיחשוף ליגנד רומן / אנטגוניסט אינטראקציה שאריות באמצעות פלטפורמת גילוי Y2H מבוססת הפוכה. בהתבסס על הממצא הקודם שלנו שketoconazole משבש PXR וactivator SRC-1, פיתחנו רומן הפוך מערכת Y2H שיאפשר לנו להגדיר ולחקור את שאריות ketoconazole האינטראקציה בPXR 6. השיטה שלנו מבוססת על המאפיינים של חלבון GAL4 שמרים שמורכבת מתחומים להפרדה אחראים להפעלת ה-DNA מחייבת ותעתיק. חלבון PXR LBD מבוטא היתוך לתחום LexA-DNA מחייב (DNA-BD), תוך שיתוף מפעילי אורך המלא SRC-1 (coactivator קולטן סטרואידים 1) חלבונים באים לידי ביטוי כהתכה לתחום הפעלת GAL4 (AD ). אינטראקציה בין PXR וחלבונים היתוך SRC-1 מובילה להפעלת תעתיק של אתרי GAL4 מחייבים המכילים גן כתב β-Lac Z המשתלב בשמרים genomדואר. Ketoconazole, אנטגוניסט PXR, משבש PXR ואינטראקציה SRC-1 15, 16, 17 ואנחנו יכולים לזהות את האינטראקציה של PXR וSRC-1 בנוכחותו או היעדריו של ketoconazole לאחר צביעת מושבות במסננים לפעילות X-gal. עיקרון Y2H מודגם באיור 1 והליך הניסוי מסוכם באיור 2.

<table border="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Yeast Strain CTY10-5d erg3&#916;/erg11&#916;</td>
			<td>Our lab</td>
			<td></td>
			<td>CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3&#916;/erg11&#916;) genes6 .</td>
		</tr>
		<tr>
			<td>YPD Growth Medium</td>
			<td>BD Biosciences</td>
			<td>630409</td>
			<td></td>
		</tr>
		<tr>
			<td>Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate</td>
			<td>BD Biosciences</td>
			<td>233520</td>
			<td></td>
		</tr>
		<tr>
			<td>Bacto Agar</td>
			<td>BD Biosciences</td>
			<td>214010</td>
			<td></td>
		</tr>
		<tr>
			<td>CSM-His/-Leu Complete Supplement Mixture</td>
			<td>MP Biomedicals</td>
			<td>4250-412</td>
			<td></td>
		</tr>
		<tr>
			<td>ONPG (o-Nitrophenyl &#914;-D- Galactopyranoside).</td>
			<td>Sigma-Aldrich</td>
			<td>N1127</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-Aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Luria Broth (LB)</td>
			<td>Sigma-Aldrich</td>
			<td>L3022</td>
			<td></td>
		</tr>
		<tr>
			<td>X-Gal</td>
			<td>Fisher</td>
			<td>BP-1615</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicated Salmon Sperm DNA boiled (10 mg/ml)</td>
			<td>Life Technology</td>
			<td>156-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Acros Organics</td>
			<td>61177</td>
			<td></td>
		</tr>
		<tr>
			<td>Ketoconazole</td>
			<td>Sigma-Aldrich</td>
			<td>K1003</td>
			<td></td>
		</tr>
		<tr>
			<td>N,N-Dimethylformamide</td>
			<td>Acros Organics</td>
			<td>326871000</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Sigma-Aldrich</td>
			<td>L4158</td>
			<td></td>
		</tr>
		<tr>
			<td>50% PEG-3350 solution, filter-sterilized</td>
			<td>Sigma-Aldrich</td>
			<td>P-3640</td>
			<td></td>
		</tr>
		<tr>
			<td>Nitrocellulose Membrane</td>
			<td>Whatman</td>
			<td>10402091</td>
			<td></td>
		</tr>
		<tr>
			<td>10 cm Petri Dish</td>
			<td>Fisher</td>
			<td>875712</td>
			<td></td>
		</tr>
		<tr>
		</tr>
	</tbody>
</table>

<table border="1">
	<tbody>
		<tr>
			<td>5&#39;-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD forward primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-AGAGTCGACTCAGCTA CCTGTGATGCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>PXR LBD reverse primer for pSH2-1</td>
		</tr>
		<tr>
			<td>5&#39;-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 forward primer for pGADNOT</td>
		</tr>
		<tr>
			<td>5&#39;-GCGGTCGACTTATTCAGTCA GTAGCTG -3&#39;</td>
			<td>our lab</td>
			<td></td>
			<td>SRC-1 reverse primer for pGADNOT</td>
		</tr>
		<tr>
			<td>Platinum PCR Supermix</td>
			<td>Invitrogen</td>
			<td>11306-016</td>
			<td></td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>our lab</td>
			<td>R0136</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>our lab</td>
			<td>R0138</td>
			<td></td>
		</tr>
		<tr>
			<td>NotI</td>
			<td>our lab</td>
			<td>R0189</td>
			<td></td>
		</tr>
	</tbody>
</table>

reverse yeast two-hybrid system to identify mammalian nuclear receptor residues that interact with ligands and/or antagonists

כרגולטור קריטי של חילוף חומרים בסמים ודלקת, pregnane X קולטן (PXR), ממלא תפקיד חשוב בפתופיזיולוגיה מחלה המקשר את חילוף החומרים ודלקת (למשל steatosis כבד) 1,2. חל התקדמות רבה בזיהוי של ligands אגוניסט לPXR, לעומת זאת, יש תיאורים מוגבלים של יריבים כמו סמים ואתרי הקישור שלהם על PXR 3,4,5. מכשול קריטי היה חוסר היכולת לטהר את יעילות החלבון באורך מלא ללימודים מבניים עם יריבים למרות שPXR שוכפל ומאופיין ב1998. המעבדה שלנו שפותחה על שמרי תפוקה גבוהה רומן מבוסס assay שני ההיברידי להגדיר אנטגוניסט, ketoconazole של, מחייב שאריות על PXR 6. השיטה שלנו כרוכה ביצירת ספריות מוטאציות שתצלנה את ההשפעה של מוטציות בודדות על פני השטח AF-2 של PXR הצפוי לקיים אינטראקציה עם ketoconazole. הצלה או &quot;רווח של הפונקציה&quot; הערוץמוטציות nd יכולים להתבצע כך שמסקנות לגבי האינטראקציה הגנטית של ketoconazole ושאריות המשטח (ים) בPXR הן ריאלי. לכן, פיתחנו תפוקה גבוהה של שני היברידי שמרי מסך של מוטציות PXR אינטראקציה עם coactivator, SRC-1. שימוש בגישה זו, שבה את השמרים שונה כדי להתאים את המחקר של התרופה נגד פטריות, ketoconazole, אנחנו יכולים להפגין מוטציות ספציפיות על PXR מועשרת בשיבוטים מסוגלים להיקשר ketoconazole. לפי היגיון הפוך, אנו מגיעים למסקנה שהשאריות המקוריות הן שאריות אינטראקציה ישירות עם ketoconazole. assay זה מייצג רומן, assay הגנטי הצייתן למסך לאתרי קישור אנטגוניסט על משטחי קולטן גרעיני. assay זה יכול להיות מיושם על כל תרופה ללא קשר לפוטנציאל ציטוטוקסיות שלה לשמרים, כמו גם לחלבון תאי (ים) שלא ניתן ללמוד באמצעות ביולוגיה מבנית סטנדרטית או שיטות proteomic מבוססות. החסרונות פוטנציאליים כוללים פרשנות של נתונים (שיטות משלימות שימושי), רליאהה בשיטה אחת Y2H, מומחיות בטיפול בשמרים או ביצוע מבחני שני היברידי שמרים, וassay אופטימיזציה.

ביצענו assay כדי לראות אם אנחנו יכולים לזהות readout colorimetric של העמותה של PXR וקולטן סטרואידי coactivator-1 (SRC-1). מאז שמרים יש ייצור סטרולים משמעותי, זה כבר בעבר הראה כי ביטוי lacZ בשמרים יכול להיגרם ללא הצורך יגנד אקסוגניים נוסף. מצאנו כי ביטוי lacZ (מושבות כחולות) הוא גם מושרה בזן השמרי...

Watch this Scientific Journal Video about Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists at JoVE.com

Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Ketoconazole נקשר ולעוינות pregnane X קולטן הפעלה (PXR). מסכי תפוקת שמרים גבוהים של מוטציות PXR להגדיר אזור ייחודי לketoconazole מחייב. שיטה גנטית המבוסס על שמרים זה מגלה אינטראקציות רצפטור הגרעיני רומן עם ligands שמקשר עם אתרי פני השטח מחייבים.

הפוך מערכת דו היברידית שמרים לזהות יונקים הגרעיני קולטן שאריות כי אינטראקציה עם ligands ו / או יריבים

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking ...

reverse-yeast-two-hybrid-system-to-identify-mammalian-nuclear

Research

JoVE Journal

Biology

12.7K Views.  Albert Einstein College of Medicine.  Ketoconazole נקשר ולעוינות pregnane X קולטן הפעלה (PXR). מסכי תפוקת שמרים גבוהים של מוטציות PXR להגדיר אזור ייחודי לketoconazole מחייב. שיטה גנטית המבוסס על שמרים זה מגלה אינטראקציות רצפטור הגרעיני רומן עם ligands שמקשר עם אתרי פני השטח מחייבים. 

Video: Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Proteomics to Identify Proteins Interacting with P2X2 Ligand-Gated Cation Channels

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys loop, the glutamate-gated and the P2X receptor channels2. In each case binding of transmitter leads to the opening of a pore through which ions flow down their electrochemical gradients. Many ligand-gated channels are also permeable to calcium ions3, 4, which have downstream signaling roles5 (e.g. gene regulation) that may exceed the duration of channel opening. Thus ligand-gated channels can signal over broad time scales ranging from a few milliseconds to days. Given these important roles it is necessary to understand how ligand-gated ion channels themselves are regulated by proteins, and how these proteins may tune signaling. Recent studies suggest that many, if not all, channels may be part of protein signaling complexes6. In this article we explain how to identify the proteins that bind to the C-terminal aspects of the P2X2 receptor cytosolic domain.
P2X receptors are ATP-gated cation channels and consist of seven subunits (P2X1-P2X7). P2X receptors are widely expressed in the brain, where they mediate excitatory synaptic transmission and presynaptic facilitation of neurotransmitter release7. P2X receptors are found in excitable and non-excitable cells and mediate key roles in neuronal signaling, inflammation and cardiovascular function8. P2X2 receptors are abundant in the nervous system9 and are the focus of this study. Each P2X subunit is thought to possess two membrane spanning segments (TM1 &amp; TM2) separated by an extracellular region7 and intracellular N and C termini (Fig 1a)7. P2X subunits10 (P2X1-P2X7) show 30-50% sequence homology at the amino acid level11. P2X receptors contain only three subunits, which is the simplest stoichiometry among ionotropic receptors. The P2X2 C-terminus consists of 120 amino acids (Fig 1b) and contains several protein docking consensus sites, supporting the hypothesis that P2X2 receptor may be part of signaling complexes. However, although several functions have been attributed to the C-terminus of P2X2 receptors9 no study has described the molecular partners that couple to the intracellular side of this protein via the full length C-terminus. In this methods paper we describe a proteomic approach to identify the proteins which interact with the full length C-terminus of P2X2 receptors.

We describe a simple protocol to identify brain proteins that bind to the full length C terminus of ATP-gated P2X2 receptors. The extension and systematic application of this approach to all P2X receptors is expected to lead to a better understanding of P2X receptor signaling.

Proteomics כדי לזהות חלבונים אינטראקציה עם ליגנד P2X2-מגודרת ערוצי קטיון

Ligand-gated ion channels underlie synaptic communication in the nervous system1. In mammals there are three families of ligand-gated channels: the cys ...

Split-Ubiquitin Based Membrane Yeast Two-Hybrid (MYTH) System: A Powerful Tool For Identifying Protein-Protein Interactions

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput identification of protein-protein interactions (PPI) for full-length transmembrane proteins. To this end, our lab developed the split-ubiquitin based Membrane Yeast Two-Hybrid (MYTH) system. This technology allows for the sensitive detection of transient and stable protein interactions using Saccharomyces cerevisiae as a host organism. MYTH takes advantage of the observation that ubiquitin can be separated into two stable moieties: the C-terminal half of yeast ubiquitin (Cub) and the N-terminal half of the ubiquitin moiety (Nub). In MYTH, this principle is adapted for use as a 'sensor' of protein-protein interactions. Briefly, the integral membrane bait protein is fused to Cub which is linked to an artificial transcription factor. Prey proteins, either in individual or library format, are fused to the Nub moiety. Protein interaction between the bait and prey leads to reconstitution of the ubiquitin moieties, forming a full-length 'pseudo-ubiquitin' molecule. This molecule is in turn recognized by cytosolic deubiquitinating enzymes, resulting in cleavage of the transcription factor, and subsequent induction of reporter gene expression. The system is highly adaptable, and is particularly well-suited to high-throughput screening. It has been successfully employed to investigate interactions using integral membrane proteins from both yeast and other organisms.

Split-Ubiquitin Based Membrane Yeast Two-Hybrid MYTH System: A Powerful Tool For Identifying Protein-Protein Interactions

MYTH allows the sensitive detection of transient and stable interactions between proteins that are expressed in the model organism Saccharomyces cerevisiae. It has been successfully applied to study exogenous and yeast integral membrane proteins in order to identify their interacting partners in a high throughput manner.

Split-יוביקוויטין ממברנה שמרים בהתבסס שני היברידי (מיתוס) מערכת: כלי רב עוצמה עבור זיהוי חלבונים אינטראקציות

The fundamental biological and clinical importance of integral membrane proteins prompted the development of a yeast-based system for the high-throughput ...

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

אנליזה של קינטיקה mRNA גרעיני ייצוא בתאי יונקים ידי Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated tools and resources for studies in this system are facilitating continued discovery of genes with more subtle phenotypes or roles. 
Here we present a generalized protocol we adapted for identifying C. elegans genes with postembryonic phenotypes of interest using RNAi2. This procedure is easily modified to assay the phenotype of choice, whether by light or fluorescence optics on a dissecting or compound microscope. This screening protocol capitalizes on the physical assets of the organism and molecular tools the C. elegans research community has produced. As an example, we demonstrate the use of an integrated transgene that expresses a fluorescent product in an RNAi screen to identify genes required for the normal localization of this product in late stage larvae and adults. First, we used a commercially available genomic RNAi library with full-length cDNA inserts. This library facilitates the rapid identification of multiple candidates by RNAi reduction of the candidate gene product. Second, we generated an integrated transgene that expresses our fluorecently tagged protein of interest in an RNAi-sensitive background. Third, by exposing hatched animals to RNAi, this screen permits identification of gene products that have a vital embryonic role that would otherwise mask a post-embryonic role in regulating the protein of interest. Lastly, this screen uses a compound microscope equipped for single cell resolution.

RNAi Screening to Identify Postembryonic Phenotypes in C. elegans

We describe a sensitized method to identify postembryonic regulators of protein expression and localization in C. elegans using an RNAi-based genomic screen and an integrated transgene that expresses a functional, fluorescently tagged protein.

RNAi הקרנת לזהות פנוטיפים Postembryonic ב ג elegans</em

C. elegans has proven to be a valuable model system for the discovery and functional characterization of many genes and gene pathways1. More sophisticated ...

Modified Yeast-Two-Hybrid System to Identify Proteins Interacting with the Growth Factor Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role in a variety of physiologic and disease processes, including early embryogenesis, wound healing 1, inflammation 2, 3, and host defense 4. PGRN also functions as a neurotrophic factor 5, and mutations in the PGRN gene resulting in partial loss of the PGRN protein cause frontotemporal dementia 6, 7. Our recent studies have led to the isolation of PGRN as an important regulator of cartilage development and degradation 8-11. Although PGRN, discovered nearly two decades ago, plays crucial roles in multiple physiological and pathological conditions, efforts to exploit the actions of PGRN and understand the mechanisms involved have been significantly hampered by our inability to identify its binding receptor(s). To address this issue, we developed a modified yeast two-hybrid (MY2H) approach based on the most commonly used GAL4 based 2-hybrid system. Compared with the conventional yeast two-hybrid screen, MY2H dramatically shortens the screen process and reduces the number of false positive clones. In addition, this approach is reproducible and reliable, and we have successfully employed this system in isolating the binding proteins of various baits, including ion channel 12, extracellular matrix protein 10, 13, and growth factor14. In this paper, we describe this MY2H experimental procedure in detail using PGRN as an example that led to the identification of TNFR2 as the first known PGRN-associated receptor 14, 15.

We have modified the conventional yeast two-hybrid screening, an effective genetic tool in identifying protein interaction. This modification markedly shortens the process, reduces the workload, and most importantly, reduces the number of false positives. In addition, this approach is reproducible and reliable.

השתנה שמרים-Two-Hybrid System כדי לזהות חלבונים אינטראקציה עם גורם הגדילה Progranulin

Progranulin (PGRN), also known as granulin epithelin precursor (GEP), is a 593-amino-acid autocrine growth factor. PGRN is known to play a critical role ...

siRNA Screening to Identify Ubiquitin and Ubiquitin-like System Regulators of Biological Pathways in Cultured Mammalian Cells

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that regulates diverse biological pathways including the hypoxia response, proteostasis, the DNA damage response and transcription.&#160; To better understand how UBLs regulate pathways relevant to human disease, we have compiled a human siRNA &#8220;ubiquitome&#8221; library consisting of 1,186 siRNA duplex pools targeting all known and predicted components of UBL system pathways. This library can be screened against a range of cell lines expressing reporters of diverse biological pathways to determine which UBL components act as positive or negative regulators of the pathway in question.&#160; Here, we describe a protocol utilizing this library to identify ubiquitome-regulators of the HIF1A-mediated cellular response to hypoxia using a transcription-based luciferase reporter.&#160; An initial assay development stage is performed to establish suitable screening parameters of the cell line before performing the screen in three stages: primary, secondary and tertiary/deconvolution screening. &#160;The use of targeted over whole genome siRNA libraries is becoming increasingly popular as it offers the advantage of reporting only on members of the pathway with which the investigators are most interested.&#160; Despite inherent limitations of siRNA screening, in particular false-positives caused by siRNA off-target effects, the identification of genuine novel regulators of the pathways in question outweigh these shortcomings, which can be overcome by performing a series of carefully undertaken control experiments.

Here, we describe a methodology to perform a targeted siRNA &#8220;ubiquitome&#8221; screen to identify novel ubiquitin and ubiquitin-like regulators of the HIF1A-mediated cellular response to hypoxia.&#160; This can be adapted to any biological pathway where a robust read out of reporter activity is available.

הקרנת siRNA לזיהוי יוביקוויטין ורגולטורים מערכת דמויות יוביקוויטין של מסלולים ביולוגיים בתאי יונקים בתרבית

Post-translational modification of proteins with ubiquitin and ubiquitin-like molecules (UBLs) is emerging as a dynamic cellular signaling network that ...

Detecting Estrogenic Ligands in Personal Care Products using a Yeast Estrogen Screen Optimized for the Undergraduate Teaching Laboratory

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine disruption. Estrogenic ligands include both natural and manmade &#34;Environmental Estrogens&#34; (EEs) found in many consumer goods including Personal Care Products (PCPs), plastics, pesticides, and foods. EEs disrupt hormone signaling in humans and other animals, potentially reducing fertility and increasing disease risk. Despite the importance of EEs and other Endocrine Disrupting Chemicals (EDCs) to public health, endocrine disruption is not typically included in undergraduate curricula. This shortcoming is partly due to a lack of relevant laboratory activities that illustrate the principles involved while also being accessible to undergraduate students. This article presents an optimized YES for quantifying ligands in personal care products that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates one of the two colorimetric substrates (ortho-nitrophenyl-&#946;-D-galactopyranoside (ONPG) or chlorophenol red-&#946;-D-galactopyranoside (CPRG)) that are cleaved by &#946;-galactosidase, a 6-day refrigerated incubation step to facilitate use in undergraduate laboratory courses, an automated application for LacZ calculations, and R code for the associated 4-parameter logistic regression analysis. The protocol has been designed to allow undergraduate students to develop and conduct experiments in which they screen products of their choosing for estrogen mimics. In the process, they learn about endocrine disruption, cell culture, receptor binding, enzyme activity, genetic engineering, statistics, and experimental design. Simultaneously, they also practice fundamental and broadly applicable laboratory skills, such as: calculating concentrations; making solutions; demonstrating sterile technique; serially diluting standards; constructing and interpolating standard curves; identifying variables and controls; collecting, organizing, and analyzing data; constructing and interpreting graphs; and using common laboratory equipment such as micropipettors and spectrophotometers. Thus, implementing this assay encourages students to engage in inquiry-based learning while exploring emerging issues in environmental science and health.

This article presents an optimized yeast estrogen screen for quantifying ligands in Personal Care Products (PCPs) that bind estrogen receptors alpha (ER&#945;) and/or beta (ER&#946;). The method incorporates two colorimetric substrate options, a six-day refrigerated incubation for use in undergraduate courses, and statistical tools for data analysis.

זיהוי ליגנדים אסטרוגניים במוצרי טיפוח אישי באמצעות של שמרים אסטרוגן מסך ממוטב עבור המעבדה הוראה לתואר ראשון

The Yeast Estrogen Screen (YES) is used to detect estrogenic ligands in environmental samples and has been broadly applied in studies of endocrine ...

A Flow Cytometry-based Assay to Identify Compounds That Disrupt Binding of Fluorescently-labeled CXC Chemokine Ligand 12 to CXC Chemokine Receptor 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling contributes to the progression of many diseases. The ligand/receptor pair CXC chemokine ligand 12 (CXCL12)/CXC chemokine receptor 4 (CXCR4) has raised significant clinical interest, for instance as a potential target for the treatment of cancer and inflammatory diseases. Small molecules as well as therapeutic antibodies that specifically target CXCR4 and inhibit the receptor&#39;s function are therefore considered to be valuable pharmacological tools. Here, a flow cytometry-based cellular assay that allows identification of compounds (e.g., small molecules) that abrogate CXCL12 binding to CXCR4, is described. Essentially, the assay relies on the competition for receptor binding between a fixed amount of fluorescently labeled CXCL12, the natural chemokine agonist for CXCR4, and unlabeled compounds. Hence, the undesirable use of radioactively labeled probes is avoided in this assay. In addition, living cells are used as the source of receptor (CXCR4) instead of cell membrane preparations. This allows easy adaptation of the assay to a plate format, which increases the throughput. This assay has been shown to be a valuable generic drug discovery assay to identify CXCR4-targeting compounds. The protocol can likely be adapted to other GPCRs, at least if fluorescently labeled ligands are available or can be generated. Prior knowledge concerning the intracellular signaling pathways that are induced upon activation of these GPCRs, is not required.

A flow cytometry-based cellular binding assay is described that is primarily used as a screening tool to identify compounds that inhibit the binding of a fluorescently labeled CXC chemokine ligand 12 (CXCL12) to the CXC chemokine receptor 4 (CXCR4).

וזמינותו מבוססי Cytometry זרימה כדי לזהות תרכובות לשבש קשירה של ליגנד כימוקין שכותרתו Fluorescently CXC 12 לקולטן כימוקין CXC 4

Pharmacological targeting of G protein-coupled receptors (GPCRs) is of great importance to human health, as dysfunctional GPCR-mediated signaling ...

Examination of Mitotic and Meiotic Fission Yeast Nuclear Dynamics by Fluorescence Live-cell Microscopy

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does not interfere with cell physiology, and requires minimal experimental handling. The low levels of technical interference enable researchers to study cells across multiple cycles of mitosis and to observe meiosis from beginning to end. Using fluorescent tags such as Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP), researchers can analyze different factors whose functions are important for processes like transcription, DNA replication, cohesion, and segregation. Coupled with data analysis using Fiji (a free, optimized ImageJ version), live-cell imaging offers various ways of assessing protein movement, localization, stability, and timing, as well as nuclear dynamics and chromosome segregation. However, as is the case with other microscopy methods, live-cell imaging is limited by the intrinsic properties of light, which put a limit to the resolution power at high magnifications, and is also sensitive to photobleaching or phototoxicity at high wavelength frequencies. However, with some care, investigators can bypass these physical limitations by carefully choosing the right conditions, strains, and fluorescent markers to allow for the appropriate visualization of mitotic and meiotic events.

Here, we present live-cell imaging which is a non-toxic microscopy method that allows researchers to study protein behavior and nuclear dynamics in living fission yeast cells during mitosis and meiosis.

בחינת Mitotic ומיוטיק ביקוע הדינמיקה הגרעינית על ידי הזריחה לחיות-מיקרוסקופ התא

Live-cell imaging is a microscopy technique used to examine cell and protein dynamics in living cells. This imaging method is not toxic, generally does ...

A Two-Step Strategy that Combines Epigenetic Modification and Biomechanical Cues to Generate Mammalian Pluripotent Cells

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe a new strategy that combines the use of chemical epigenetic erasing with mechanosensing-related cues, to generate mammalian pluripotent cells. Two main steps are required. In the first step, adult mature (terminally differentiated) cells are exposed to the epigenetic eraser 5-aza-cytidine to drive them into a pluripotent state. This part of the protocol was developed, based on the increasing understanding of the epigenetic mechanisms controlling cell fate and differentiation, and involves the use of the epigenetic modifier to erase cell differentiated state and then drive into a transient high plasticity window.
In the second step, erased cells are encapsulated in polytetrafluoroethylene (PTFE) micro-bioreactors, also known as Liquid Marbles, to promote 3D cell rearrangement to extend and stably maintain the acquired high plasticity. PTFE is a non-reactive hydrophobic synthetic compound and its use permits the creation of a cellular microenvironment, which cannot be achieved in traditional 2D culture systems. This system encourages and boosts the maintenance of pluripotency though bio-mechanosensing-related cues.
The technical procedures described here are simple strategies to allow for the induction and maintenance of a high plasticity state in adult somatic cells. The protocol allowed the derivation of high plasticity cells in all mammalian species tested. Since it does not involve the use of gene transfection and is free of viral vectors, it may represent a notable technological advance for translational medicine applications. Furthermore, the micro-bioreactor system provides a notable advancement in stem cell organoid technology by in vitro re-creating a specific micro-environment that allows for the long-term culture of high plasticity cells, namely as ESCs, iPSCs, epigenetically erased cells and MSCs.

We here present a method that combines the use of chemical epigenetic erasing with mechanosensing-related cues to efficiently generate mammalian pluripotent cells, without the need of gene transfection or retroviral vectors. This strategy is, therefore, promising for translational medicine and represents a notable advancement in stem cell organoid technology.

אסטרטגיה דו-שלבית המשלבת שינוי אפיגנטי ורמזים ביומכניים ליצירת תאים פלוריפוטנטיים של יונקים

Cell phenotype can be reversed or modified with different methods, with advantages and limitations that are specific for each technique. Here we describe ...