עבודה זו נתמכה על ידי מענק מקרן ביל ומלינדה גייטס ופילנתרופיה פתוחה. אנו מודים למתקן לדימות באמצעות מיקרוסקופ אור (FILM) באימפריאל קולג' בלונדון על ניתוח המיקרוסקופ. איור 2 נוצר באמצעות Biorender.com.

1. תיוג בדיקת DNA
הערה: להלן השלבים הטכניים ליצירת בדיקות DNA פלואורסצנטיות המסמנות באופן ספציפי את כרומוזומי המין של יתושי An. gambiae. 
<ol><li>בדיקה תיוג באמצעות PCR<ol><li>חלץ DNA גנומי מגלמים או זכרים בוגרים כדי לתייג את כרומוזומי X או Y באמצעות ערכת מיצוי DNA גנומי זמינה מסחרית (ראה טבלת חומרים).</li>
		<li>הכינו את תערובת תגובת ה-PCR: 200 ננוגרם של דנ"א גנומי, 0.05 מילימטר נוקלאוטיד לא מסומן (dATP, dCTP, dGTP), 0.015 מילימטר של dTTP, ו-1 uL של dUTP המסומן פלואורסצנטית (Cy3, Cy5, או פלואורוכרום אחר), 50 PMOL של פריימר קדמי והפוך (טבלה 1), 5 μL של 10x PCR-buffer ו-10 U של Taq DNA polymerase (ראה טבלת חומרים).</li>
		<li>כדי לתייג 18S rDNA ולוויין AgY53B (טבלה 1), בצע תגובת PCR באמצעות פרמטרי ה-PCR הבאים: מחזור אחד של 95°C למשך 10 דקות; 35 מחזורים של 95 ° C עבור 30 שניות, 52 ° C עבור 30 שניות, ו 72 ° C עבור 45 שניות; מחזור אחד של 72 °C למשך 5 דקות; ואחיזה סופית ב-4 מעלות צלזיוס. הערה: כדי להשיג ריכוז בדיקה טוב עם שיטת התיוג PCR (~ 1 מיקרוגרם ב 5 μL), שהוא קריטי עבור WFISH מוצלח, תגובת PCR צריכה להיות יעילה מאוד. מסיבה זו, לפני תיוג הבדיקה, מומלץ מאוד לבדוק את יעילות הפריימרים שנבחרו להגברה. בנוסף, הכללת בקרה חיובית בתגובת ה- PCR (ללא dUTP פלואורסצנטי) תסייע לאמת את יעילות תגובת התיוג.</li>
		<li>אחסנו את הגשושית בטמפרטורה של -20°C במקום חשוך.</li>
	</ol></li>
	<li>השגת בדיקות אוליגונוקלאוטיד פלואורסצנטיות 3'<ol><li>השג בדיקות אוליגונוקלאוטיד פלואורסצנטיות זמינות מסחרית כאוליגוס שונה על ידי הוספת פלואורוכרום Cy3 או Cy5 (או כל פלואורוכרום אחר) לקצה 3' של רצף הנוקלאוטידים (ראה טבלת חומרים). ראו פריימרים/אוליגונוקלאוטיד בטבלה 1 עבור רצפי הייחוס המשמשים לסימון אזור צומת הלוויין AgY477-AgY53B המקושר ל-Y והלוויין מקושר ה-X מ-Contig_240. הערה: אין מכשולים טכניים הקשורים לריכוז של אוליגונוקלאוטידים המסומנים בקצה, מכיוון שהמשתמש יכול בדרך כלל לבחור זאת לפני הרכישה. אנו מציעים לדלל ~800 ננוגרם של תמיסת בדיקת אוליגו במאגר ההכלאה לצורך תיוג יעיל באמצעות בדיקת אוליגו. גשושיות אוליגו ספציפיות ל-X ו-Y שימשו בעבר עבור WFISH על ידי ליאנג ושרחוב19, וניתן למצוא את רצף הייחוס בטבלה 1.</li>
	</ol></li>
</ol>2. הכנת פתרון ההכלאה
הערה: הגשושיות הפלואורסצנטיות הנוצרות בשלב 1 חייבות להיות משולבות בתמיסה כימית שמבצעת הכלאה עם רצפי המטרה.
<ol><li>משקעי בדיקה לפני הכלאה פלואורסצנטית באתרו <ol><li>לצינור של 1.5 מ"ל, הוסף 5 μL של בדיקת DNA מסומנת (אם הושגה בשיטת תיוג PCR) או 2.2 μL של בדיקת אוליגו שונה 3' (~ 800 ng של בדיקה) משלב 1 ו -5 μL של DNA זרע סלמון (ראה טבלת חומרים). שלב את הגשושיות הספציפיות לאזורים גנומיים שונים באותו צינור, והשתמש בהן כפתרון ייחודי בשלבים הבאים.</li>
		<li>לזרז את בדיקת ה- DNA על ידי הוספת נפח 0.1 של 3 M נתרן אצטט ו 2 כרכים של 100% אתנול. שמור על -20 ° C לפחות 2.5 שעות (הגדלת זמן הדגירה ב -20 ° C יגדיל את התשואה הסופית). בשלב זה, ניתן לאחסן את הגשושיות גם לילה לפני הצנטריפוגה.</li>
		<li>צנטריפוגה ב 17,000 x גרם ב 4 ° C במשך 20 דקות, להסיר את האתנול, ולייבש את האוויר את הגלולה ב RT בחושך במשך ~ 20 דקות.</li>
	</ol></li>
	<li>פתרון היברידיזציה<ol><li>לפני שתמשיך עם דיסקציה האשכים (שלב 3), להכין את חיץ הכלאה על ידי ערבוב ריאגנטים הבאים בצינור 1.5: 500 μL של פורממיד, 0.2 גרם של דקסטרן סולפט, 100 μL של 20x נתרן ציטראט מלוחים (SSC), ו 200 μL של סטרילי H20 (ראה טבלה של חומרים). מערבלים את תמיסת ההכלאה למשך דקה אחת, ומאפשרים לדאקסטרן סולפט להתמוסס ב-37°C למשך 30 דקות.</li>
		<li>ממיסים את הגלולה משלב 2.1.3 ב-20-30 מיקרוליטר של חיץ הכלאה (מערבולת למשך כדקה, מבצעים סיבוב מהיר ומאחסנים את הצינורות ב-37 מעלות צלזיוס בחושך) לקבלת תמיסת ההכלאה.</li>
	</ol></li>
</ol>3. דיסקציה וקיבוע אשכים
<ol><li>בטמפרטורת החדר (RT), נתחולפחות 21 ~20 אשכים מגלמים או מבוגרים בני יום אחד בתמיסת מלח סטרילית 1x פוספט חוצץ מלח (PBS), והעבירו אותם למגלשת מיקרוסקופ נקייה המכילה טיפה טרייה של תמיסת PBS 1x.</li>
	<li>מעבירים את האשכים באמצעות קצה מסונן רחב P1,000 או קצה של מחט דיסקציה מטיפת PBS 1x לתוך צלחת עובר המכילה 3.7% פורמלדהיד ב-1x PBS עם 0.1% Tween-20 (PBST), ודגרים במשך 10 דקות ב-RT.</li>
	<li>שטפו את האשכים ב-1x PBST במשך 5 דקות ב-RT. דגרו על האשכים ב-RNAse A של 0.1 מ"ג/מ"ל (ראו טבלת חומרים) מדוללים ב-1x PBS סטרילי למשך 30 דקות ב-37°C.</li>
	<li>הסר את תמיסת ה- RNAse, הוסף את התמיסה החודרת (1% טריטון/0.1 M HCl ב- 1x PBST), ודגר ב- RT למשך 10 דקות. הערה: ניתן להשתמש בפרוטאינאז K כחומר חודר בריכוז סופי של 10 מיקרוגרם/מ"ל ב-1x PBST כדי להגביר את החדירות של האשכים.</li>
	<li>שטפו את האשכים ב-1x PBST פעמיים במשך 5 דקות כל אחת ב-RT.</li>
</ol>4. הכלאה
הערה: סעיף זה מתאר את השלבים האחרונים עבור הכלאה באתר .
<ol><li>לאחר שלב הכביסה (שלב 3.5), להעביר את האשכים בצינור 1.5 מ"ל עם 20-30 μL של פתרון הכלאה המכיל את הבדיקה שהוכנה בעבר (שלב 2.2.2). השתמש בקצה פיפטה כדי לערבב את התמיסה בעדינות. החלק בעדינות את הצינור חמש פעמים לפני שתמשיך לשלבים הבאים.</li>
	<li>דגירה במשך 5 דקות ב 75 ° C עבור דנטורציה DNA.</li>
	<li>דוגרים לילה בטמפרטורה של 37°C (אם אפשר, עם נדנוד בפחות מ-100 סל"ד) לצורך הכלאה של DNA-DNA.</li>
	<li>מעבירים את האשכים בחזרה לצלחת עוברית באמצעות קצה מסונן רחב P1,000, ושוטפים אותם ב-2x SSC שחומם מראש ל-50°C למשך 5 דקות. הערה: לאחר שלב ההכלאה, נדרש שלב שטיפה סופי באמצעות 2x SSC; זה משחק תפקיד חשוב בהסרת כל אות רקע שנגרם על ידי נוכחות של בדיקות unhybridized בתוך רקמת האיבר. אם קיים אות רקע חזק, מומלץ לחזור על שלב הכביסה האחרון.</li>
	<li>הסר את 2x SSC, והרכיב את האשכים באמצעות אמצעי הרכבה זמין מסחרית עם 4′,6-diamidino-2-phenylindole (DAPI) (ראה רשימת חומרים) על שקופית זכוכית חלבית, אטום עם חומר איטום החלקה, ודגר במשך שעתיים לפחות ב- RT בחושך.</li>
	<li>בצע הדמיה קונפוקלית. ניתן לדמיין את כל האשכים באמצעות מטרות טבילה בשמן 40x או 63x. אם מבוצעת מחסנית z, אנו ממליצים להשתמש בצעד z של 1.25 מיקרומטר.</li>
</ol>

הכלאה פלואורסצנטית באתרו לחקר זרע יתושים

<ol>
	<li>World Malaria Report. World Health Organization Available from: <a target="_blank" href="https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2022">https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2022</a> (2022)</li><li>Bhatt, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+malaria+control+on+Plasmodium+falciparum+in+Africa+between+2000+and+2015.">The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015.</a> Nature. 526 (7572), 207-211 (2015).</li><li>Hammond, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+gene+drive+system+targeting+female+reproduction+in+the+malaria+mosquito+vector+Anopheles+gambiae.">A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae.</a> Nature Biotechnology. 34 (1), 78-83 (2016).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature Communications. 5 (1), 3977 (2014).</li><li>Kyrou, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+gene+drive+targeting+doublesex+causes+complete+population+suppression+in+caged+Anopheles+gambiae+mosquitoes.">A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes.</a> Nature Biotechnology. 36 (11), 1062-1066 (2018).</li><li>Simoni, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+male-biased+sex-distorter+gene+drive+for+the+human+malaria+vector+Anopheles+gambiae.">A male-biased sex-distorter gene drive for the human malaria vector Anopheles gambiae.</a> Nature Biotechnology. 38 (9), 1054-1060 (2020).</li><li>Gantz, V. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+Cas9-mediated+gene+drive+for+population+modification+of+the+malaria+vector+mosquito+Anopheles+stephensi.">Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (49), E6736-E6743 (2015).</li><li>Bernardini, F., Kriezis, A., Galizi, R., Nolan, T., Crisanti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introgression+of+a+synthetic+sex+ratio+distortion+system+from+Anopheles+gambiae+into+Anopheles+arabiensis.">Introgression of a synthetic sex ratio distortion system from Anopheles gambiae into Anopheles arabiensis.</a> Scientific Reports. 9 (1), 5158 (2019).</li><li>Hammond, A. M., Galizi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+drives+to+fight+malaria:+Current+state+and+future+directions.">Gene drives to fight malaria: Current state and future directions.</a> Pathogens and Global Health. 111 (8), 412-423 (2017).</li><li>Garrood, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Driving+down+malaria+transmission+with+engineered+gene+drives.">Driving down malaria transmission with engineered gene drives.</a> Frontiers in Genetics. 13, 891218 (2022).</li><li>Hoermann, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+drive+mosquitoes+can+aid+malaria+elimination+by+retarding+Plasmodium+sporogonic+development.">Gene drive mosquitoes can aid malaria elimination by retarding Plasmodium sporogonic development.</a> Science Advances. 8 (38), (2022).</li><li>Nash, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integral+gene+drives+for+population+replacement.">Integral gene drives for population replacement.</a> Biology Open. 8 (1), (2019).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+sex-ratio+distortion+system+for+genetic+control.">A CRISPR-Cas9 sex-ratio distortion system for genetic control.</a> Scientific Reports. 6 (1), 31139 (2016).</li><li>Terradas, G., Hermann, A., James, A. A., McGinnis, W., Bier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+in+situ+analysis+of+Cas9+germline+transcript+distributions+in+gene-drive+Anopheles+mosquitoes.">High-resolution in situ analysis of Cas9 germline transcript distributions in gene-drive Anopheles mosquitoes.</a> G3: Genes, Genomes, Genetics. 12 (1), (2022).</li><li>Durant, A. C., Donini, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ammonium+transporter+expression+in+sperm+of+the+disease+vector+Aedes+aegypti+mosquito+influences+male+fertility.">Ammonium transporter expression in sperm of the disease vector Aedes aegypti mosquito influences male fertility.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (47), 29712-29719 (2020).</li><li>Taxiarchi, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+transcriptional+profiling+of+Anopheles+gambiae+spermatogenesis+reveals+mechanisms+of+sex+chromosome+regulation.">High-resolution transcriptional profiling of Anopheles gambiae spermatogenesis reveals mechanisms of sex chromosome regulation.</a> Scientific Reports. 9 (1), 14841 (2019).</li><li>Pompon, J., Levashina, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+role+of+the+mosquito+complement-like+cascade+in+male+fertility+in+Anopheles+gambiae.">A new role of the mosquito complement-like cascade in male fertility in Anopheles gambiae.</a> PLoS Biology. 13 (9), e1002255 (2015).</li><li>Papathanos, P. A., Windbichler, N., Menichelli, M., Burt, A., Crisanti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+vasa+regulatory+region+mediates+germline+expression+and+maternal+transmission+of+proteins+in+the+malaria+mosquito+Anopheles+gambiae:+A+versatile+tool+for+genetic+control+strategies.">The vasa regulatory region mediates germline expression and maternal transmission of proteins in the malaria mosquito Anopheles gambiae: A versatile tool for genetic control strategies.</a> BMC Molecular Biology. 10 (1), 13 (2009).</li><li>Liang, J., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premeiotic+and+meiotic+failures+lead+to+hybrid+male+sterility+in+the+Anopheles+gambiae+complex.">Premeiotic and meiotic failures lead to hybrid male sterility in the Anopheles gambiae complex.</a> Proceedings of the Royal Society B. 286 (1906), 20191080 (2019).</li><li>Hall, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radical+remodeling+of+the+Y+chromosome+in+a+recent+radiation+of+malaria+mosquitoes.">Radical remodeling of the Y chromosome in a recent radiation of malaria mosquitoes.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (15), E2114-E2123 (2016).</li><li>Clements, A. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Biology of Mosquitoes. Volume 1: Development, Nutrition and Reproduction. , (1992).</li><li>Demarco, R. S., Eikenes, &. #. 1. 9. 7. ;. H., Haglund, K., Jones, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+spermatogenesis+in+Drosophila+melanogaster.">Investigating spermatogenesis in Drosophila melanogaster.</a> Methods. 68 (1), 218-227 (2014).</li><li>Helinski, M. E., Parker, A. G., Knols, B. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radiation+biology+of+mosquitoes.">Radiation biology of mosquitoes.</a> Malaria Journal. 8, S6 (2009).</li><li>Huho, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+morphological+method+to+assess+the+age+of+male+Anopheles+gambiae.">A reliable morphological method to assess the age of male Anopheles gambiae.</a> Malaria Journal. 5 (1), 62 (2006).</li><li>Fabian, L., Brill, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+spermiogenesis.">Drosophila spermiogenesis.</a> Spermatogenesis. 2 (3), 197-212 (2012).</li><li>Li, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppressing+mosquito+populations+with+precision+guided+sterile+males.">Suppressing mosquito populations with precision guided sterile males.</a> Nature Communications. 12 (1), 5374 (2021).</li><li>Thailayil, J., Magnusson, K., Godfray, H. C., Crisanti, A., Catteruccia, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spermless+males+elicit+large-scale+female+responses+to+mating+in+the+malaria+mosquito+Anopheles+gambiae.">Spermless males elicit large-scale female responses to mating in the malaria mosquito Anopheles gambiae.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (33), 13677-13681 (2011).</li><li>Haghighat-Khah, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanisms+regulating+synthetic+sex+ratio+distortion+in+the+Anopheles+gambiae+germline.">Cellular mechanisms regulating synthetic sex ratio distortion in the Anopheles gambiae germline.</a> Pathogens and Global Health. 114 (7), 370-378 (2020).</li><li>Yamamoto, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+male-specific+sterilization+system+using+the+mammalian+pro-apoptotic+factor+in+a+malaria+vector+mosquito.">A synthetic male-specific sterilization system using the mammalian pro-apoptotic factor in a malaria vector mosquito.</a> Scientific Reports. 9 (1), 8160 (2019).</li><li>Papathanos, P. A., Windbichler, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redkmer:+An+assembly-free+pipeline+for+the+identification+of+abundant+and+specific+X-chromosome+target+sequences+for+X-shredding+by+CRISPR+endonucleases.">Redkmer: An assembly-free pipeline for the identification of abundant and specific X-chromosome target sequences for X-shredding by CRISPR endonucleases.</a> The CRISPR Journal. 1 (1), 88-98 (2018).</li><li>Sharma, A., Kinney, N. A., Timoshevskiy, V. A., Sharakhova, M. V., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+variation+of+the+X+chromosome+heterochromatin+in+the+Anopheles+gambiae+complex.">Structural variation of the X chromosome heterochromatin in the Anopheles gambiae complex.</a> Genes. 11 (3), 327 (2020).</li><li>Krzywinski, J., Sangar&#233;, D., Besansky, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Satellite+DNA+from+the+Y+chromosome+of+the+malaria+vector+Anopheles+gambiae.">Satellite DNA from the Y chromosome of the malaria vector Anopheles gambiae.</a> Genetics. 169 (1), 185-196 (2005).</li><li>Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+in+situ+hybridization+on+mitotic+chromosomes+of+mosquitoes.">Fluorescent in situ hybridization on mitotic chromosomes of mosquitoes.</a> Journal of Visualized Experiments. (67), e4215 (2012).</li><li>Liang, J., Hodge, J. M., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Asymmetric+phenotypes+of+sterile+hybrid+males+from+reciprocal+crosses+between+species+of+the+Anopheles+gambiae+complex.">Asymmetric phenotypes of sterile hybrid males from reciprocal crosses between species of the Anopheles gambiae complex.</a> Frontiers in Ecology and Evolution. 9, 660207 (2021).</li><li>Slotman, M., Torre, A. D., Powell, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetics+of+inviability+and+male+sterility+in+hybrids+between+Anopheles+gambiae+and+An.+arabiensis.">The genetics of inviability and male sterility in hybrids between Anopheles gambiae and An. arabiensis.</a> Genetics. 167 (1), 275-287 (2004).</li><li>Wood, R. J., Newton, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex-ratio+distortion+caused+by+meiotic+drive+in+mosquitoes.">Sex-ratio distortion caused by meiotic drive in mosquitoes.</a> The American Naturalist. 137 (3), 379-391 (1991).</li><li>Cazemajor, M., Joly, D., Montchamp-Moreau, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex-ratio+meiotic+drive+in+Drosophila+simulans+is+related+to+equational+nondisjunction+of+the+Y+chromosome.">Sex-ratio meiotic drive in Drosophila simulans is related to equational nondisjunction of the Y chromosome.</a> Genetics. 154 (1), 229-236 (2000).</li><li>Jaenike, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+chromosome+meiotic+drive.">Sex chromosome meiotic drive.</a> Annual Review of Ecology and Systematics. 32 (1), 25-49 (2001).</li><li>Courret, C., Chang, C. H., Wei, K. H., Montchamp-Moreau, C., Larracuente, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+drive+mechanisms:+Lessons+from+Drosophila.">Meiotic drive mechanisms: Lessons from Drosophila.</a> Proceedings of the Royal Society B. 286 (1913), 20191430 (2019).</li><li>Zanders, S. E., Unckless, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fertility+costs+of+meiotic+drivers.">Fertility costs of meiotic drivers.</a> Current Biology. 29 (11), R512-R520 (2019).</li><li>Newton, M. E., Wood, R. J., Southern, D. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytogenetic+analysis+of+meiotic+drive+in+the+mosquito,+Aedes+aegypti+(L.).">A cytogenetic analysis of meiotic drive in the mosquito, Aedes aegypti (L.).</a> Genetica. 46 (3), 297-318 (1976).</li><li>Carabajal Paladino, L. Z., Nguyen, P., &#352;&#237;chov&#225;, J., Marec, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+single-copy+genes+by+TSA-FISH+in+the+codling+moth,+Cydia+pomonella.">Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.</a> BMC Genomic Data. 15, S15 (2014).</li><li>Bernardini, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-species+Y+chromosome+function+between+malaria+vectors+of+the+Anopheles+gambiae+species+complex.">Cross-species Y chromosome function between malaria vectors of the Anopheles gambiae species complex.</a> Genetics. 207 (2), 729-740 (2017).</li></ol>

למחברים אין מה לחשוף.

בדרך כלל, פרוטוקולי FISH דורשים מעיכה של האיבר המעניין כדי לאפשר צביעת כרומוזומים. זה גורם לאובדן מידע לגבי הסידור המרחבי של התאים בתוך אותו איבר33. פרוטוקול זה מתאר כיצד ניתן לחקור תהליכים ביולוגיים, כגון ספרמטוגנזה, באתרם תוך שמירה על המבנה הטבעי השלם של האשך והארגון הציטולוגי הפנימי שלו. גשושיות המכוונות לאלמנטים שונים החוזרים על עצמם בדנ"א, המועשרים במיוחד בכרומוזומי מין20, יכולות לשמש בו זמנית כדי לחשוף את הדינמיקה של התבגרות הזרע. בהתאם לעיתוי של דיסקציה האשכים, WFISH מציע את ההזדמנות ללמוד שלבים שונים של spermatogenesis באמצעות התפתחות יתושים. WFISH שימושי לחקר תופעות ספציפיות כגון חוסר תאימות היברידית, אשר, ביתושים אנופלס, נובע מנוכחות של פגמים מיוטיים כגון כשל premeiotic ו כרומוזום מין אי ניתוק 19,34,35. מלבד ההיבט הביולוגי, ספרמטוגנזה היא המטרה של מספר אסטרטגיות גנטיות שפותחו כדי לשלוט חרקים מזיקים כגון יתושי אנופלס. בהקשר זה, מוקד rDNA מקושר X של An. gambiae שימש כמטרה לפיתוח עיוות יחס מין סינתטי, אשר, על ידי פגיעה בזרע נושא X, מטה את הצאצאים כלפי זכרים 4,8,13.
טכנולוגיה זו משקפת את פעולתם של דחפים מיוטיים טבעיים ביחס מין שזוהו במספר טקסים, כולל יתושים, אך עדיין אינם מובנים היטב 28,36,37,38,39,40,41. WFISH מציעה הזדמנות לחקור תופעה זו וסוללת את הדרך לשכלול או שיפור אסטרטגיות גנטיות מבוססות עיוות מין על ידי, למשל, מתן מידע על האופן שבו הציטולוגיה של ייצור הזרע מושפעת מבחירת אתרי היעד המשמשים לגריסת כרומוזומי מין. אמנם, מניסיוננו, WFISH מראה סיכויי הצלחה גבוהים, כישלון עדיין יכול להתרחש. זה יכול להיות בגלל רמה לא יעילה של חדירות רקמות, אשר ניתן להתגבר על ידי הגדלת זמן הדגירה של הפתרון החודר. לחלופין, ניתן להשתמש בפרוטאינאז K במהלך שלב החדירה. בחלק מהמקרים שמנו לב לרמה לא אחידה של חדירת גשושיות, עם אות גבוה יותר בגרעין הזרעונים ואות נמוך או נעדר בשלבי המיוטי והזרע. זה יכול להיות בגלל הבדל ברמת permeabilization בהתאם לשלב התא. בנוסף, WFISH הוכיח את עצמו כבעל ערך בעת שימוש בבדיקות פלואורסצנטיות שנועדו להתמקד ברצפי DNA הנמצאים במספרי העתקה גבוהים. כאשר מתמקדים בגנים בעלי עותק יחיד, ייתכן שזיהוי האות אינו מספיק. במקרה זה, שיטות להגברת אותות, כגון הגברת אות טירמיד (TSA), חייבות להיות משולבות42.
פרוטוקול זה יכול להיות משולב עם immunostaining או עם זני כתב טרנסגניים בעלי סמנים פלואורסצנטיים ספציפיים לנבט16,18, שכן זה יוסיף מידע על לוקליזציה של חלבונים וביטוי גנים באתרם. בעבודה זו, WFISH מתואר כטכניקה לחקור spermatogenesis ב יתושי אנופלס; עם זאת, בהתחשב באנטומיה המשותפת של איברי הרבייה הגבריים, פרוטוקול זה יכול להיות מיושם על מיני יתושים אחרים הממלאים תפקיד בהעברת מחלות. באופן דומה, ניתן לחקור את הגמטוגנזה הנשית באמצעות טכניקה זו. בנוסף, מחקרים ציטולוגיים באיברים או רקמות מעניינים, כגון יתוש המעי האמצעי, שהוא יעד לפלישת טפילים, או רקע גנטי לא טיפוסי, כגון אלה של יתושים היברידיים, ניתן לחקור43. יתר על כן, טכניקה זו יכולה להיות מועברת באופן פוטנציאלי לאורגניזמים אחרים בתוך סדר דיפטרה.

המלריה מטילה נטל עצום על בריאותה ורווחתה של האוכלוסייה האנושית העולמית. בשנת 2021 העריך ארגון הבריאות העולמי (WHO) כי המלריה גרמה ל-619,000 מקרי מוות, מתוכם 96% באפריקה שמדרום לסהרה1. המחלה מועברת על ידי יתושים השייכים לסוג אנופלס, ובאפריקה שמדרום לסהרה, לשלושה מינים, כלומר אנופלס גמביה (An. gambiae), אנופלס קולוצי (An, coluzzi) ואנופלס ערביינסיס (An. arabiensis) יש תפקיד גדול באופן לא פרופורציונלי בהעברת מלריה, המהווים 95% ממקרי המלריה בעולם. תוכניות בקרה המסתמכות על שיטות מסורתיות כגון קוטלי חרקים ותרופות נגד מלריה הצילו מיליוני חיים; עם זאת, בשנים האחרונות, ההתנגדות הגוברת לשיטות בקרה אלה ערערה על יעילותן 1,2. בנוסף, הגבלות שהוטלו על ידי מגיפת COVID-19 השפיעו על זמינותן של התערבויות מרכזיות לשליטה במלריה, אשר, על פי דו"ח המלריה העולמי של ארגון הבריאות העולמי לשנת 2022, הגבירו את שכיחות המלריה1. בשני העשורים האחרונים פותחו שיטות בקרה גנטית חדשניות בתנאי מעבדה כדי להתמקד ביתושי אנופלס 3,4,5,6,7,8,9,10. בין אסטרטגיות אלה, אלה המבוססות על מערכות דחף גנטי (GDSs) ועיוותים סינתטיים ביחס המין (SDs) נראים מבטיחים. GDS מסתמכים על האפשרות להעביר, בתדירות גבוהה מאוד, שינוי גנטי המשפיע על פוריות האישה או פוגע במחזור החיים של הטפיל ביתוש 5,11,12. במקום זאת, SDs פועלים על ידי הטיית יחס המין של צאצאי יתוש כלפי זכרים, מה שמוביל, לאורך זמן, לקריסת אוכלוסיית היעד עקב מחסור בנקבות 4,6,13. המרכיבים העיקריים של מערכות גנטיות אלה פועלים בעיקר על איברי הרבייה של היתושים, שם הגמטות, הביציות והזרע מיוצרים לאחר חלוקה מיוטית14.
בפרוטוקול זה, התקדמות בטכניקות ציטוגנטיות משמשת לחקר ספרמטוגנזה ב- An. gambiae תוך התמקדות בהתנהגות הכרומוזומים באתרם. מבנה האשך של היתוש והתהליכים הביולוגיים המתרחשים בו נחקרו בעבר באמצעות מספר שיטות ציטולוגיות, כגון אימונופלואורסצנטיות, טרנסגנים פלואורסצנטיים והכלאות DNA ו-RNA באתרו (FISH)15,16,17,18,19,20; האיברים מראים צורה דמוית ציר, שבה הקוטב התחתון מחובר לצינור דפרנט המחובר לבלוטות העזר הגבריות. בקוטב העליון, נישה תאי גזע germline מתרבים ומתמיינים לתאי זרע המשובצים בתוך זרעונים שנוצרו על ידי תאים סומטיים. לאחר סבבים מרובים של חלוקה מיטוטית, הזרעונים מתמיינים לזרעונים, הנכנסים למיוזה. בשלב הפרוזום, כרומוזומי מין ואוטוזומים מתחברים להומולוגים שלהם, ומתרחשת חצייה. לאחר החלוקות המיוטיות, נוצרים זרעונים הפלואידים עגולים ונכנסים לספרמיוגנזה, ותהליך זה מוביל להיווצרות זרעונים הפלואידים בוגרים שבהם הציטופלסמה הוסרה, הכרומטין הגרעיני מתעבה, ושוטונים מופיעים בחלק הבסיסי של גרעיני21,22 (איור 1 ואיור 2).
באופן כללי, ספרמיוגנזה מתחילה סביב שלב הגלמים האמצעיים, וניתן לזהות זרעונים בוגרים בשלב הגלמים המאוחרים במאגר הזרע23. תהליך ההתבגרות של הזרעונים נמשך במהלך החיים הבוגרים23,24,25. באשכי אנופלס, כל שלב של זרע יכול להיות מזוהה בקלות על-ידי התבוננות במורפולוגיה הגרעינית של התאים בכל זרע (איור 2). הכלאה פלואורסצנטית באתרה (WFISH), המתוארת בפרוטוקול זה, מאפשרת לחוקרים לתייג באופן ספציפי אזור כרומוזומלי ולעקוב אחריו במהלך הזרע תוך שמירה על המבנה הטבעי של מיקום האיבר וגרעיני התא; זה מייצג יתרון בהשוואה לפרוטוקול DNA FISH סטנדרטי שבו האיבר בדרך כלל מעוך, מה שמוביל לנזק לרקמות19. בפרוטוקול הנוכחי, בדיקות פלואורסצנטיות משמשות להכתמת רצפים חוזרים על כרומוזומי המין, ובכך לעקוב אחר התנהגותם במהלך ספרמטוגנזה, מתאים מתחלקים דיפלואידים לזרעונים הפלואידים בוגרים. WFISH יכול להיות שימושי במיוחד לחקר זיווג מיוטי של כרומוזומי מין וחקירת הפנוטיפים הציטולוגיים הקשורים, למשל, לעיוותים סינתטיים של יחס המינים, עקרות זכרית היברידית והשמדת גנים המעורבים בזרע 4,19,26,27.
בהתחשב בתפקידם כווקטורי מלריה, יתושי אנופלס הם המטרה של מספר גדל והולך של אסטרטגיות בקרת וקטורים גנטיים, אשר לעתים קרובות פועלים באיברי הרבייה של אורגניזמים אלה. נוצרו מספר מוטנטים ופנוטיפים ציטולוגיים הדורשים טכניקות ציטולוגיות חדשות כדי להיחקר26,27,28,29. השיטה המתוארת במחקר זה שופכת אור על הבנת הזרע, כמו גם על המנגנונים הציטולוגיים מאחורי אסטרטגיות גנטיות שיש להן פוטנציאל לשלוט ביתושים מעבירי מלריה.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amersham CyDye Fluorescent Nucleotides, Cy3-dUTP</td>
			<td>Cytiva</td>
			<td>PA53022</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham CyDye Fluorescent Nucleotides, Cy5-dUTP</td>
			<td>Cytiva</td>
			<td>PA55022</td>
			<td></td>
		</tr>
		<tr>
			<td>ART Wide Bore Filtered Pipette Tips</td>
			<td>ThermoFisher Scientific</td>
			<td>2079GPK</td>
			<td></td>
		</tr>
		<tr>
			<td>CytoBond Removable Coverslip Sealant</td>
			<td>SciGene</td>
			<td>2020-00-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Dextran sulfate sodium salt from Leuconostoc spp.</td>
			<td>Sigma-Aldrich</td>
			<td>D8906-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kits&#160;</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>Embryo Dishes</td>
			<td>VWR</td>
			<td>70543-30</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol, molecular grade</td>
			<td>Sigma-Aldrich</td>
			<td>51976</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>ThermoFisher Scientific</td>
			<td>17899</td>
			<td></td>
		</tr>
		<tr>
			<td>GoTaq G2 DNA Polymerase</td>
			<td>Promega</td>
			<td>M7841</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid, 37%</td>
			<td>Sigma-Aldrich</td>
			<td>320331</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope slides, SuperFrost</td>
			<td>VWR&#160;</td>
			<td>631-0114</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10x), pH 7.4</td>
			<td>ThermoFisher Scientific</td>
			<td>70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce 16% Formaldehyde (w/v), Methanol-free</td>
			<td>ThermoFisher Scientific</td>
			<td>28906</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade Mountant with DAPI</td>
			<td>ThermoFisher Scientific</td>
			<td>P36941</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A/T1 Mix</td>
			<td>ThermoFisher Scientific</td>
			<td>EN0551</td>
			<td></td>
		</tr>
		<tr>
			<td>Set of dATP, dCTP, dGTP, dTTP</td>
			<td>Promega</td>
			<td>U1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution</td>
			<td>ThermoFisher Scientific</td>
			<td>R1181</td>
			<td></td>
		</tr>
		<tr>
			<td>SP8 inverted confocal microscope</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>9036-19-5</td>
			<td></td>
		</tr>
		<tr>
			<td>TWEEN 20</td>
			<td>Sigma-Aldrich</td>
			<td>P1379</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure Salmon Sperm DNA Solution</td>
			<td>ThermoFisher Scientific</td>
			<td>15632011</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure SSC 20x</td>
			<td>ThermoFisher Scientific</td>
			<td>15557044</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer sequences</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;-CAATAAATTTCCTTTTTAATGATGC 
			AAAATCTACGTCTCTAGC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>Contig_240 (X)</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;AGAAGAATAGAATCAGAATAGT 
			CGG 
			TTTCTTCATCCTGAAAGCC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>AgY53B (Y)</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;-TTCTAAGTTTCTAGGCTTTAAGGA 
			T 
			GAAGAAACCGACTATTC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>AgY477- 
			AgY53B 
			junction 
			region (Y)</td>
			<td></td>
		</tr>
		<tr>
			<td>F: AACTGTGGAAAAGCCAGAGC 
			R: TCCACTTGATCCTTGCAAAA</td>
			<td>Eurofins Genomics</td>
			<td>18S rDNA (X)</td>
			<td></td>
		</tr>
		<tr>
			<td>F: CCTTTAAACACATGCTCAAATT 
			R: GTTTCTTCATCCTTAAAGCCTAG</td>
			<td>Eurofins Genomics</td>
			<td>AgY53B (Y)</td>
			<td></td>
		</tr>
	</tbody>
</table>

whole-mount fluorescence in situ hybridization to study spermatogenesis in the anopheles mosquito

ספרמטוגנזה היא תהליך ביולוגי מורכב שבמהלכו תאים דיפלואידים עוברים חלוקה מיטוטית ומיאוטית עוקבת ואחריה שינויים מבניים גדולים ליצירת זרעונים הפלואידים. מלבד ההיבט הביולוגי, חקר הזרע הוא בעל חשיבות עליונה להבנה ופיתוח של טכנולוגיות גנטיות כגון דחיפת גנים ועיוותים סינתטיים ביחס בין המינים, אשר, על ידי שינוי התורשה המנדליאנית ויחס מין הזרע, בהתאמה, יכולים לשמש להדברת אוכלוסיות חרקים מזיקים. טכנולוגיות אלה הוכיחו את עצמן כמבטיחות מאוד בתנאי מעבדה ועשויות לשמש להדברת אוכלוסיות בר של יתושי אנופלס , שהם וקטורים של מלריה. בשל פשטות האנטומיה של האשכים וחשיבותם הרפואית, אנופלס גמביה, וקטור מלריה מרכזי באפריקה שמדרום לסהרה, מייצג מודל ציטולוגי טוב לחקר זרעונים. פרוטוקול זה מתאר כיצד ניתן להשתמש בהכלאה פלואורסצנטית באתרה (WFISH) כדי לחקור את השינויים הדרמטיים במבנה הגרעיני של התא באמצעות ספרמטוגנזה באמצעות בדיקות פלואורסצנטיות המכתימות באופן ספציפי את כרומוזומי X ו- Y. FISH דורש בדרך כלל הפרעה של איברי הרבייה כדי לחשוף כרומוזומים מיטוטיים או meiotic ולאפשר צביעה של אזורים גנומיים ספציפיים עם בדיקות פלואורסצנטיות. WFISH מאפשר לשמר את המבנה הציטולוגי המקורי של האשכים, יחד עם רמה טובה של זיהוי אותות מגשושיות פלואורסצנטיות המכוונות לרצפי DNA חוזרים. זה מאפשר לחוקרים לעקוב אחר שינויים בהתנהגות הכרומוזומלית של תאים שעברו מיוזה לאורך מבנה האיבר, שם ניתן להבחין בבירור בכל שלב של התהליך. טכניקה זו יכולה להיות שימושית במיוחד לחקר זיווג כרומוזומים מיוטי וחקירת הפנוטיפים הציטולוגיים הקשורים, למשל, לעיוותים סינתטיים ביחס בין המינים, לעקרות זכרית היברידית ולהשמדת גנים המעורבים בזרעונים.

Malaria imposes an enormous burden on the health and well-being of the global human population. In 2021, the World Health Organization (WHO) estimated that malaria caused 619,000 deaths, of which 96% occurred in Sub-Saharan Africa1. The disease is transmitted by mosquitoes belonging to the Anopheles genus, and in Sub-Saharan Africa, three species, namely Anopheles gambiae (An. gambiae), Anopheles coluzzi (An, coluzzi) and Anopheles arabiensis (An. Arabiensis) have a disproportionately large role in malaria transmission, accounting for 95% of malaria cases globally. Control programs relying on traditional methods such as insecticides and antimalarial drugs have saved millions of lives; however, in recent years, the rising resistance to these control methods has challenged their efficacy1,2. In addition, restrictions imposed by the COVID-19 pandemic have affected the availability of key malaria control interventions, which, according to the 2022 WHO World Malaria Report, has increased malaria incidence1. In the last two decades, novel genetic control methods have been developed in laboratory settings to target&#160;Anopheles mosquitoes3,4,5,6,7,8,9,10. Among these strategies, those based on gene drive systems (GDSs) and synthetic sex ratio distorters (SDs) seem promising. GDSs rely on the possibility of transmitting, at a very high frequency, a genetic modification that affects female fertility or impairs the parasite life cycle in the mosquito5,11,12. SDs, instead, act by skewing the sex ratio of a mosquito progeny toward males, which leads, over time, to the collapse of a target population due to a lack of females4,6,13. The main components of these genetic systems act primarily on the reproductive organs of the mosquitoes, where the gametes, eggs, and sperm are produced following meiotic division14.
In this protocol, advances in cytogenetic techniques are employed to explore spermatogenesis in An. gambiae focusing on the chromosomes&#39; behavior in situ. The structure of the mosquito testis and the biological processes that take place within it have been previously investigated using a number of cytological methods, such as immunofluorescence, fluorescent reporter transgenes, and DNA and RNA fluorescence in situ hybridization (FISH)15,16,17,18,19,20; the organs show a spindle-like shape, in which the lower pole is attached to a deferent duct connected to the male accessory glands. In the upper pole, the germline stem cells niche proliferates and differentiates into spermatogonia cells embedded inside spermatocysts formed by somatic cells. Following multiple rounds of mitotic division, the spermatogonia differentiate into spermatocytes, which enter meiosis. At prophase, autosome and sex chromosomes pair with their homologs, and crossing over takes place. After the meiotic divisions, round haploid spermatids are generated and enter spermiogenesis, and this process leads to the formation of mature haploid spermatozoa in which the cytoplasm has been removed, the nuclear chromatin is condensed, and flagella emerge at the basal part of the nuclei21,22 (Figure 1 and Figure 2).
In general, spermiogenesis starts around the mid-pupal stage, and mature spermatozoa can be detected in the late pupal stage in the sperm reservoir23. The maturation process of the spermatocysts continues during adult life23,24,25. In Anopheles testes, each step of spermatogenesis can be easily identified by looking at the nuclear morphology of the cells in each spermatocyst (Figure 2). Whole-mount fluorescence in situ hybridization (WFISH), described in this protocol, allows researchers to specifically label a chromosomal region and track it during spermatogenesis while preserving the native structure of the organ and cell nuclei position; this represents an advantage when compared to the standard DNA FISH protocol in which the organ is usually squashed, leading to tissue damage19. In the current protocol, fluorescent probes are used to stain repetitive sequences on the sex chromosomes and, thus, track their behavior during spermatogenesis, from diploid dividing cells to mature haploid spermatozoa. WFISH can be particularly useful for studying sex chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis4,19,26,27.
Given their role as malaria vectors, Anopheles mosquitoes are the target of an increasing number of genetic vector control strategies, which often act in the reproductive organs of these organisms. Several mosquito mutants and cytological phenotypes have been generated that require novel cytological techniques to be investigated26,27,28,29. The method described in this study sheds light on the understanding of spermatogenesis, as well as the cytological mechanisms behind genetic strategies that have the potential to control malaria-transmitting mosquitoes.

מחבר זרקור: הכלאה פלואורסצנטית באתרו לחקר ספרמטוגנזה ביתוש אנופלס  

הכלאה פלואורסצנטית באתרה לחקר ספרמטוגנזה ביתוש האנופלס

The scope of our research is to develop and share cost-effective and sustainable genetic strategies that aim at reducing the number of malaria-transmitting mosquitoes in South Saharan Africa. In the last few years, we have demonstrated the power of gene drive technologies in suppressing caged mosquito populations. We are currently running a number of experiments to challenge these technologies in more complex experimental setup and to answer the regulatory requirements that are absolutely necessary for the potential implementation of these technologies in the field.FISH is a molecular cytogenetic technique that allows for the staining of a specific DNA sequence. It typically involves the squashing of the organ of interest, which can results in the loss of information about the spatial arrangement of cells. Wellman FISH allows for the preservation of the native cytological structure of the organs.Wellman FISH can be used to study chromosome behavior in mosquito reproductive organs. Reproductive organs are the target of several genetic strategies for vector control. Wellmann FISH has the potential to shed light on the mechanism that take place in the reproductive organs of well-time mosquito, as well as in any genetic strain of interest.

בעבודה זו, WFISH שימש כדי לחקור את התנהגות הכרומוזומים במהלך spermatogenesis ב An. gambiae. הצעד המכריע הראשון ליישום פרוטוקול זה הוא השגת אשכים המראים רמה נמוכה של שינוי מורפולוגי לאחר דיסקציה. ידע בסיסי באנטומיה של היתוש נדרש כדי לבצע דיסקציה מוצלחת של האשכים, ולהלן ניתנות כמה הנחיות להליך זה. אצל יתוש האנופלס , ניתן למצוא אשכים בוגרים השוכבים בקטע הבטן השישי של שלבי הגלמים והבוגרים21. כפי שניתן לראות באיור 1, כלי הדם מחברים את האשכים לבלוטות העזר הגבריות (MAGs), אשר ממוקמות בחלק האחרון של הבטן. המאגדים מחוברים לצינור שפיכה ייחודי המעביר את הזרע ונוזלי הזרע לאיבר הקופולטורי ולחלק החיצוני של מנגנון איברי המין הגברי21. ניתן לנתח את כל מנגנון איברי המין הגברי הפנימי בגישות שונות בהתאם לשלב החיים של היתוש. במהלך שלב הגולם, ניתן לזהות בקלות אשכים באמצעות סטריאומיקרוסקופ לאורך הקוטיקולה הקלה על-ידי התבוננות בצד הגחוני של הבטן בקרבת החלק השישי (איור 1). כדי לנתח את האשכים, ניתן לבודד את החלק התחתון של הבטן, כולל החלק השישי, משאר הגוף באמצעות זוג מחטים ולהעביר לטיפה נקייה של PBS 1x. לאחר הסרת הקטע האחרון, ניתן למעוך את כל המנגנון מהבטן על ידי הפעלת לחץ עדין עם המחטים המנתחות. כדי לנתח את האשכים מזכרים בוגרים, השלב הראשון כולל בידוד של כל הבטן בטיפה טרייה של PBS 1x ואז שליפת החלק האחרון הנושא את האבזמים, שהם מבני הרבייה הזכריים (איור 1). בשלב זה, החלק התחתון של הפצ"רים אמור להופיע ולהיות קל לזיהוי בשל צבעם הצהוב. לאחר מכן ניתן לשלוף את כל המנגנון הגברי החוצה באיטיות בעזרת מחט או מלקחיים בטיפה של PBS 1x עד שזוג האשכים המחוברים לכלי הדם נראים לעין. לפני שממשיכים בקיבוע, חשוב לבודד את האשכים מהחלקים האחרים של המנגנון הגברי על-ידי חיתוך בקרבת החלק התחתון של כלי הדם (איור 1).
גיל הגלמים או הזכרים הבוגרים הוא גורם חשוב שיש לקחת בחשבון בהתאם לשלב הזרע הנחקר. ב An. gambiae , spermatogenesis מתחיל בשלב המוקדם/אמצע הגולם, והוא נמשך לאורך כל חייו של הפרט24. בין 3 שעות ל -10 שעות לאחר הגור, השלבים הפרמיוטיים והמיוטיים מיוצגים יותר באשכים (שלב מיוטי, חלוקות מיוטיות), הדנ"א הזרעוני אינו מעובה יחסית, וזרעונים בוגרים טרם נוצרו. גלמים מאוחרים ובוגרים בני יום אחד מציעים איזון טוב בין השלב הפרה-מיוטי, השלב המיוטי והשלב הפוסט-מיוטי (איור 2 ואיור 3). אצל מבוגרים בני יותר מ -4 ימים, השלבים הפרמיוטיים והזרעונים מיוצגים פחות, והאשכים תפוסים בעיקר על ידי זרע בוגר הכלול במאגר הזרע.
כדי לחקור את ההתנהגות של כרומוזומי המין בשלבים שונים של ספרמטוגנזה, WFISH בוצע על אשכים שנותחו בשלב הגולם המאוחר כדי להבטיח ייצוג טוב של התהליך כולו. כדי לעקוב אחר ההתנהגות של כרומוזומים אלה, נעשה שימוש בבדיקות פלואורסצנטיות ספציפיות לרצפים חוזרים הממוקמים אך ורק על כרומוזום X או Y. ניתן לייצר את הגשושיות הפלואורסצנטיות באמצעות PCR או להשיג אותן באופן מסחרי כאוליגונוקלאוטידים מסומנים בקצה. מומלץ להשתמש באוליגו באורך של >40 bps כדי לאפשר זיהוי אות טוב מבדיקת האוליגו הפלואורסצנטית. מניסיוננו, אוליגו מסומן קצה 3' מתפקד טוב יותר מאשר בדיקות המסומנות PCR במונחים של זיהוי אותות. בנוסף, מספר העותק של רצף היעד הוא גורם שעשוי להשפיע על היעילות של WFISH. אם ההתוויה אינה מצליחה, מומלץ להשתמש בשיטת התיוג PCR על מקטע ארוך יותר או לעצב מספר אוליגו ספציפיים לאזור היעד.
השיטות הנוכחיות, המבוססות על שימוש בתמיסה חודרת (1% טריטון/0.1 M HCl ב-1x PBST), מאפשרות רמה טובה של חדירת האשכים וחדירה של הגשושיות, וכתוצאה מכך תגובת הכלאה מוצלחת. ניתן לתכנן בדיקות אוליגו ספציפיות לרצפים חוזרים של כרומוזומי מין בהתבסס על אפיון נרחב של אלמנטים חוזרים המבוצעים על ידי הול ואחרים. בנוסף, ניתן לקבל רצפי קונצנזוס ספציפיים לאלמנטים חוזרים מקושרי X או Y באמצעות פלטפורמה ביואינפורמטית כגון צינור RedKmer30. חשוב לשים לב כי גשושיות כרומוזומי מין יכולות להתמקד באלמנטים חוזרים כגון לוויינים ורטרוטרנספוזונים, והן יכולות להיות ברמה שונה של הכלאה עם כרומוזומי X או Y בהתאם למין הנבדק 20,31,32. כפי שניתן לראות באיור 3, רמה טובה של הכלאה של הגשושיות ורקע נמוך אפשרו הדמיה של הכרומוזומים הממוקדים במהלך הזרע. ניתן היה לראות את הזיווג של כרומוזומי המין המסומנים בשלבים הפרמיוטיים והמיוטים. לאחר מכן התגלה כרומוזומי X או Y בגרעין התא הפלואידי כתוצאה מחלוקות מיוטיות. לאחר מכן, ניתן היה לעקוב אחר זרעונים נושאי X או Y לאורך הזרע, המסומן ברמות שונות של עיבוי DNA, עד לשלב הסופי של זרעונים בוגרים בצורת חץ. במערך הניסוי הנוכחי, נעשה שימוש בערימות Z קונפוקליות כדי להשיג מידע על הארגון המרחבי התלת-ממדי של התאים במהלך תהליך זה (וידאו 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65356/65356fig01v2.jpg"> איור 1: אשכים שנותחו מגלמים ומזכרי אנופלס גמביה בוגרים בני יום אחד. (A) בטן שנחתכה בשלב הגולם המאוחר המראה את מיקום האשכים בקרבת מקטע הבטן השישי. ניתן לזהות את האשכים לאורך הקוטיקולה ולהופיע כמבנים חומים משני צידי הבטן (עם חצים). (B) אשכים שנחתכו בשלב הגולם, המראים את האשכים הבוגרים (1), vas deferens (2), MAGs (3) וצינור שפיכה (4). (C) בטן שנותחה מזכר בוגר בן יום אחד לאחר הסרת מקטע האבזם הבסיסי. ניתן למעוך את המאגים מהבטן על ידי הפעלת לחץ עדין (חץ לבן). (D) מנגנון רבייה פנימי זכרי שנותח מזכר בוגר בן יום אחד. החץ הלבן מציין את המיקום שנכבש על ידי זרע בוגר, המופיע כצבר לבן בקוטב הבסיסי של האשכים. פסי קנה מידה: (A,C) 200 מיקרומטר; (B,D) 100 מיקרומטר. הספרות הרומיות מ-I עד VIII מציינות את מקטעי הבטן. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig01large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65356/65356fig02v2.jpg"> איור 2: ייצוג של זרע בגמביה אנופלס. התמונה משמאל מראה An. gambiae late pupa testis לאחר צביעת DAPI בהרכבה שלמה. בצד ימין נמצאת גרסה סכמטית להדמיה טובה יותר. על ידי התבוננות בצורה הגרעינית וברמת העיבוי, קל יחסית לעקוב אחר כל שלבי הזרע מתאים דיפלואידיים ועד זרעונים הפלואידים. גומחת תאי הגזע ממוקמת בקוטב העליון של האיבר, שם מתחיל התמיינות לזרעונים. מספרם של תאי הזרע גדל לאחר חלוקה מיטוטית (תאים ירוקים), ותאי הזרע גדלים (תאים צהובים). תאי הזרע מתמיינים לזרעונים לאחר סבבים מרובים של חלוקות מיטוטיות (תאים כחולים). הזרעונים, המאופיינים בגרעינים גדולים יחסית לתאי השלבים האחרים של התהליך, הם התאים שיעברו חלוקה מיוטית. תאים שעוברים מיוזה יכולים להיות מזוהים על ידי התבוננות בנוכחות כרומוזומים בשלבים מיוטיים שונים; ניתן לזהות כרומוזומים של כיאזמטה ומטאפאזות גם בהגדלה נמוכה. השלבים הפרה-מיוטיים מיוצגים יתר על המידה באשכים שנחתחו בשלב הגולם המוקדם. לאחר החטיבות המיוטיות הראשונה והשנייה, מיוצרים זרעונים ובדרך כלל ניתן למצוא אותם שוכבים באמצע האשכים. גרעיני הזרעונים מראים מידה מסוימת של שונות בצורתם, מצורה עגולה לצורה דמוית חץ. הזרעונים נכנסים לתהליך הזרע, שבמהלכו הגרעינים מתחילים להתעבות, והמבנה שלהם משתנה לנקודות דמויות חץ. כאשר יתושים מתבגרים מינית לאחר הופעתם, זרעונים המכילים זרעונים בוגרים יכולים לתפוס את רוב נפח האשכים על חשבון זרעונים בשלב אחר של התפתחות. סרגל קנה מידה: 20 מיקרומטר. הכוכבית (*) מציינת את החלק האפי של האשכים. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig02large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65356/65356fig03v2.jpg"> איור 3: WFISH על An. gambiae testis מנותח משלב הגלמים המאוחר. WFISH בוצע באמצעות בדיקות ספציפיות לכרומוזומי X (Contig_240) ו-Y (בדיקת אוליגו ספציפית לכרומוזומי AgY53B). (A) WFISH מאפשר לעקוב אחר התנהגות כרומוזום המין במהלך ספרמטוגנזה מתאים דיפלואידים לזרעונים הפלואידים. בתמונה זו ניתן להעריך את השינויים הדרמטיים שעוברים הגרעינים במהלך הזרע. תיוג כרומוזומי המין מאפשר הבחנה בין תאים דיפלואידים לתאים הפלואידים. בתאים דיפלואידיים, האות מכרומוזומי המין קשור לאותם גרעינים. בתאים הפלואידים (זרעונים וזרעונים), האות של כרומוזומי המין אינו מקושר עקב החלוקה הרדוקציונית המיוטית. (ב,ג) תמונה בהגדלה גבוהה יותר (63x) של האשכים מוצגת ב-(A). הם נרכשו בעמדות שונות לאורך ציר Z. המסגרות המקווקוות הלבנות מציינות את אזור הרכישה. (B) שלב המעבר בין זרעונים לזרעונים, המראה היווצרות תאים הפלואידים והפרדת האותות מכרומוזומי המין לגרעינים נפרדים. (C) שלב המעבר בין זרעונים הפלואידים לזרעונים בוגרים. שלב זה מציג את השינויים ברמת העיבוי הגרעיני; זרעונים בוגרים מראים צורה דחוסה ומוארכת יותר מאשר זרעונים. מוטות קנה מידה: (A), 30 מיקרומטר; (B,C), 10 מיקרומטר; אפור: DAPI. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig03large.jpg" target="_blank">אנא לחץ כאן כדי להציג גרסה גדולה יותר של איור זה.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>רצף יעד</td>
			<td>קונצנזוס של Primer Sequence ו-Oligo-probe</td>
			<td>הפניה</td>
		</tr><tr><td>Contig_240 (X)</td>
			<td>5'-CAATAAATTTCCTTTTTAATGATGC AAAATCTACGTCTCTAGC-3'-[Fluorochrome]</td>
			<td>19</td>
		</tr><tr><td>AgY53B (Y)</td>
			<td>5'AGAAGAATAGAATCAGAATAGTCGG TTTCTTCATCCTGAAAGCC-3'-[Fluorochrome]</td>
			<td>מחקר זה</td>
		</tr><tr><td>AgY477- AgY53B צומת אזור (Y)</td>
			<td>5'-TTCTAAGTTTCTAGGCTTTAAGGAT GAAGAAACCGACTATTC-3'-[Fluorochrome]</td>
			<td>19</td>
		</tr><tr><td>18S rDNA (X)</td>
			<td>F: AACTGTGGAAAAGCCAGAGC R: TCCACTTGATCCTTGCAAAA</td>
			<td>19</td>
		</tr><tr><td>AgY53B (Y)</td>
			<td>F: CCTTTAAACACATGCTCAAATT R: GTTTCTTCCTTACCTTAAAGCCTAG</td>
			<td>19</td>
		</tr></tbody></table>טבלה 1: רשימת בדיקות אוליגו ספציפיות לכרומוזום X או Y ב- An. gambiae.
וידאו 1: ערימה תלת ממדית על WFISH שבוצעה על An. gambiae testis שנותח משלב הגולם המאוחר. כדי לקבל ייצוג תלת ממדי של תהליך הזרע, ניתן לבצע מחסנית תלת ממדית קונפוקלית על אשכים המראים מספר נמוך של שינויים מבניים. במחקר זה, הערימות בוצעו במרווח של 1.25 מיקרומטר בין שני מקטעים אופטיים תחת עדשת שמן 63x או 40x כדי לא לאבד מידע על הארגון המרחבי התלת-ממדי של התאים. אפור: DAPI, צהוב: Contig_240 (X), מגנטה: AgY53B (Y). <a href="https://www.jove.com/files/ftp_upload/65356/Video-1.zip" target="_blank">אנא לחץ כאן כדי להוריד סרטון זה.</a>

Watch this Scientific Journal Video about Whole-Mount Fluorescence In Situ Hybridization to Study Spermatogenesis in the Anopheles Mosquito at JoVE.com

בהתחשב באנטומיה הפשוטה שלהם, אשכי אנופלס מציעים מודל ציטולוגי טוב לחקר זרע. פרוטוקול זה מתאר הכלאה פלואורסצנטית באתרה , טכניקה המשמשת לחקר תהליך ביולוגי זה, כמו גם את הפנוטיפ של זנים טרנסגניים בעלי מוטציות בגנים המעורבים בייצור זרע.

Spermatogenesis is a complex biological process during which diploid cells undergo successive mitotic and meiotic division followed by large structural ...

היקף המחקר שלנו הוא לפתח ולשתף אסטרטגיות גנטיות חסכוניות ובנות קיימא שמטרתן להפחית את מספר היתושים המעבירים מלריה בדרום אפריקה הסהרה. בשנים האחרונות הדגמנו את כוחן של טכנולוגיות דחיפת גנים בדיכוי אוכלוסיות יתושים בכלובים. בימים אלה אנו עורכים מספר ניסויים כדי לאתגר טכנולוגיות אלה במערך ניסויי מורכב יותר ולענות על הדרישות הרגולטוריות הנחוצות לחלוטין ליישום פוטנציאלי של טכנולוגיות אלה בשטח.FISH היא טכניקה ציטוגנטית מולקולרית המאפשרת צביעה של רצף DNA מסוים. זה בדרך כלל כרוך מעיכה של האיבר של עניין, אשר יכול לגרום לאובדן מידע על הסדר המרחבי של תאים. Wellman FISH מאפשר שימור המבנה הציטולוגי המקומי של האיברים.ניתן להשתמש ב-Wellman FISH כדי לחקור התנהגות כרומוזומים באיברי הרבייה של יתושים. איברי רבייה הם המטרה של מספר אסטרטגיות גנטיות לשליטה וקטורית. ל-Wellmann FISH יש פוטנציאל לשפוך אור על המנגנון המתרחש באיברי הרבייה של יתוש זמן טוב, כמו גם בכל זן גנטי מעניין.

whole-mount-fluorescence-situ-hybridization-to-study-spermatogenesis

Research

JoVE Journal

Immunology and Infection

Whole-Mount Fluorescence In Situ Hybridization to Study Spermatogenesis in the Anopheles Mosquito

1.5K Views.  Imperial College London. היקף המחקר שלנו הוא לפתח ולשתף אסטרטגיות גנטיות חסכוניות ובנות קיימא שמטרתן להפחית את מספר היתושים המעבירים מלריה בדרום אפריקה הסהרה. בשנים האחרונות הדגמנו את כוחן של טכנולוגיות דחיפת גנים בדיכוי אוכלוסיות יתושים בכלובים. בימים אלה אנו עורכים מספר ניסויים כדי לאתגר טכנו?...

Video: מחבר זרקור: הכלאה פלואורסצנטית באתרו לחקר ספרמטוגנזה ביתוש אנופלס  

Spermatogenesis is a complex biological process during which diploid cells undergo successive mitotic and meiotic division followed by large structural changes to form haploid spermatozoa. Besides the biological aspect, studying spermatogenesis is of paramount importance for understanding and developing genetic technologies such as gene drive and synthetic sex ratio distorters, which, by altering Mendelian inheritance and the sperm sex ratio, respectively, could be used to control pest insect populations. These technologies have proven to be very promising in lab settings and could potentially be used to control wild populations of Anopheles mosquitoes, which are vectors of malaria. Due to the simplicity of the testis anatomy and their medical importance, Anopheles gambiae, a major malaria vector in sub-Saharan Africa, represents a good cytological model for studying spermatogenesis. This protocol describes how whole-mount fluorescence in situ hybridization (WFISH) can be used to study the dramatic changes in cell nuclear structure through spermatogenesis using fluorescent probes that specifically stain the X and Y chromosomes. FISH usually requires the disruption of the reproductive organs to expose mitotic or meiotic chromosomes and allow the staining of specific genomic regions with fluorescent probes. WFISH enables the preservation of the native cytological structure of the testis, coupled with a good level of signal detection from fluorescent probes targeting repetitive DNA sequences. This allows researchers to follow changes in the chromosomal behavior of cells undergoing meiosis along the structure of the organ, where each phase of the process can clearly be distinguished. This technique could be particularly useful for studying chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis.

Given their simple anatomy, Anopheles testes offer a good cytological model for studying spermatogenesis. This protocol describes whole-mount fluorescence in situ hybridization, a technique used to investigate this biological process, as well as the phenotype of transgenic strains harboring mutations in the genes involved in sperm production.

Generating DNA Probes to Label the Sex Chromosomes of Anopheles Mosquitoes and Preparing the Hybridization Solution

Generating DNA Probes to Label the Sex Chromosomes of Anopheles Mosquitoes and Preparing the Hybridization Solution  

Begin by using a commercial extraction kit to extract the genomic DNA from the pupae or from adult male Anopheles mosquitoes. Next, prepare the PCR reaction mixture. Label the 18 SR-DNA and satellite AGY 53B by performing a PCR reaction.For the preparation of the hybridization solution, add five microliters of labeled DNA probe to a 1.5 milliliter tube. Then add five microliters of salmon sperm DNA. Precipitate the DNA probe by adding two volumes of 100%ethanol and 0.1 volume of three molar sodium acetate.Keep at minus 20 degrees Celsius for at least 2.5 hours. Centrifuge the tube at 17, 000 G for 20 minutes at four degrees Celsius. Then remove the ethanol and air dry the pellet at room temperature in the dark for 20 minutes.Next, prepare the hybridization buffer in a 1.5 milliliter tube. Vortex the solution for one minute and allow the dextran sulfate to dissolve at 37 degrees Celsius for 30 minutes. To obtain the hybridization solution, dissolve the DNA palette in 20 to 30 microliters of the hybridization buffer.Vortex the solution for one minute. Perform a quick spin, and store the tubes at 37 degrees Celsius in the dark.

יצירת בדיקות DNA לסימון כרומוזומי המין של יתושי אנופלס והכנת פתרון ההכלאה

Anopheles Mosquito Testis Dissection and Hybridisation

Anopheles Mosquito Testis Dissection and Hybridisation  

Begin by excising at least 20 testes from the pupae of Anopheles mosquitoes in sterile PBS. Transfer the testes to a clean microscope slide containing a fresh drop of PBS. Using P1000 boarded filtered tips or the tip of a dissection needle, transfer the testes into an embryo dish containing 3.7%formaldehyde in PBST.Incubate for 10 minutes at room temperature. Next, wash the testes in PBST for five minutes at room temperature. Transfer the testes to the embryo dish containing RNase A and incubated for a half hour at 37 degrees Celsius.Remove the RNA solution and add one milliliter of the penetrating solution. Incubate the testes in the penetrating solution at room temperature for 10 minutes. Then wash the testes and PBST two times for five minutes each.Transfer the testes to a 1.5 milliliter tube containing 20 to 30 microliters of hybridization solution with the labeled DNA probe. Incubate the mixture overnight at 37 degrees Celsius in the dark to allow hybridization. With the help of AP 1000 white bore filtered tip, transfer the testes into an embryo dish, then wash them in two XSSC for five minutes.Remove the SSC then mount the testes on a frosted glass slide using a commercially available mounting medium containing DAPI. Seal the slide with a cover slip sealant and incubate it at room temperature in the dark for two hours. A good level of hybridization allowed for the visualization of the targeted chromosomes throughout spermatogenesis.The pairing of the labeled sex chromosomes could be seen in the prebiotic and myotic stages. X or Y bearing spermatids could be followed throughout spermiogenesis marked by different levels of DNA condensation to the final step of arrow shaped mature spermatozoa.