이 작업은 빌 & 멜린다 게이츠 재단(Bill & Melinda Gates Foundation)과 오픈 필란트로피(Open Philanthropy)의 보조금으로 지원되었습니다. 현미경 분석을 위해 임페리얼 칼리지 런던(Imperial College London)의 광학 현미경 이미징 시설(Facility for Imaging by Light Microscopy, FILM)에 감사드립니다. 그림 2는 Biorender.com 로 작성되었습니다.

1. DNA 프로브 라벨링
참고: 다음은 An. gambiae 모기의 성염색체를 특이적으로 표지하는 형광 DNA 프로브를 생성하는 기술적 단계입니다.
<ol><li>PCR을 사용한 프로브 라벨링<ol><li>번데기 또는 성체 수컷에서 게놈 DNA를 추출하여 시판되는 게놈 DNA 추출 키트를 사용하여 X 또는 Y 염색체를 라벨링합니다( 재료 표 참조).</li>
		<li>PCR 반응 혼합물을 준비합니다: 게놈 DNA 200ng, 표지되지 않은 뉴클레오티드(dATP, dCTP, dGTP) 0.015mM, 형광 표지된 dUTP 1uL(Cy3, Cy5 또는 기타 형광 색소), 순방향 및 역방향 프라이머 50pmol(표 1), 10x PCR 완충액 5μL 및 Taq DNA 중합효소 10U( 재료 표 참조).</li>
		<li>18S rDNA 및 위성 AgY53B(표 1)를 표지하려면 다음 PCR 파라미터를 사용하여 PCR 반응을 수행합니다. 30초 동안 95°C, 30초 동안 52°C, 45초 동안 72°C의 35회 주기; 5분 동안 72°C의 한 사이클; 그리고 4 °C에서 최종 유지. 참고: 성공적인 WFISH에 중요한 PCR 라벨링 방법(5μL에서 ~1μg)으로 양호한 프로브 농도를 얻으려면 PCR 반응이 매우 효율적이어야 합니다. 이러한 이유로, 프로브에 라벨을 붙이기 전에, 증폭을 위해 선택된 프라이머의 효능을 테스트하는 것이 좋습니다. 또한 PCR 반응(형광 dUTP 없음)에 양성 대조군을 포함하면 표지 반응의 효능을 검증하는 데 도움이 됩니다.</li>
		<li>프로브를 -20°C의 어두운 곳에 보관하십시오.</li>
	</ol></li>
	<li>3' 말단 형광 올리고뉴클레오티드 프로브 얻기<ol><li>Cy3 또는 Cy5 형광 색소(또는 다른 형광 색소)를 뉴클레오티드 서열의 3' 말단에 추가하여 변형된 올리고로서 상업적으로 이용 가능한 형광 올리고뉴클레오티드 프로브를 얻습니다( 재료 표 참조). Contig_240에서 Y 결합 위성 AgY477-AgY53B 접합 영역 및 X 결합 위성을 라벨링하는 데 사용되는 참조 서열은 표 1 의 프라이머/올리고뉴클레오티드를 참조하십시오. 참고: 3' 말단 표지 올리고뉴클레오티드의 농도와 관련된 기술적 장애는 없으며, 사용자가 일반적으로 구매 전에 선택할 수 있습니다. 올리고 프로브를 사용하여 효율적인 라벨링을 위해 하이브리드화 버퍼에 ~800ng의 올리고 프로브 용액을 희석하는 것이 좋습니다. X- 및 Y-특이적 올리고 프로브는 이전에 Liang 및 Sharakhov19에 의해 WFISH에 사용되었으며, 참조 서열은 표 1에서 찾을 수 있습니다.</li>
	</ol></li>
</ol>2. 하이브리드화 용액의 준비
참고: 1단계에서 생성된 형광 프로브는 표적 염기서열과 하이브리드화되는 화학 용액에 통합되어야 합니다.
<ol><li>형광 in situ 교잡 전 프로브 침전<ol><li>1.5mL 튜브에 5μL의 표지된 DNA 프로브(PCR 라벨링 방법으로 얻은 경우) 또는 2.2μL의 1단계에서 3' 변형 올리고 프로브(~800ng의 프로브)와 5μL의 연어 정자 DNA를 추가합니다( 재료 표 참조). 동일한 튜브에서 서로 다른 게놈 영역에 특이적인 프로브를 결합하고 다음 단계에서 고유한 솔루션으로 사용합니다.</li>
		<li>0.1 부피의 3M 아세트산 나트륨과 2 부피의 100% 에탄올을 첨가하여 DNA 프로브를 침전시킵니다. 최소 2.5시간 동안 -20°C에서 유지합니다(-20°C에서 배양 시간을 늘리면 최종 수율이 증가함). 이 단계에서 프로브는 원심분리 전에 하룻밤 동안 보관할 수도 있습니다.</li>
		<li>4°C에서 17,000 x g 으로 20분 동안 원심분리하고 에탄올을 제거한 다음 펠릿을 RT에서 ~20분 동안 공기 건조합니다.</li>
	</ol></li>
	<li>하이브리드화 솔루션<ol><li>고환 해부를 진행하기 전에(3단계) 1.5 튜브에 포름아미드 500μL, 덱스트란 설페이트 0.2g, 20x 식염나트륨 시트레이트(SSC) 100μL 및 멸균 H200μL 200μL의 시약을 혼합하여 혼성화 완충액을 준비합니다(재료표 참조). 혼성화 용액을 1분 동안 와류시키고 덱스트란 황산염을 37°C에서 30분 동안 용해시킵니다.</li>
		<li>2.1.3 단계의 펠릿을 20-30 μL의 혼성화 완충액(약 1분 동안 와류, 빠른 회전을 수행하고 튜브를 어두운 곳에서 37°C에 보관)에 용해시켜 혼성화 용액을 얻습니다.</li>
	</ol></li>
</ol>3. 고환 박리 및 고정
<ol><li>실온(RT)에서 번데기 또는 생후 1일 된 성충의고환 21 ~20개를 멸균 1x 인산염 완충 식염수(PBS) 용액에 절개하고 1x PBS 용액을 새 한 방울 떨어뜨린 깨끗한 현미경 슬라이드로 옮깁니다.</li>
	<li>P1,000 광구경 필터 팁 또는 1x PBS 방울의 해부 바늘 팁을 사용하여 고환을 0.1% 트윈-20(PBST)이 있는 1x PBS의 3.7% 포름알데히드가 포함된 배아 접시에 옮기고 RT에서 10분 동안 배양합니다.</li>
	<li>고환을 RT에서 5분 동안 1x PBST로 세척합니다. 37°C에서 30분 동안 멸균 1x PBS에 희석한 0.1mg/mL RNAse A( 재료 표 참조)에서 고환을 배양합니다.</li>
	<li>RNAse 용액을 제거하고 침투 용액(1x PBST에서 1% Triton/0.1M HCl)을 추가하고 실온에서 10분 동안 배양합니다. 참고: Proteinase K는 1x PBST에서 최종 농도 10μg/mL에서 침투제로 사용하여 고환의 투과성을 높일 수 있습니다.</li>
	<li>고환을 1x PBST에서 RT에서 각각 5분 동안 두 번 세척합니다.</li>
</ol>4. 하이브리드화
참고: 이 섹션에서는 in situ 하이브리드화의 최종 단계에 대해 설명합니다.
<ol><li>세척 단계(단계 3.5) 후, 이전에 준비된 프로브를 포함하는 20-30μL의 혼성화 용액과 함께 1.5mL 튜브에 고환을 옮깁니다(단계 2.2.2). 피펫의 끝을 사용하여 용액을 부드럽게 혼합합니다. 다음 단계를 진행하기 전에 튜브를 부드럽게 다섯 번 튕깁니다.</li>
	<li>DNA 변성을 위해 75°C에서 5분간 배양합니다.</li>
	<li>DNA-DNA 혼성화를 위해 37°C(가능한 경우 100rpm 미만에서 흔들림)에서 밤새 배양합니다.</li>
	<li>P1,000 대구경 필터 팁을 사용하여 고환을 배아 접시에 다시 옮기고 50°C로 예열된 2x SSC에서 5분 동안 세척합니다. 알림: 하이브리드화 단계 후에는 2x SSC를 사용하는 최종 세척 단계가 필요합니다. 이것은 장기 조직 내부에 잡성화되지 않은 프로브의 존재로 인한 배경 신호를 제거하는 데 중요한 역할을 합니다. 강한 배경 신호가 있는 경우 최종 세탁 단계를 반복하는 것이 좋습니다.</li>
	<li>2x SSC를 제거하고 젖빛 유리 슬라이드에 4′,6-diamidino-2-phenylindole(DAPI)( 재료 표 참조)이 있는 시중에서 판매되는 장착 매체를 사용하여 고환을 장착하고 커버슬립 실런트로 밀봉하고 어둠 속에서 RT에서 최소 2시간 동안 배양합니다.</li>
	<li>공초점 이미징을 수행합니다. 전체 고환은 40x 또는 63x 오일 이멀젼 대물렌즈를 사용하여 시각화할 수 있습니다. z-스택을 수행하는 경우 1.25μm의 z-단계를 사용하는 것이 좋습니다.</li>
</ol>

모기 정자 형성을 연구하기 위한 Fluorescence In Situ Hybridization

<ol>
	<li>World Malaria Report. World Health Organization Available from: <a target="_blank" href="https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2022">https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2022</a> (2022)</li><li>Bhatt, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+malaria+control+on+Plasmodium+falciparum+in+Africa+between+2000+and+2015.">The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015.</a> Nature. 526 (7572), 207-211 (2015).</li><li>Hammond, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+gene+drive+system+targeting+female+reproduction+in+the+malaria+mosquito+vector+Anopheles+gambiae.">A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae.</a> Nature Biotechnology. 34 (1), 78-83 (2016).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature Communications. 5 (1), 3977 (2014).</li><li>Kyrou, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+gene+drive+targeting+doublesex+causes+complete+population+suppression+in+caged+Anopheles+gambiae+mosquitoes.">A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes.</a> Nature Biotechnology. 36 (11), 1062-1066 (2018).</li><li>Simoni, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+male-biased+sex-distorter+gene+drive+for+the+human+malaria+vector+Anopheles+gambiae.">A male-biased sex-distorter gene drive for the human malaria vector Anopheles gambiae.</a> Nature Biotechnology. 38 (9), 1054-1060 (2020).</li><li>Gantz, V. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+Cas9-mediated+gene+drive+for+population+modification+of+the+malaria+vector+mosquito+Anopheles+stephensi.">Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (49), E6736-E6743 (2015).</li><li>Bernardini, F., Kriezis, A., Galizi, R., Nolan, T., Crisanti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introgression+of+a+synthetic+sex+ratio+distortion+system+from+Anopheles+gambiae+into+Anopheles+arabiensis.">Introgression of a synthetic sex ratio distortion system from Anopheles gambiae into Anopheles arabiensis.</a> Scientific Reports. 9 (1), 5158 (2019).</li><li>Hammond, A. M., Galizi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+drives+to+fight+malaria:+Current+state+and+future+directions.">Gene drives to fight malaria: Current state and future directions.</a> Pathogens and Global Health. 111 (8), 412-423 (2017).</li><li>Garrood, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Driving+down+malaria+transmission+with+engineered+gene+drives.">Driving down malaria transmission with engineered gene drives.</a> Frontiers in Genetics. 13, 891218 (2022).</li><li>Hoermann, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+drive+mosquitoes+can+aid+malaria+elimination+by+retarding+Plasmodium+sporogonic+development.">Gene drive mosquitoes can aid malaria elimination by retarding Plasmodium sporogonic development.</a> Science Advances. 8 (38), (2022).</li><li>Nash, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integral+gene+drives+for+population+replacement.">Integral gene drives for population replacement.</a> Biology Open. 8 (1), (2019).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+sex-ratio+distortion+system+for+genetic+control.">A CRISPR-Cas9 sex-ratio distortion system for genetic control.</a> Scientific Reports. 6 (1), 31139 (2016).</li><li>Terradas, G., Hermann, A., James, A. A., McGinnis, W., Bier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+in+situ+analysis+of+Cas9+germline+transcript+distributions+in+gene-drive+Anopheles+mosquitoes.">High-resolution in situ analysis of Cas9 germline transcript distributions in gene-drive Anopheles mosquitoes.</a> G3: Genes, Genomes, Genetics. 12 (1), (2022).</li><li>Durant, A. C., Donini, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ammonium+transporter+expression+in+sperm+of+the+disease+vector+Aedes+aegypti+mosquito+influences+male+fertility.">Ammonium transporter expression in sperm of the disease vector Aedes aegypti mosquito influences male fertility.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (47), 29712-29719 (2020).</li><li>Taxiarchi, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+transcriptional+profiling+of+Anopheles+gambiae+spermatogenesis+reveals+mechanisms+of+sex+chromosome+regulation.">High-resolution transcriptional profiling of Anopheles gambiae spermatogenesis reveals mechanisms of sex chromosome regulation.</a> Scientific Reports. 9 (1), 14841 (2019).</li><li>Pompon, J., Levashina, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+role+of+the+mosquito+complement-like+cascade+in+male+fertility+in+Anopheles+gambiae.">A new role of the mosquito complement-like cascade in male fertility in Anopheles gambiae.</a> PLoS Biology. 13 (9), e1002255 (2015).</li><li>Papathanos, P. A., Windbichler, N., Menichelli, M., Burt, A., Crisanti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+vasa+regulatory+region+mediates+germline+expression+and+maternal+transmission+of+proteins+in+the+malaria+mosquito+Anopheles+gambiae:+A+versatile+tool+for+genetic+control+strategies.">The vasa regulatory region mediates germline expression and maternal transmission of proteins in the malaria mosquito Anopheles gambiae: A versatile tool for genetic control strategies.</a> BMC Molecular Biology. 10 (1), 13 (2009).</li><li>Liang, J., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premeiotic+and+meiotic+failures+lead+to+hybrid+male+sterility+in+the+Anopheles+gambiae+complex.">Premeiotic and meiotic failures lead to hybrid male sterility in the Anopheles gambiae complex.</a> Proceedings of the Royal Society B. 286 (1906), 20191080 (2019).</li><li>Hall, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radical+remodeling+of+the+Y+chromosome+in+a+recent+radiation+of+malaria+mosquitoes.">Radical remodeling of the Y chromosome in a recent radiation of malaria mosquitoes.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (15), E2114-E2123 (2016).</li><li>Clements, A. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Biology of Mosquitoes. Volume 1: Development, Nutrition and Reproduction. , (1992).</li><li>Demarco, R. S., Eikenes, &. #. 1. 9. 7. ;. H., Haglund, K., Jones, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+spermatogenesis+in+Drosophila+melanogaster.">Investigating spermatogenesis in Drosophila melanogaster.</a> Methods. 68 (1), 218-227 (2014).</li><li>Helinski, M. E., Parker, A. G., Knols, B. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radiation+biology+of+mosquitoes.">Radiation biology of mosquitoes.</a> Malaria Journal. 8, S6 (2009).</li><li>Huho, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+morphological+method+to+assess+the+age+of+male+Anopheles+gambiae.">A reliable morphological method to assess the age of male Anopheles gambiae.</a> Malaria Journal. 5 (1), 62 (2006).</li><li>Fabian, L., Brill, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+spermiogenesis.">Drosophila spermiogenesis.</a> Spermatogenesis. 2 (3), 197-212 (2012).</li><li>Li, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppressing+mosquito+populations+with+precision+guided+sterile+males.">Suppressing mosquito populations with precision guided sterile males.</a> Nature Communications. 12 (1), 5374 (2021).</li><li>Thailayil, J., Magnusson, K., Godfray, H. C., Crisanti, A., Catteruccia, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spermless+males+elicit+large-scale+female+responses+to+mating+in+the+malaria+mosquito+Anopheles+gambiae.">Spermless males elicit large-scale female responses to mating in the malaria mosquito Anopheles gambiae.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (33), 13677-13681 (2011).</li><li>Haghighat-Khah, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanisms+regulating+synthetic+sex+ratio+distortion+in+the+Anopheles+gambiae+germline.">Cellular mechanisms regulating synthetic sex ratio distortion in the Anopheles gambiae germline.</a> Pathogens and Global Health. 114 (7), 370-378 (2020).</li><li>Yamamoto, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+male-specific+sterilization+system+using+the+mammalian+pro-apoptotic+factor+in+a+malaria+vector+mosquito.">A synthetic male-specific sterilization system using the mammalian pro-apoptotic factor in a malaria vector mosquito.</a> Scientific Reports. 9 (1), 8160 (2019).</li><li>Papathanos, P. A., Windbichler, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redkmer:+An+assembly-free+pipeline+for+the+identification+of+abundant+and+specific+X-chromosome+target+sequences+for+X-shredding+by+CRISPR+endonucleases.">Redkmer: An assembly-free pipeline for the identification of abundant and specific X-chromosome target sequences for X-shredding by CRISPR endonucleases.</a> The CRISPR Journal. 1 (1), 88-98 (2018).</li><li>Sharma, A., Kinney, N. A., Timoshevskiy, V. A., Sharakhova, M. V., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+variation+of+the+X+chromosome+heterochromatin+in+the+Anopheles+gambiae+complex.">Structural variation of the X chromosome heterochromatin in the Anopheles gambiae complex.</a> Genes. 11 (3), 327 (2020).</li><li>Krzywinski, J., Sangar&#233;, D., Besansky, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Satellite+DNA+from+the+Y+chromosome+of+the+malaria+vector+Anopheles+gambiae.">Satellite DNA from the Y chromosome of the malaria vector Anopheles gambiae.</a> Genetics. 169 (1), 185-196 (2005).</li><li>Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+in+situ+hybridization+on+mitotic+chromosomes+of+mosquitoes.">Fluorescent in situ hybridization on mitotic chromosomes of mosquitoes.</a> Journal of Visualized Experiments. (67), e4215 (2012).</li><li>Liang, J., Hodge, J. M., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Asymmetric+phenotypes+of+sterile+hybrid+males+from+reciprocal+crosses+between+species+of+the+Anopheles+gambiae+complex.">Asymmetric phenotypes of sterile hybrid males from reciprocal crosses between species of the Anopheles gambiae complex.</a> Frontiers in Ecology and Evolution. 9, 660207 (2021).</li><li>Slotman, M., Torre, A. D., Powell, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetics+of+inviability+and+male+sterility+in+hybrids+between+Anopheles+gambiae+and+An.+arabiensis.">The genetics of inviability and male sterility in hybrids between Anopheles gambiae and An. arabiensis.</a> Genetics. 167 (1), 275-287 (2004).</li><li>Wood, R. J., Newton, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex-ratio+distortion+caused+by+meiotic+drive+in+mosquitoes.">Sex-ratio distortion caused by meiotic drive in mosquitoes.</a> The American Naturalist. 137 (3), 379-391 (1991).</li><li>Cazemajor, M., Joly, D., Montchamp-Moreau, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex-ratio+meiotic+drive+in+Drosophila+simulans+is+related+to+equational+nondisjunction+of+the+Y+chromosome.">Sex-ratio meiotic drive in Drosophila simulans is related to equational nondisjunction of the Y chromosome.</a> Genetics. 154 (1), 229-236 (2000).</li><li>Jaenike, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+chromosome+meiotic+drive.">Sex chromosome meiotic drive.</a> Annual Review of Ecology and Systematics. 32 (1), 25-49 (2001).</li><li>Courret, C., Chang, C. H., Wei, K. H., Montchamp-Moreau, C., Larracuente, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+drive+mechanisms:+Lessons+from+Drosophila.">Meiotic drive mechanisms: Lessons from Drosophila.</a> Proceedings of the Royal Society B. 286 (1913), 20191430 (2019).</li><li>Zanders, S. E., Unckless, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fertility+costs+of+meiotic+drivers.">Fertility costs of meiotic drivers.</a> Current Biology. 29 (11), R512-R520 (2019).</li><li>Newton, M. E., Wood, R. J., Southern, D. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytogenetic+analysis+of+meiotic+drive+in+the+mosquito,+Aedes+aegypti+(L.).">A cytogenetic analysis of meiotic drive in the mosquito, Aedes aegypti (L.).</a> Genetica. 46 (3), 297-318 (1976).</li><li>Carabajal Paladino, L. Z., Nguyen, P., &#352;&#237;chov&#225;, J., Marec, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+single-copy+genes+by+TSA-FISH+in+the+codling+moth,+Cydia+pomonella.">Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.</a> BMC Genomic Data. 15, S15 (2014).</li><li>Bernardini, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-species+Y+chromosome+function+between+malaria+vectors+of+the+Anopheles+gambiae+species+complex.">Cross-species Y chromosome function between malaria vectors of the Anopheles gambiae species complex.</a> Genetics. 207 (2), 729-740 (2017).</li></ol>

저자는 공개할 것이 없습니다.

일반적으로 FISH 프로토콜은 염색체 염색을 허용하기 위해 관심 기관을 찌그러뜨려야 합니다. 이것은 그 기관(33) 내의 세포들의 공간적 배열에 관한 정보의 손실을 야기한다. 이 프로토콜은 정자 형성과 같은 생물학적 과정을 고환과 내부 세포학적 조직의 온전한 기본 구조를 유지하면서 현장에서 연구할 수 있는 방법을 설명합니다. 특히 성염색체20이 풍부하게 함유된 다양한 DNA 반복 요소를 표적으로 하는 프로브를 동시에 사용하여 정자 성숙의 역학을 밝힐 수 있습니다. 고환 해부의 시기에 따라 WFISH는 모기 발달을 통해 정자 형성의 여러 단계를 연구할 수 있는 기회를 제공합니다. WFISH는 Anopheles 모기에서 수막전 부전 및 성염색체 비분리와 같은 감수분열 결함의 존재로 인한 하이브리드 비호환성과 같은 특정 현상을 연구하는 데 유용합니다 19,34,35. 생물학적 측면 외에도 정자 형성은 Anopheles 모기와 같은 해충 곤충을 통제하기 위해 개발 된 여러 유전 전략의 대상입니다. 이러한 맥락에서, An. gambiae의 X-결합 rDNA 유전자좌는 X-함유 정자를 손상시킴으로써 자손을 남성으로 편향시키는 합성 성비 왜곡제를 개발하기 위한 표적으로 사용되어 왔다 4,8,13.
이 기술은 모기를 포함한 여러 분류군에서 확인되었지만 여전히 잘 이해되지 않은 상태로 남아 있는 자연적인 성비 감수분열 드라이브의 작용을 반영합니다 28,36,37,38,39,40,41. WFISH는 이러한 현상을 조사할 수 있는 기회를 제공하며, 예를 들어 성염색체 파쇄에 사용되는 표적 부위의 선택에 따라 정자 생산의 세포학이 어떻게 영향을 받는지에 대한 정보를 제공함으로써 성 왜곡 기반 유전 전략을 개선하거나 개선할 수 있는 길을 열어줍니다. 경험상 WFISH는 성공 가능성이 높지만 실패는 여전히 발생할 수 있습니다. 이는 비효율적인 수준의 조직 투과화 때문일 수 있으며, 이는 침투 용액의 배양 시간을 늘려 극복할 수 있습니다. 또는 투과화 단계에서 Proteinase K를 사용할 수 있습니다. 어떤 경우에는 정자 세포 핵에서 더 높은 신호와 감수분열 및 정자 형성 단계에서 더 낮거나 없는 신호와 함께 균일하지 않은 수준의 프로브 침투를 발견했습니다. 이는 세포 단계에 따른 투과화 수준의 차이 때문일 수 있습니다. 또한 WFISH는 높은 복제 수로 존재하는 DNA 염기서열을 표적으로 삼도록 설계된 형광 프로브를 사용할 때 유용한 것으로 입증되었습니다. single-copy 유전자를 표적으로 하는 경우, 신호 검출이 충분하지 않을 수 있습니다. 이 경우, 티라미드 신호 증폭(TSA)과 같은 신호 증폭을 위한 방법들이 적분되어야 한다(42).
이 프로토콜은 면역염색 또는 생식세포 특이적 형광 마커16,18을 보유하는 형질전환 리포터 균주와 결합될 수 있는데, 이는 단백질 국소화 및 유전자 발현에 대한 정보를 제자리에서 추가할 수 있기 때문입니다. 이 연구에서 WFISH는 Anopheles 모기의 정자 형성을 조사하는 기술로 설명됩니다. 그러나 남성 생식 기관의 해부학적 구조를 공유한다는 점을 감안할 때 이 프로토콜은 질병 전염에 중요한 역할을 하는 다른 모기 종에도 적용될 수 있습니다. 유사하게, 여성의 생식세포 형성은 이 기술을 사용하여 조사할 수 있습니다. 또한, 기생충 침입의 표적이 되는 모기 중장(midgut)과 같은 관심 장기나 조직, 또는 잡종 모기와 같은 비정형적 유전적 배경에 대한 세포학적 연구를 탐색할 수 있다43. 더욱이, 이 기술은 잠재적으로 Diptera 목 내의 다른 유기체로 이전될 수 있습니다.

말라리아는 전 세계 인류의 건강과 복지에 막대한 부담을 주고 있습니다. 2021년 세계보건기구(WHO)는 말라리아로 인한 사망자가 619,000명으로 추산되었으며, 그 중 96%가 사하라 사막 이남 아프리카1에서 발생했습니다. 이 질병은 Anopheles 속에 속하는 모기에 의해 전염되며, 사하라 사막 이남 아프리카에서는 Anopheles gambiae (An. gambiae), Anopheles coluzzi (An, coluzzi) 및 Anopheles arabiensis (An. Arabiensis)의 세 종이 말라리아 전염에 불균형적으로 큰 역할을 하며 전 세계 말라리아 사례의 95 %를 차지합니다. 살충제와 항말라리아 약과 같은 전통적인 방법에 의존하는 방제 프로그램은 수백만 명의 생명을 구했습니다. 그러나 최근 몇 년 동안 이러한 제어 방법에 대한 저항이 증가함에 따라 효능이 도전 받고있습니다 1,2. 또한 COVID-19 팬데믹으로 인한 제한 조치는 주요 말라리아 통제 개입의 가용성에 영향을 미쳤으며, 2022년 WHO 세계 말라리아 보고서에 따르면 말라리아 발병률이 증가했습니다1. 지난 20년 동안 아노펠레스 모기 3,4,5,6,7,8,9,10을 표적으로 삼는 새로운 유전자 제어 방법이 실험실 환경에서 개발되었습니다. 이러한 전략 중 유전자 구동 시스템(GDS)과 합성 성비 왜곡자(SD)를 기반으로 하는 전략이 유망해 보입니다. GDS는 여성의 생식력에 영향을 미치거나 모기의 기생충 생활주기를 손상시키는 유전자 변형을 매우 높은 빈도로 전달할 가능성에 의존합니다 5,11,12. 대신 SD는 수컷에 대한 모기 자손의 성비를 왜곡하여 작용하며, 이는 시간이 지남에 따라 암컷의 부족으로 인해 대상 개체군의 붕괴로 이어진다 4,6,13. 이러한 유전 시스템의 주요 구성 요소는 주로 모기의 생식 기관에 작용하며, 모기의 생식 기관은 감수분열분열 14에 따라 생산됩니다.
이 프로토콜에서는 세포유전학 기술의 발전이 제자리 염색체의 거동에 초점을 맞춘 An. gambiae의 정자 형성을 탐구하는 데 사용됩니다.모기 고환의 구조와 그 안에서 일어나는 생물학적 과정은 이전에 면역형광, 형광 리포터 전이유전자, DNA 및 RNA 형광 제자리 교잡(FISH)15,16,17,18,19,20과 같은 여러 세포학적 방법을 사용하여 조사되었습니다; 장기는 방추형 모양을 보이며, 아래쪽 기둥은 남성 액세서리 땀샘에 연결된 지연 덕트에 부착되어 있습니다. 상극에서는 생식세포 줄기세포의 틈새가 증식하여 체세포에 의해 형성된 정낭 내부에 내장된 정자세포로 분화합니다. 여러 차례의 유사분열 후 정자는 감수분열로 들어가는 정세포로 분화합니다. 전단계에서 상염색체와 성염색체는 상동체와 쌍을 이루고 교차가 일어납니다. 감수분열 후 둥근 반수체 정자가 생성되어 정자 형성에 들어가고, 이 과정은 세포질이 제거되고 핵 염색질이 응축되어 핵21,22의 기저부에 편모가 나타나는 성숙한 반수체 정자가 형성됩니다(그림 1 및 그림 2).
일반적으로, 정자형성은 번데기 중기 부근에서 시작되고, 성숙한 정자는 정자저장소(23)에서 번데기 후기 단계에서 검출될 수 있다. 정낭의 성숙 과정은 성인이 되어서도 계속된다23,24,25. 아노펠레스 고환에서 정자 형성의 각 단계는 각 정자 낭종에 있는 세포의 핵 형태를 보면 쉽게 확인할 수 있습니다(그림 2). 이 프로토콜에 설명된 WFISH(Whole-mount fluorescence in situ hybridization)를 통해 연구자들은 염색체 영역을 특이적으로 라벨링하고 정자 형성 중에 이를 추적하면서 장기 및 세포핵 위치의 기본 구조를 보존할 수 있습니다. 이는 장기가 일반적으로 찌그러져 조직 손상을 초래하는 표준 DNA FISH 프로토콜과 비교할 때 이점을 나타낸다19. 현재 프로토콜에서 형광 프로브는 성염색체의 반복적인 서열을 염색하는 데 사용되며, 따라서 이배체 분열 세포에서 성숙한 반수체 정자에 이르기까지 정자 형성 중 행동을 추적합니다. WFISH는 성염색체 감수분열 쌍을 연구하고 예를 들어 합성 성비 왜곡자, 하이브리드 남성 불임 및 정자 형성에 관여하는 유전자의 녹아웃과 관련된 세포학적 표현형을 조사하는 데 특히 유용할 수 있습니다 4,19,26,27.
말라리아 매개체로서의 역할을 감안할 때, 아노펠레스 모기는 종종 이러한 유기체의 생식 기관에서 작용하는 점점 더 많은 유전적 벡터 제어 전략의 표적이 되고 있습니다. 몇 가지 모기 돌연변이 및 세포학적 표현형이 생성되어 새로운 세포학적 기술을 조사해야 합니다26,27,28,29. 이 연구에서 설명된 방법은 정자 형성에 대한 이해와 말라리아 전염 모기를 통제할 수 있는 유전 전략의 세포학적 메커니즘을 밝힙니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amersham CyDye Fluorescent Nucleotides, Cy3-dUTP</td>
			<td>Cytiva</td>
			<td>PA53022</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham CyDye Fluorescent Nucleotides, Cy5-dUTP</td>
			<td>Cytiva</td>
			<td>PA55022</td>
			<td></td>
		</tr>
		<tr>
			<td>ART Wide Bore Filtered Pipette Tips</td>
			<td>ThermoFisher Scientific</td>
			<td>2079GPK</td>
			<td></td>
		</tr>
		<tr>
			<td>CytoBond Removable Coverslip Sealant</td>
			<td>SciGene</td>
			<td>2020-00-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Dextran sulfate sodium salt from Leuconostoc spp.</td>
			<td>Sigma-Aldrich</td>
			<td>D8906-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kits&#160;</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>Embryo Dishes</td>
			<td>VWR</td>
			<td>70543-30</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol, molecular grade</td>
			<td>Sigma-Aldrich</td>
			<td>51976</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>ThermoFisher Scientific</td>
			<td>17899</td>
			<td></td>
		</tr>
		<tr>
			<td>GoTaq G2 DNA Polymerase</td>
			<td>Promega</td>
			<td>M7841</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid, 37%</td>
			<td>Sigma-Aldrich</td>
			<td>320331</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope slides, SuperFrost</td>
			<td>VWR&#160;</td>
			<td>631-0114</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10x), pH 7.4</td>
			<td>ThermoFisher Scientific</td>
			<td>70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce 16% Formaldehyde (w/v), Methanol-free</td>
			<td>ThermoFisher Scientific</td>
			<td>28906</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade Mountant with DAPI</td>
			<td>ThermoFisher Scientific</td>
			<td>P36941</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A/T1 Mix</td>
			<td>ThermoFisher Scientific</td>
			<td>EN0551</td>
			<td></td>
		</tr>
		<tr>
			<td>Set of dATP, dCTP, dGTP, dTTP</td>
			<td>Promega</td>
			<td>U1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution</td>
			<td>ThermoFisher Scientific</td>
			<td>R1181</td>
			<td></td>
		</tr>
		<tr>
			<td>SP8 inverted confocal microscope</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>9036-19-5</td>
			<td></td>
		</tr>
		<tr>
			<td>TWEEN 20</td>
			<td>Sigma-Aldrich</td>
			<td>P1379</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure Salmon Sperm DNA Solution</td>
			<td>ThermoFisher Scientific</td>
			<td>15632011</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure SSC 20x</td>
			<td>ThermoFisher Scientific</td>
			<td>15557044</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer sequences</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;-CAATAAATTTCCTTTTTAATGATGC 
			AAAATCTACGTCTCTAGC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>Contig_240 (X)</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;AGAAGAATAGAATCAGAATAGT 
			CGG 
			TTTCTTCATCCTGAAAGCC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>AgY53B (Y)</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;-TTCTAAGTTTCTAGGCTTTAAGGA 
			T 
			GAAGAAACCGACTATTC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>AgY477- 
			AgY53B 
			junction 
			region (Y)</td>
			<td></td>
		</tr>
		<tr>
			<td>F: AACTGTGGAAAAGCCAGAGC 
			R: TCCACTTGATCCTTGCAAAA</td>
			<td>Eurofins Genomics</td>
			<td>18S rDNA (X)</td>
			<td></td>
		</tr>
		<tr>
			<td>F: CCTTTAAACACATGCTCAAATT 
			R: GTTTCTTCATCCTTAAAGCCTAG</td>
			<td>Eurofins Genomics</td>
			<td>AgY53B (Y)</td>
			<td></td>
		</tr>
	</tbody>
</table>

whole-mount fluorescence in situ hybridization to study spermatogenesis in the anopheles mosquito

정자 형성은 이배체 세포가 연속적인 유사분열 및 감수분열 분열을 겪은 후 반수체 정자를 형성하기 위해 큰 구조적 변화를 겪는 복잡한 생물학적 과정입니다. 생물학적 측면 외에도 정자 형성을 연구하는 것은 유전자 드라이브 및 합성 성비 왜곡제와 같은 유전 기술을 이해하고 개발하는 데 가장 중요하며, 이는 각각 멘델 유전과 정자 성비를 변경하여 해충 곤충 개체수를 통제하는 데 사용할 수 있습니다. 이러한 기술은 실험실 환경에서 매우 유망한 것으로 입증되었으며 말라리아 매개체인 Anopheles 모기의 야생 개체군을 통제하는 데 잠재적으로 사용될 수 있습니다. 고환 해부학의 단순성과 의학적 중요성으로 인해 사하라 사막 이남 아프리카의 주요 말라리아 매개체인 Anopheles gambiae는 정자 형성을 연구하기 위한 좋은 세포학적 모델을 나타냅니다. 이 프로토콜은 X 및 Y 염색체를 특이적으로 염색하는 형광 프로브를 사용하여 정자 형성을 통한 세포 핵 구조의 극적인 변화를 연구하기 위해 전체 장착 형광 in situ hybridization(WFISH)을 사용하는 방법을 설명합니다. FISH는 일반적으로 유사분열 또는 감수분열 염색체를 노출시키고 형광 프로브로 특정 게놈 영역을 염색할 수 있도록 생식 기관을 파괴해야 합니다. WFISH는 반복적인 DNA 염기서열을 표적으로 하는 형광 프로브의 우수한 신호 검출과 함께 고환의 본래 세포학적 구조를 보존할 수 있습니다. 이를 통해 연구자들은 장기의 구조를 따라 감수분열을 겪는 세포의 염색체 거동 변화를 추적할 수 있으며, 이 과정에서 각 단계를 명확하게 구별할 수 있습니다. 이 기술은 염색체 감수분열 쌍을 연구하고 예를 들어 합성 성비 왜곡자, 하이브리드 남성 불임 및 정자 형성에 관여하는 유전자의 녹아웃과 관련된 세포학적 표현형을 조사하는 데 특히 유용할 수 있습니다.

Malaria imposes an enormous burden on the health and well-being of the global human population. In 2021, the World Health Organization (WHO) estimated that malaria caused 619,000 deaths, of which 96% occurred in Sub-Saharan Africa1. The disease is transmitted by mosquitoes belonging to the Anopheles genus, and in Sub-Saharan Africa, three species, namely Anopheles gambiae (An. gambiae), Anopheles coluzzi (An, coluzzi) and Anopheles arabiensis (An. Arabiensis) have a disproportionately large role in malaria transmission, accounting for 95% of malaria cases globally. Control programs relying on traditional methods such as insecticides and antimalarial drugs have saved millions of lives; however, in recent years, the rising resistance to these control methods has challenged their efficacy1,2. In addition, restrictions imposed by the COVID-19 pandemic have affected the availability of key malaria control interventions, which, according to the 2022 WHO World Malaria Report, has increased malaria incidence1. In the last two decades, novel genetic control methods have been developed in laboratory settings to target&#160;Anopheles mosquitoes3,4,5,6,7,8,9,10. Among these strategies, those based on gene drive systems (GDSs) and synthetic sex ratio distorters (SDs) seem promising. GDSs rely on the possibility of transmitting, at a very high frequency, a genetic modification that affects female fertility or impairs the parasite life cycle in the mosquito5,11,12. SDs, instead, act by skewing the sex ratio of a mosquito progeny toward males, which leads, over time, to the collapse of a target population due to a lack of females4,6,13. The main components of these genetic systems act primarily on the reproductive organs of the mosquitoes, where the gametes, eggs, and sperm are produced following meiotic division14.
In this protocol, advances in cytogenetic techniques are employed to explore spermatogenesis in An. gambiae focusing on the chromosomes&#39; behavior in situ. The structure of the mosquito testis and the biological processes that take place within it have been previously investigated using a number of cytological methods, such as immunofluorescence, fluorescent reporter transgenes, and DNA and RNA fluorescence in situ hybridization (FISH)15,16,17,18,19,20; the organs show a spindle-like shape, in which the lower pole is attached to a deferent duct connected to the male accessory glands. In the upper pole, the germline stem cells niche proliferates and differentiates into spermatogonia cells embedded inside spermatocysts formed by somatic cells. Following multiple rounds of mitotic division, the spermatogonia differentiate into spermatocytes, which enter meiosis. At prophase, autosome and sex chromosomes pair with their homologs, and crossing over takes place. After the meiotic divisions, round haploid spermatids are generated and enter spermiogenesis, and this process leads to the formation of mature haploid spermatozoa in which the cytoplasm has been removed, the nuclear chromatin is condensed, and flagella emerge at the basal part of the nuclei21,22 (Figure 1 and Figure 2).
In general, spermiogenesis starts around the mid-pupal stage, and mature spermatozoa can be detected in the late pupal stage in the sperm reservoir23. The maturation process of the spermatocysts continues during adult life23,24,25. In Anopheles testes, each step of spermatogenesis can be easily identified by looking at the nuclear morphology of the cells in each spermatocyst (Figure 2). Whole-mount fluorescence in situ hybridization (WFISH), described in this protocol, allows researchers to specifically label a chromosomal region and track it during spermatogenesis while preserving the native structure of the organ and cell nuclei position; this represents an advantage when compared to the standard DNA FISH protocol in which the organ is usually squashed, leading to tissue damage19. In the current protocol, fluorescent probes are used to stain repetitive sequences on the sex chromosomes and, thus, track their behavior during spermatogenesis, from diploid dividing cells to mature haploid spermatozoa. WFISH can be particularly useful for studying sex chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis4,19,26,27.
Given their role as malaria vectors, Anopheles mosquitoes are the target of an increasing number of genetic vector control strategies, which often act in the reproductive organs of these organisms. Several mosquito mutants and cytological phenotypes have been generated that require novel cytological techniques to be investigated26,27,28,29. The method described in this study sheds light on the understanding of spermatogenesis, as well as the cytological mechanisms behind genetic strategies that have the potential to control malaria-transmitting mosquitoes.

저자 스포트라이트: Anopheles Mosquito의 정자 형성을 연구하기 위한 Whole-Mount Fluorescence In Situ Hybridization  

Anopheles 모기의 정자 형성을 연구하기 위한 전체 장착 형광 In Situ 교잡

이 연구에서 WFISH는 An. gambiae의 정자 형성 중 염색체 거동을 조사하는 데 사용되었습니다. 이 프로토콜을 적용하기 위한 첫 번째 중요한 단계는 해부 후 낮은 수준의 형태학적 변화를 보이는 고환을 얻는 것입니다. 성공적인 고환 해부를 수행하려면 모기 해부학에 대한 기본 지식이 필요하며 아래에는 이 절차에 대한 몇 가지 지침이 나와 있습니다. Anopheles 모기에서 성숙한 고환은 번데기 및 성충 단계21의 여섯 번째 복부 부분에 놓여 있습니다. 그림 1에서 볼 수 있듯이 정관 은 고환을 복부의 마지막 부분에 위치한 남성 보조 땀샘(MAG)에 연결합니다. MAG는 정자와 정액을 교미 기관 및 남성 생식기 장치(21)의 외부 부분으로 전달하는 독특한 사정관에 연결되어 있다. 전체 내부 남성 생식기는 모기의 생활 단계에 따라 다른 접근 방식을 사용하여 해부 할 수 있습니다. 번데기 단계에서는 여섯 번째 분절 근처에 있는 복부의 복부 쪽을 보고 광 큐티클 전체에 걸쳐 실체현미경을 사용하여 고환을 쉽게 식별할 수 있습니다(그림 1). 고환을 해부하기 위해 여섯 번째 부분을 포함한 복부의 하부를 한 쌍의 바늘을 사용하여 신체의 나머지 부분과 분리하고 1x PBS의 깨끗한 방울로 옮길 수 있습니다. 마지막 부분을 제거한 후 해부 바늘로 부드러운 압력을 가하여 전체 장치를 복부에서 찌그러뜨릴 수 있습니다. 성인 남성의 고환을 해부하기 위한 첫 번째 단계는 1x PBS를 한 방울 떨어뜨려 복부 전체를 분리한 다음 남성의 교미 구조인 걸쇠가 있는 마지막 부분을 빼내는 것입니다(그림 1). 이 시점에서 MAG의 아래쪽 부분이 나타나고 노란색으로 인해 쉽게 식별할 수 있어야 합니다. 그런 다음 정관 에 부착된 한 쌍의 고환이 보일 때까지 바늘이나 집게를 사용하여 1x PBS를 떨어뜨려 전체 남성 장치를 천천히 빼낼 수 있습니다. 고정을 진행하기 전에 정관 의 하부 근처를 절단하여 고환을 남성 장치의 다른 부분과 분리하는 것이 중요합니다(그림 1).
번데기 또는 성인 남성의 나이는 조사 중인 정자 형성 단계에 따라 고려해야 할 중요한 요소입니다. An. gambiae에서 정자 형성은 번데기 초기/중기 단계에서 시작되며 개체의 전 생애에 걸쳐 계속됩니다24. 번데기 후 3시간에서 10시간 사이에, 감수분열 및 감수분열 단계는 고환(감수분열 전단계, 감수분열 분열)에서 더 많이 나타나고, 정자 DNA는 상대적으로 응축되지 않으며, 성숙한 정자는 아직 형성되지 않았습니다. 늦은 번데기와 생후 1일 된 성충은 감수분열 전단계, 감수분열 후 단계 사이에 좋은 균형을 제공합니다(그림 2 및 그림 3). 생후 4일 이상의 성인은 수조전 단계와 정낭이 덜 나타나며, 고환은 주로 정자 저장소에 포함된 성숙한 정자가 차지합니다.
정자 형성의 여러 단계에서 성염색체의 거동을 조사하기 위해 번데기 후기 단계에서 해부된 고환에서 WFISH를 수행하여 전체 과정을 잘 표현했습니다. 이러한 염색체의 거동을 추적하기 위해 X 또는 Y 염색체에만 위치한 반복적인 서열에 특이적인 형광 프로브가 사용되었습니다. 형광 프로브는 PCR을 사용하여 생성하거나 3' 말단 표지 올리고뉴클레오티드로 상업적으로 얻을 수 있습니다. 형광 올리고 프로브에서 우수한 신호 검출을 허용하려면 길이가 >40bps인 올리고를 사용하는 것이 좋습니다. 경험상 3' 말단 표지 올리고는 신호 검출 측면에서 PCR 표지 프로브보다 더 나은 성능을 발휘합니다. 또한, 표적 서열의 복제 수는 WFISH의 효능에 영향을 미칠 수 있는 인자이다. 라벨링에 실패하는 경우, 더 긴 단편에 대해 PCR 라벨링 방법을 사용하거나 표적 영역에 특이적인 여러 올리고를 설계하는 것이 좋습니다.
침투 용액(1x PBST에서 1% Triton/0.1M HCl)을 사용하는 현재의 방법은 프로브의 우수한 수준의 고환 투과화 및 침투를 허용하여 성공적인 혼성화 반응을 가능하게 합니다. 성염색체 반복 서열에 특이적인 올리고 프로브는 Hall et al.20에 의해 수행된 반복 요소의 광범위한 특성화를 기반으로 설계할 수 있습니다. 또한, X- 또는 Y-연결된 반복 요소에 특이적인 합의 서열은 RedKmer 파이프라인(30)과 같은 생물정보학 플랫폼을 사용하여 얻을 수 있습니다. 성염색체 탐침은 위성(satellite) 및 레트로트랜스포손(retrotransposon)과 같은 반복적인 요소를 표적으로 삼을 수 있으며, 검사 중인 종에 따라 X 염색체 또는 Y 염색체와 다른 수준의 혼성화를 가질 수 있다는 점에 유의하는 것이 중요하다 20,31,32. 그림 3에서 볼 수 있듯이 프로브의 양호한 혼성화와 낮은 백그라운드는 정자 형성 전반에 걸쳐 표적 염색체를 시각화할 수 있었습니다. 표지된 성염색체의 쌍은 감수분열 단계와 감수분열 단계에서 볼 수 있습니다. 그 다음에는 감수분열 분열로 인한 반수체 세포핵 염색체에서 X 또는 Y 염색체를 검출했습니다. 그 후, X- 또는 Y-함유 정자는 화살표 모양의 성숙한 정자의 마지막 단계까지 다양한 수준의 DNA 응축으로 표시된 정자 형성 전반에 걸쳐 추적될 수 있습니다. 본 실험 설정에서는 이 과정에서 세포의 3D 공간 구성에 관한 정보를 획득하기 위해 공초점 Z-스택을 사용했습니다(비디오 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65356/65356fig01v2.jpg"> 그림 1: 번데기와 생후 1일 된 성체 Anopheles gambiae 수컷에서 해부한 고환. (A) 번데기 후기에 절개된 복부는 여섯 번째 복부 분절 부근에서 고환의 위치를 보여줍니다. 고환은 큐티클 전체에서 확인할 수 있으며 복부 양쪽에 갈색 구조로 나타납니다(화살표 포함). (B) 번데기 단계에서 해부된 고환, 성숙한 고환(1), 정관(2), MAGs(3) 및 사정관(4)을 보여줍니다. (C) 기저부 걸쇠 부분을 제거한 후 생후 1일 된 성인 남성의 복부를 절개한 복부. MAG는 부드러운 압력(흰색 화살표)을 가하여 복부에서 찌그러뜨릴 수 있습니다. (D) 생후 1일 된 성인 남성으로부터 해부한 남성 내부 생식기관. 흰색 화살표는 고환의 기저극에서 흰색 응집체로 나타나는 성숙한 정자가 차지하는 위치를 나타냅니다. 눈금 막대: (A,C) 200 μm; (B,D) 100μm입니다. I에서 VIII까지의 로마 숫자는 복부 세그먼트를 나타냅니다. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig01large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65356/65356fig02v2.jpg"> 그림 2: Anopheles gambiae의 정자 형성 표현.왼쪽 이미지는 전체 마운트 DAPI 염색 후 An. gambiae late pupa testis를 보여줍니다. 오른쪽은 더 나은 시각화를 위한 회로도 버전입니다. 핵 모양과 응축 수준을 관찰하면 이배체 세포에서 반수체 정자에 이르기까지 모든 정자 형성 단계를 비교적 쉽게 추적할 수 있습니다. 줄기 세포 틈새는 장기의 상극에 위치하며, 여기서 정자로의 분화가 시작됩니다. 정자 세포는 유사분열 후 수가 증가하고 (녹색 세포) 정자 낭은 크기가 증가합니다 (노란색 세포). 정자 세포는 여러 차례의 유사분열 분열(청색 세포)을 거친 후 정자 세포로 분화합니다. 이 과정의 다른 단계의 세포보다 상대적으로 큰 핵을 특징으로 하는 정자 세포는 감수분열 분열을 겪게 될 세포입니다. 감수분열을 겪는 세포는 다른 감수분열 단계에서 염색체의 존재를 관찰하여 검출할 수 있습니다. chiasmata 및 metaphase 염색체는 낮은 배율에서도 검출할 수 있습니다. 수조전단계는 초기 번데기 단계에서 해부된 고환에서 과잉 대표됩니다. 첫 번째와 두 번째 감수분열 후 정자가 생성되며 일반적으로 고환 중앙에 누워있는 것을 볼 수 있습니다. 정자의 핵은 둥근 모양에서 화살 모양에 이르기까지 어느 정도의 모양 변화를 보여줍니다. 정자는 정자 형성 과정에 들어가며, 그 동안 핵이 응축되기 시작하고 구조가 화살표 모양의 점으로 바뀝니다. 모기가 출현 후 성적으로 성숙할 때, 성숙한 정자를 포함하는 정자는 다른 발달 단계에서 정자를 희생하여 고환 부피의 대부분을 차지할 수 있습니다. 척도 막대: 20 μm. 별표(*)는 고환의 정점 부분을 나타냅니다. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig02large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65356/65356fig03v2.jpg"> 그림 3: 번데기 후기 단계에서 해부된 An. gambiae 고환의 WFISH. WFISH는 X(Contig_240) 및 Y(AgY53B) 염색체에 특이적인 올리고 프로브를 사용하여 수행되었습니다. (A) WFISH는 이배체 세포에서 반수체 정자동물로 정자 형성 동안 성염색체의 거동을 추적할 수 있습니다. 이 이미지에서는 정자 형성 중에 핵이 겪는 극적인 변화를 감상할 수 있습니다. 성염색체에 라벨을 붙이면 이배체 세포와 반수체 세포를 구별할 수 있습니다. 이배체 세포에서 성염색체의 신호는 동일한 핵에 연결되어 있습니다. 반수체 세포(정자 및 정자)에서 성염색체의 신호는 감수분열 환원 분열로 인해 연결되지 않습니다. (나,씨) 고환의 고배율(63x) 이미지는 (A)에 나와 있습니다. Z축을 따라 다른 위치에서 획득했습니다. 흰색 점선 프레임은 획득 영역을 나타냅니다. (B) 정세포와 정자 사이의 전이 단계로, 반수체 세포의 형성과 성염색체의 신호가 별도의 핵으로 분리되는 것을 보여줍니다. (C) 반수체 정자와 성숙한 정자 사이의 전이 단계. 이 단계는 핵 응축 수준의 변화를 보여줍니다. 성숙한 정자는 정자보다 더 응축되고 길쭉한 모양을 보여줍니다. 눈금 막대: (A), 30 μm; (B,C), 10μm; 회색: DAPI. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig03large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>타겟 시퀀스</td>
			<td>Primer Sequence 및 Oligo-probe 합의</td>
			<td>참조</td>
		</tr><tr><td>Contig_240 (X)</td>
			<td>5'-CAATAAATTTCCTTTTTAATGATGC AAAATCTACGTCTCTAGC-3'-[형광 색소]</td>
			<td>19</td>
		</tr><tr><td>AgY53B(Y)</td>
			<td>5'아가아가아 TTTCTTCATCCTGAAAGCC-3'-[형광 색소]</td>
			<td>본 연구는</td>
		</tr><tr><td>AgY477- AgY53B 접합 지역(Y)</td>
			<td>5'-TTCTAAGTTTCTAGGCTTTAAGGAT GAAGAAACCGACTATTC-3'-[형광 색소]</td>
			<td>19</td>
		</tr><tr><td>18S rDNA(엑스)</td>
			<td>F: AACTGTGGAAAAGCCAGAGC R: TCCACTTGATCCTTGCAAAA</td>
			<td>19</td>
		</tr><tr><td>AgY53B(Y)</td>
			<td>F: CCTTTAAACACATGCTCAAATT R: GTTTCTTCATCCTTAAAGCCTAG</td>
			<td>19</td>
		</tr></tbody></table>표 1: An. gambiae의 X 또는 Y 염색체에 특이적인 올리고 프로브 목록.
비디오 1: 번데기 후기 단계에서 해부된 An. gambiae 고환에서 수행된 WFISH의 3D 스택. 정자 형성 과정의 3D 표현을 얻기 위해 적은 수의 구조적 변화를 보이는 고환에서 공초점 3D 스택을 수행할 수 있습니다. 이 연구에서는 세포의 3D 공간 구성에 대한 정보를 잃지 않기 위해 63x 또는 40x 오일 렌즈 아래에서 두 광학 섹션 사이에 1.25μm 간격으로 스택을 수행했습니다. 회색: DAPI, 노란색: Contig_240(X), 자홍색: AgY53B(Y). <a href="https://www.jove.com/files/ftp_upload/65356/Video-1.zip" target="_blank">이 비디오를 다운로드하려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about Whole-Mount Fluorescence In Situ Hybridization to Study Spermatogenesis in the Anopheles Mosquito at JoVE.com

간단한 해부학적 구조를 감안할 때 Anopheles 고환은 정자 형성을 연구하기 위한 좋은 세포학적 모델을 제공합니다. 이 프로토콜은 이 생물학적 과정을 조사하는 데 사용되는 기술인 전체 마운트 형광 in situ 교잡과 정자 생산에 관여하는 유전자에 돌연변이가 있는 형질전환 균주의 표현형을 설명합니다.

Spermatogenesis is a complex biological process during which diploid cells undergo successive mitotic and meiotic division followed by large structural ...

우리 연구의 범위는 남사하라 사막 아프리카에서 말라리아를 옮기는 모기의 수를 줄이는 것을 목표로 하는 비용 효율적이고 지속 가능한 유전 전략을 개발하고 공유하는 것입니다. 지난 몇 년 동안 우리는 우리에 갇힌 모기 개체수를 억제하는 유전자 드라이브 기술의 힘을 입증했습니다. 우리는 현재 더 복잡한 실험 설정에서 이러한 기술에 도전하고 현장에서 이러한 기술을 잠재적으로 구현하는 데 절대적으로 필요한 규제 요구 사항에 답하기 위해 여러 실험을 진행하고 있습니다.FISH는 특정 DNA 염기서열을 염색할 수 있는 분자 세포유전학 기술입니다. 일반적으로 관심 기관이 찌그러지는 것과 관련이 있으며, 이로 인해 세포의 공간적 배열에 대한 정보가 손실될 수 있습니다. Wellman FISH는 장기의 본래 세포학적 구조를 보존할 수 있습니다.Wellman FISH는 모기 생식 기관의 염색체 행동을 연구하는 데 사용할 수 있습니다. 생식 기관은 벡터 조절을 위한 여러 유전 전략의 대상입니다. Wellmann FISH는 유착 모기의 생식 기관과 관심 있는 모든 유전적 균주에서 일어나는 메커니즘을 밝힐 수 있는 잠재력을 가지고 있습니다.

whole-mount-fluorescence-situ-hybridization-to-study-spermatogenesis

Research

JoVE Journal

Immunology and Infection

Whole-Mount Fluorescence In Situ Hybridization to Study Spermatogenesis in the Anopheles Mosquito

1.5K 조회수.  Imperial College London. 우리 연구의 범위는 남사하라 사막 아프리카에서 말라리아를 옮기는 모기의 수를 줄이는 것을 목표로 하는 비용 효율적이고 지속 가능한 유전 전략을 개발하고 공유하는 것입니다. 지난 몇 년 동안 우리는 우리에 갇힌 모기 개체수를 억제하는 유전자 드라이브 기술의 힘을 입증했습니다. 우리는 현재 더 복잡한 실험 설정에서 이러한 기술에 도전하고 현장에서 이러한 기술?...

비디오: 저자 스포트라이트: Anopheles Mosquito의 정자 형성을 연구하기 위한 Whole-Mount Fluorescence In Situ Hybridization  

Spermatogenesis is a complex biological process during which diploid cells undergo successive mitotic and meiotic division followed by large structural changes to form haploid spermatozoa. Besides the biological aspect, studying spermatogenesis is of paramount importance for understanding and developing genetic technologies such as gene drive and synthetic sex ratio distorters, which, by altering Mendelian inheritance and the sperm sex ratio, respectively, could be used to control pest insect populations. These technologies have proven to be very promising in lab settings and could potentially be used to control wild populations of Anopheles mosquitoes, which are vectors of malaria. Due to the simplicity of the testis anatomy and their medical importance, Anopheles gambiae, a major malaria vector in sub-Saharan Africa, represents a good cytological model for studying spermatogenesis. This protocol describes how whole-mount fluorescence in situ hybridization (WFISH) can be used to study the dramatic changes in cell nuclear structure through spermatogenesis using fluorescent probes that specifically stain the X and Y chromosomes. FISH usually requires the disruption of the reproductive organs to expose mitotic or meiotic chromosomes and allow the staining of specific genomic regions with fluorescent probes. WFISH enables the preservation of the native cytological structure of the testis, coupled with a good level of signal detection from fluorescent probes targeting repetitive DNA sequences. This allows researchers to follow changes in the chromosomal behavior of cells undergoing meiosis along the structure of the organ, where each phase of the process can clearly be distinguished. This technique could be particularly useful for studying chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis.

Given their simple anatomy, Anopheles testes offer a good cytological model for studying spermatogenesis. This protocol describes whole-mount fluorescence in situ hybridization, a technique used to investigate this biological process, as well as the phenotype of transgenic strains harboring mutations in the genes involved in sperm production.