تم دعم هذا العمل بمنحة من مؤسسة بيل وميليندا غيتس و Open Philanthropy. نشكر مرفق التصوير بالمجهر الضوئي (FILM) في إمبريال كوليدج لندن على التحليل المجهري. تم إنشاء الشكل 2 باستخدام Biorender.com.

1. وسم مسبار الحمض النووي
ملاحظة: فيما يلي الخطوات الفنية لإنشاء مجسات الحمض النووي الفلورية التي تحدد على وجه التحديد الكروموسومات الجنسية لبعوض An. gambiae. 
<ol><li>دقق في وضع العلامات باستخدام تفاعل البوليميراز المتسلسل<ol><li>استخراج الحمض النووي الجينومي من الشرانق أو الذكور البالغين لتسمية الكروموسومات X أو Y باستخدام مجموعة استخراج الحمض النووي الجينومي المتاحة تجاريا (انظر جدول المواد).</li>
		<li>تحضير خليط تفاعل تفاعل البوليميراز المتسلسل: 200 نانوغرام من الحمض النووي الجينومي ، 0.05 مللي متر من النوكليوتيدات غير المسماة (dATP ، dCTP ، dGTP) ، 0.015 mM من dTTP ، و 1 ميكرولتر من dUTP المسمى بالفلورسنت (Cy3 ، Cy5 ، أو فلوروكروم آخر) ، 50 pmol من التمهيدي الأمامي والخلفي (الجدول 1) ، 5 ميكرولتر من 10x PCR-buffer ، و 10 U من Taq DNA polymerase (انظر جدول المواد).</li>
		<li>لتسمية 18S rDNA والقمر الصناعي AgY53B (الجدول 1) ، قم بإجراء تفاعل تفاعل PCR باستخدام معلمات تفاعل البوليميراز المتسلسل التالية: دورة واحدة من 95 درجة مئوية لمدة 10 دقائق ؛ 35 دورة من 95 درجة مئوية لمدة 30 ثانية ، و 52 درجة مئوية لمدة 30 ثانية ، و 72 درجة مئوية لمدة 45 ثانية ؛ دورة واحدة من 72 درجة مئوية لمدة 5 دقائق ؛ وعقد نهائي عند 4 درجات مئوية. ملاحظة: للحصول على تركيز جيد للمسبار باستخدام طريقة وضع العلامات PCR (~ 1 ميكروغرام في 5 ميكرولتر) ، وهو أمر بالغ الأهمية لنجاح WFISH ، يجب أن يكون تفاعل تفاعل PCR عالي الكفاءة. لهذا السبب ، قبل تسمية المسبار ، يقترح بشدة اختبار فعالية الأوائل المختارة للتضخيم. بالإضافة إلى ذلك ، فإن تضمين التحكم الإيجابي في تفاعل PCR (بدون dUTP الفلوري) سيساعد على التحقق من فعالية تفاعل وضع العلامات.</li>
		<li>قم بتخزين المسبار في درجة حرارة -20 درجة مئوية في مكان مظلم.</li>
	</ol></li>
	<li>الحصول على 3 'مجسات قليلة النوكليوتيد الفلورية<ol><li>احصل على مجسات قليلة النوكليوتيد الفلورية المتاحة تجاريا كأوليجوات معدلة عن طريق إضافة فلوروكرومات Cy3 أو Cy5 (أو أي فلوروكروم آخر) إلى نهاية 3 'من تسلسل النوكليوتيدات (انظر جدول المواد). انظر البادئات/قليل النوكليوتيد في الجدول 1 للاطلاع على التسلسلات المرجعية المستخدمة لتسمية منطقة تقاطع الساتل AgY477-AgY53B المرتبط ب Y والساتل المرتبط X من Contig_240. ملاحظة: لا توجد عوائق فنية تتعلق بتركيز 3 'oligonucleotides المسمى في نهاية المطاف ، حيث يمكن للمستخدم عادة اختيار هذا قبل الشراء. نقترح تخفيف ~ 800 نانوغرام من محلول مسبار oligo في المخزن المؤقت للتهجين لوضع العلامات بكفاءة باستخدام مسبار oligo. تم استخدام مجسات oligo الخاصة ب X و Y سابقا ل WFISH بواسطة Liang و Sharakhov19 ، ويمكن العثور على التسلسل المرجعي في الجدول 1.</li>
	</ol></li>
</ol>2. تحضير محلول التهجين
ملاحظة: يجب دمج مجسات الفلورسنت المتولدة في الخطوة 1 في محلول كيميائي يهجن مع التسلسلات المستهدفة.
<ol><li>دقق في هطول الأمطار قبل التهجين الفلوري في الموقع <ol><li>إلى أنبوب سعة 1.5 مل ، أضف 5 ميكرولتر من مسبار الحمض النووي المسمى (إذا تم الحصول عليه بطريقة وضع العلامات PCR) أو 2.2 ميكرولتر من مسبار oligo المعدل 3 بوصات (~ 800 نانوغرام من المسبار) من الخطوة 1 و 5 ميكرولتر من الحمض النووي للحيوانات المنوية لسمك السلمون (انظر جدول المواد). اجمع بين المجسات الخاصة بمناطق جينومية مختلفة في نفس الأنبوب ، واستخدمها كحل فريد في الخطوات التالية.</li>
		<li>ترسيب مسبار الحمض النووي بإضافة 0.1 حجم من 3 M أسيتات الصوديوم و 2 مجلدات من الإيثانول 100٪. الحفاظ على -20 درجة مئوية لمدة 2.5 ساعة على الأقل (زيادة وقت الحضانة عند -20 درجة مئوية سيزيد من العائد النهائي). في هذه المرحلة ، يمكن أيضا تخزين المجسات بين عشية وضحاها قبل الطرد المركزي.</li>
		<li>أجهزة الطرد المركزي عند 17000 × جم عند 4 °C لمدة 20 دقيقة ، قم بإزالة الإيثانول ، وجفف الحبيبات بالهواء في RT في الظلام لمدة ~ 20 دقيقة.</li>
	</ol></li>
	<li>حل التهجين<ol><li>قبل الشروع في تشريح الخصية (الخطوة 3) ، قم بإعداد المخزن المؤقت للتهجين عن طريق خلط الكواشف التالية في أنبوب 1.5: 500 ميكرولتر من الفورماميد ، 0.2 غرام من كبريتات ديكستران ، 100 ميكرولتر من 20x سترات محلول ملحي الصوديوم (SSC) ، و 200 ميكرولتر من H20 المعقم (انظر جدول المواد). دوامة محلول التهجين لمدة 1 دقيقة ، والسماح لكبريتات ديكستران لتذوب عند 37 درجة مئوية لمدة 30 دقيقة.</li>
		<li>قم بإذابة الحبيبات من الخطوة 2.1.3 في 20-30 ميكرولتر من محلول التهجين (دوامة لمدة 1 دقيقة تقريبا ، وقم بإجراء دوران سريع ، وقم بتخزين الأنابيب عند 37 درجة مئوية في الظلام) للحصول على محلول التهجين.</li>
	</ol></li>
</ol>3. تشريح الخصية والتثبيت
<ol><li>في درجة حرارة الغرفة (RT) ، قم بتشريح 21 خصية على الأقل ~20 من الشرانق أو البالغين بعمر يوم واحد في محلول ملحي معقم 1x مخزن بالفوسفات (PBS) ، وانقلها إلى شريحة مجهرية نظيفة تحتوي على قطرة جديدة من محلول 1x PBS.</li>
	<li>انقل الخصيتين باستخدام طرف مرشح عريض التجويف P1,000 أو طرف إبرة تشريح من قطرة PBS 1x في طبق جنين يحتوي على 3.7٪ فورمالديهايد في 1x PBS مع 0.1٪ Tween-20 (PBST) ، واحتضانها لمدة 10 دقائق في RT.</li>
	<li>اغسل الخصيتين في 1x PBST لمدة 5 دقائق في RT. احتضان الخصيتين في 0.1 مجم / مل RNAse A (انظر جدول المواد) المخفف في 1x PBS معقم لمدة 30 دقيقة عند 37 درجة مئوية.</li>
	<li>قم بإزالة محلول RNAse ، وأضف محلول الاختراق (1٪ Triton / 0.1 M HCl في 1x PBST) ، واحتضانه في RT لمدة 10 دقائق. ملاحظة: يمكن استخدام Proteinase K كعامل اختراق بتركيز نهائي قدره 10 ميكروغرام / مل في 1x PBST لزيادة نفاذية الخصيتين.</li>
	<li>اغسل الخصيتين في 1x PBST مرتين لمدة 5 دقائق لكل منهما في RT.</li>
</ol>4. التهجين
ملاحظة: يصف هذا القسم الخطوات النهائية للتهجين في الموقع .
<ol><li>بعد خطوة الغسيل (الخطوة 3.5) ، انقل الخصيتين في أنبوب سعة 1.5 مل مع 20-30 ميكرولتر من محلول التهجين الذي يحتوي على المسبار المعد مسبقا (الخطوة 2.2.2). استخدم طرف الماصة لخلط المحلول برفق. حرك الأنبوب برفق خمس مرات قبل المتابعة إلى الخطوات التالية.</li>
	<li>احتضان لمدة 5 دقائق عند 75 درجة مئوية لتمسخ الحمض النووي.</li>
	<li>احتضان بين عشية وضحاها عند 37 درجة مئوية (إن أمكن ، مع هزاز عند أقل من 100 دورة في الدقيقة) لتهجين الحمض النووي والحمض النووي.</li>
	<li>انقل الخصيتين مرة أخرى إلى طبق الجنين باستخدام طرف مرشح عريض التجويف P1,000 ، واغسلهما في 2x SSC مسخن مسبقا إلى 50 درجة مئوية لمدة 5 دقائق. ملاحظة: بعد خطوة التهجين ، يلزم إجراء خطوة غسيل نهائية باستخدام 2x SSC ؛ يلعب هذا دورا مهما في إزالة أي إشارة خلفية ناتجة عن وجود مجسات غير مهجنة داخل أنسجة الأعضاء. في حالة وجود إشارة خلفية قوية ، يوصى بتكرار خطوة الغسيل النهائية.</li>
	<li>قم بإزالة 2x SSC ، وقم بتركيب الخصيتين باستخدام وسيط تركيب متاح تجاريا مع 4 ′ ، 6-diamidino-2-phenylindole (DAPI) (انظر جدول المواد) على شريحة زجاجية بلورية ، وختم بمادة مانعة للتسرب ، واحتضانها لمدة ساعتين على الأقل في RT في الظلام.</li>
	<li>أداء التصوير متحد البؤر. يمكن تصور الخصيتين بالكامل باستخدام أهداف غمر الزيت 40x أو 63x. إذا تم تنفيذ مكدس z ، نقترح استخدام خطوة z تبلغ 1.25 ميكرومتر.</li>
</ol>

التهجين الفلوري في الموقع لدراسة تكوين المنوية للبعوض

<ol>
	<li>World Malaria Report. World Health Organization Available from: <a target="_blank" href="https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2022">https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2022</a> (2022)</li><li>Bhatt, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effect+of+malaria+control+on+Plasmodium+falciparum+in+Africa+between+2000+and+2015.">The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015.</a> Nature. 526 (7572), 207-211 (2015).</li><li>Hammond, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+gene+drive+system+targeting+female+reproduction+in+the+malaria+mosquito+vector+Anopheles+gambiae.">A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae.</a> Nature Biotechnology. 34 (1), 78-83 (2016).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature Communications. 5 (1), 3977 (2014).</li><li>Kyrou, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+gene+drive+targeting+doublesex+causes+complete+population+suppression+in+caged+Anopheles+gambiae+mosquitoes.">A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes.</a> Nature Biotechnology. 36 (11), 1062-1066 (2018).</li><li>Simoni, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+male-biased+sex-distorter+gene+drive+for+the+human+malaria+vector+Anopheles+gambiae.">A male-biased sex-distorter gene drive for the human malaria vector Anopheles gambiae.</a> Nature Biotechnology. 38 (9), 1054-1060 (2020).</li><li>Gantz, V. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+Cas9-mediated+gene+drive+for+population+modification+of+the+malaria+vector+mosquito+Anopheles+stephensi.">Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (49), E6736-E6743 (2015).</li><li>Bernardini, F., Kriezis, A., Galizi, R., Nolan, T., Crisanti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introgression+of+a+synthetic+sex+ratio+distortion+system+from+Anopheles+gambiae+into+Anopheles+arabiensis.">Introgression of a synthetic sex ratio distortion system from Anopheles gambiae into Anopheles arabiensis.</a> Scientific Reports. 9 (1), 5158 (2019).</li><li>Hammond, A. M., Galizi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+drives+to+fight+malaria:+Current+state+and+future+directions.">Gene drives to fight malaria: Current state and future directions.</a> Pathogens and Global Health. 111 (8), 412-423 (2017).</li><li>Garrood, W. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Driving+down+malaria+transmission+with+engineered+gene+drives.">Driving down malaria transmission with engineered gene drives.</a> Frontiers in Genetics. 13, 891218 (2022).</li><li>Hoermann, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+drive+mosquitoes+can+aid+malaria+elimination+by+retarding+Plasmodium+sporogonic+development.">Gene drive mosquitoes can aid malaria elimination by retarding Plasmodium sporogonic development.</a> Science Advances. 8 (38), (2022).</li><li>Nash, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integral+gene+drives+for+population+replacement.">Integral gene drives for population replacement.</a> Biology Open. 8 (1), (2019).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR-Cas9+sex-ratio+distortion+system+for+genetic+control.">A CRISPR-Cas9 sex-ratio distortion system for genetic control.</a> Scientific Reports. 6 (1), 31139 (2016).</li><li>Terradas, G., Hermann, A., James, A. A., McGinnis, W., Bier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+in+situ+analysis+of+Cas9+germline+transcript+distributions+in+gene-drive+Anopheles+mosquitoes.">High-resolution in situ analysis of Cas9 germline transcript distributions in gene-drive Anopheles mosquitoes.</a> G3: Genes, Genomes, Genetics. 12 (1), (2022).</li><li>Durant, A. C., Donini, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ammonium+transporter+expression+in+sperm+of+the+disease+vector+Aedes+aegypti+mosquito+influences+male+fertility.">Ammonium transporter expression in sperm of the disease vector Aedes aegypti mosquito influences male fertility.</a> Proceedings of the National Academy of Sciences of the United States of America. 117 (47), 29712-29719 (2020).</li><li>Taxiarchi, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+transcriptional+profiling+of+Anopheles+gambiae+spermatogenesis+reveals+mechanisms+of+sex+chromosome+regulation.">High-resolution transcriptional profiling of Anopheles gambiae spermatogenesis reveals mechanisms of sex chromosome regulation.</a> Scientific Reports. 9 (1), 14841 (2019).</li><li>Pompon, J., Levashina, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+role+of+the+mosquito+complement-like+cascade+in+male+fertility+in+Anopheles+gambiae.">A new role of the mosquito complement-like cascade in male fertility in Anopheles gambiae.</a> PLoS Biology. 13 (9), e1002255 (2015).</li><li>Papathanos, P. A., Windbichler, N., Menichelli, M., Burt, A., Crisanti, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+vasa+regulatory+region+mediates+germline+expression+and+maternal+transmission+of+proteins+in+the+malaria+mosquito+Anopheles+gambiae:+A+versatile+tool+for+genetic+control+strategies.">The vasa regulatory region mediates germline expression and maternal transmission of proteins in the malaria mosquito Anopheles gambiae: A versatile tool for genetic control strategies.</a> BMC Molecular Biology. 10 (1), 13 (2009).</li><li>Liang, J., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Premeiotic+and+meiotic+failures+lead+to+hybrid+male+sterility+in+the+Anopheles+gambiae+complex.">Premeiotic and meiotic failures lead to hybrid male sterility in the Anopheles gambiae complex.</a> Proceedings of the Royal Society B. 286 (1906), 20191080 (2019).</li><li>Hall, A. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radical+remodeling+of+the+Y+chromosome+in+a+recent+radiation+of+malaria+mosquitoes.">Radical remodeling of the Y chromosome in a recent radiation of malaria mosquitoes.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (15), E2114-E2123 (2016).</li><li>Clements, A. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Biology of Mosquitoes. Volume 1: Development, Nutrition and Reproduction. , (1992).</li><li>Demarco, R. S., Eikenes, &. #. 1. 9. 7. ;. H., Haglund, K., Jones, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+spermatogenesis+in+Drosophila+melanogaster.">Investigating spermatogenesis in Drosophila melanogaster.</a> Methods. 68 (1), 218-227 (2014).</li><li>Helinski, M. E., Parker, A. G., Knols, B. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radiation+biology+of+mosquitoes.">Radiation biology of mosquitoes.</a> Malaria Journal. 8, S6 (2009).</li><li>Huho, B. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reliable+morphological+method+to+assess+the+age+of+male+Anopheles+gambiae.">A reliable morphological method to assess the age of male Anopheles gambiae.</a> Malaria Journal. 5 (1), 62 (2006).</li><li>Fabian, L., Brill, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+spermiogenesis.">Drosophila spermiogenesis.</a> Spermatogenesis. 2 (3), 197-212 (2012).</li><li>Li, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppressing+mosquito+populations+with+precision+guided+sterile+males.">Suppressing mosquito populations with precision guided sterile males.</a> Nature Communications. 12 (1), 5374 (2021).</li><li>Thailayil, J., Magnusson, K., Godfray, H. C., Crisanti, A., Catteruccia, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spermless+males+elicit+large-scale+female+responses+to+mating+in+the+malaria+mosquito+Anopheles+gambiae.">Spermless males elicit large-scale female responses to mating in the malaria mosquito Anopheles gambiae.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (33), 13677-13681 (2011).</li><li>Haghighat-Khah, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mechanisms+regulating+synthetic+sex+ratio+distortion+in+the+Anopheles+gambiae+germline.">Cellular mechanisms regulating synthetic sex ratio distortion in the Anopheles gambiae germline.</a> Pathogens and Global Health. 114 (7), 370-378 (2020).</li><li>Yamamoto, D. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+male-specific+sterilization+system+using+the+mammalian+pro-apoptotic+factor+in+a+malaria+vector+mosquito.">A synthetic male-specific sterilization system using the mammalian pro-apoptotic factor in a malaria vector mosquito.</a> Scientific Reports. 9 (1), 8160 (2019).</li><li>Papathanos, P. A., Windbichler, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Redkmer:+An+assembly-free+pipeline+for+the+identification+of+abundant+and+specific+X-chromosome+target+sequences+for+X-shredding+by+CRISPR+endonucleases.">Redkmer: An assembly-free pipeline for the identification of abundant and specific X-chromosome target sequences for X-shredding by CRISPR endonucleases.</a> The CRISPR Journal. 1 (1), 88-98 (2018).</li><li>Sharma, A., Kinney, N. A., Timoshevskiy, V. A., Sharakhova, M. V., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+variation+of+the+X+chromosome+heterochromatin+in+the+Anopheles+gambiae+complex.">Structural variation of the X chromosome heterochromatin in the Anopheles gambiae complex.</a> Genes. 11 (3), 327 (2020).</li><li>Krzywinski, J., Sangar&#233;, D., Besansky, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Satellite+DNA+from+the+Y+chromosome+of+the+malaria+vector+Anopheles+gambiae.">Satellite DNA from the Y chromosome of the malaria vector Anopheles gambiae.</a> Genetics. 169 (1), 185-196 (2005).</li><li>Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+in+situ+hybridization+on+mitotic+chromosomes+of+mosquitoes.">Fluorescent in situ hybridization on mitotic chromosomes of mosquitoes.</a> Journal of Visualized Experiments. (67), e4215 (2012).</li><li>Liang, J., Hodge, J. M., Sharakhov, I. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Asymmetric+phenotypes+of+sterile+hybrid+males+from+reciprocal+crosses+between+species+of+the+Anopheles+gambiae+complex.">Asymmetric phenotypes of sterile hybrid males from reciprocal crosses between species of the Anopheles gambiae complex.</a> Frontiers in Ecology and Evolution. 9, 660207 (2021).</li><li>Slotman, M., Torre, A. D., Powell, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+genetics+of+inviability+and+male+sterility+in+hybrids+between+Anopheles+gambiae+and+An.+arabiensis.">The genetics of inviability and male sterility in hybrids between Anopheles gambiae and An. arabiensis.</a> Genetics. 167 (1), 275-287 (2004).</li><li>Wood, R. J., Newton, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex-ratio+distortion+caused+by+meiotic+drive+in+mosquitoes.">Sex-ratio distortion caused by meiotic drive in mosquitoes.</a> The American Naturalist. 137 (3), 379-391 (1991).</li><li>Cazemajor, M., Joly, D., Montchamp-Moreau, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex-ratio+meiotic+drive+in+Drosophila+simulans+is+related+to+equational+nondisjunction+of+the+Y+chromosome.">Sex-ratio meiotic drive in Drosophila simulans is related to equational nondisjunction of the Y chromosome.</a> Genetics. 154 (1), 229-236 (2000).</li><li>Jaenike, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+chromosome+meiotic+drive.">Sex chromosome meiotic drive.</a> Annual Review of Ecology and Systematics. 32 (1), 25-49 (2001).</li><li>Courret, C., Chang, C. H., Wei, K. H., Montchamp-Moreau, C., Larracuente, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Meiotic+drive+mechanisms:+Lessons+from+Drosophila.">Meiotic drive mechanisms: Lessons from Drosophila.</a> Proceedings of the Royal Society B. 286 (1913), 20191430 (2019).</li><li>Zanders, S. E., Unckless, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fertility+costs+of+meiotic+drivers.">Fertility costs of meiotic drivers.</a> Current Biology. 29 (11), R512-R520 (2019).</li><li>Newton, M. E., Wood, R. J., Southern, D. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytogenetic+analysis+of+meiotic+drive+in+the+mosquito,+Aedes+aegypti+(L.).">A cytogenetic analysis of meiotic drive in the mosquito, Aedes aegypti (L.).</a> Genetica. 46 (3), 297-318 (1976).</li><li>Carabajal Paladino, L. Z., Nguyen, P., &#352;&#237;chov&#225;, J., Marec, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+of+single-copy+genes+by+TSA-FISH+in+the+codling+moth,+Cydia+pomonella.">Mapping of single-copy genes by TSA-FISH in the codling moth, Cydia pomonella.</a> BMC Genomic Data. 15, S15 (2014).</li><li>Bernardini, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-species+Y+chromosome+function+between+malaria+vectors+of+the+Anopheles+gambiae+species+complex.">Cross-species Y chromosome function between malaria vectors of the Anopheles gambiae species complex.</a> Genetics. 207 (2), 729-740 (2017).</li></ol>

ليس لدى المؤلفين ما يكشفون عنه.

عادة ، تتطلب بروتوكولات FISH سحق العضو محل الاهتمام للسماح بتلطيخ الكروموسوم. هذا يسبب فقدان المعلومات المتعلقة بالترتيب المكاني للخلايا داخل هذا العضو33. يصف هذا البروتوكول كيف يمكن دراسة العمليات البيولوجية ، مثل تكوين الحيوانات المنوية ، في الموقع مع الحفاظ على البنية الأصلية السليمة للخصية وتنظيمها الخلوي الداخلي. يمكن استخدام المجسات التي تستهدف عناصر الحمض النووي المتكررة المختلفة ، والتي يتم تخصيبها بشكل خاص في الكروموسومات الجنسية20 ، في وقت واحد للكشف عن ديناميكيات نضوج الحيوانات المنوية. اعتمادا على توقيت تشريح الخصية ، يوفر WFISH الفرصة لدراسة مراحل مختلفة من تكوين الحيوانات المنوية من خلال تطور البعوض. WFISH مفيد لدراسة ظواهر محددة مثل عدم التوافق الهجين ، والذي يرجع في بعوض الأنوفيليس إلى وجود عيوب اختزالية مثل الفشل الأولي وعدم انفصال الكروموسوم الجنسي19،34،35. إلى جانب الجانب البيولوجي ، فإن تكوين الحيوانات المنوية هو هدف لعدد من الاستراتيجيات الوراثية التي تم تطويرها للسيطرة على حشرات الآفات مثل بعوض الأنوفيلة. في هذا السياق ، تم استخدام موضع rDNA المرتبط ب X ل An. gambiae كهدف لتطوير مشوه نسبة الجنس الاصطناعي ، والذي ، من خلال إتلاف الحيوانات المنوية الحاملة ل X ، ينحاز النسل نحو الذكور4،8،13.
تعكس هذه التقنية عمل محركات الانقسام الاختزالي لنسبة الجنس الطبيعية التي تم تحديدها في العديد من الأصناف ، بما في ذلك البعوض ، ولكنها لا تزال غير مفهومةبشكل جيد 28،36،37،38،39،40،41. يوفر WFISH الفرصة للتحقيق في هذه الظاهرة ويمهد الطريق لتحسين أو تحسين الاستراتيجيات الجينية القائمة على التشويه الجنسي من خلال ، على سبيل المثال ، توفير معلومات حول كيفية تأثر علم الخلايا لإنتاج الحيوانات المنوية باختيار المواقع المستهدفة المستخدمة لتمزيق الكروموسومات الجنسية. على الرغم من أن WFISH ، في تجربتنا ، تظهر فرصا عالية للنجاح ، إلا أنه لا يزال من الممكن حدوث الفشل. قد يكون هذا بسبب عدم كفاءة مستوى نفاذية الأنسجة ، والذي يمكن التغلب عليه عن طريق زيادة وقت حضانة المحلول المخترق. بدلا من ذلك ، يمكن استخدام Proteinase K أثناء خطوة النفاذية. في بعض الحالات ، لاحظنا مستوى غير موحد من اختراق المسبار ، مع إشارة أعلى في نوى الخلايا المنوية وإشارة أقل أو غائبة في مراحل الانقسام الاختزالي وتكوين الحيوانات المنوية. قد يكون هذا بسبب اختلاف في مستوى النفاذية اعتمادا على مرحلة الخلية. بالإضافة إلى ذلك ، أثبت WFISH أنه ذو قيمة عند استخدام مجسات الفلورسنت المصممة لاستهداف تسلسلات الحمض النووي الموجودة بأعداد نسخ عالية. عند استهداف الجينات أحادية النسخة ، قد لا يكون اكتشاف الإشارة كافيا. في هذه الحالة ، يجب دمج طرق تضخيم الإشارة ، مثل تضخيم إشارة التيراميد (TSA) ،42.
يمكن أن يقترن هذا البروتوكول بتلطيخ مناعي أو سلالات مراسلة معدلة وراثيا تؤوي علامات الفلورسنت الخاصة بالخط الجرثومي16،18 ، لأن هذا من شأنه أن يضيف معلومات حول توطين البروتين والتعبير الجيني في الموقع. في هذا العمل ، يوصف WFISH بأنه تقنية للتحقيق في تكوين الحيوانات المنوية في بعوض الأنوفيلة. ومع ذلك ، نظرا للتشريح المشترك للأعضاء التناسلية الذكرية ، يمكن تطبيق هذا البروتوكول على أنواع البعوض الأخرى التي تلعب دورا في انتقال المرض. وبالمثل، يمكن دراسة تكوين الأمشاج الأنثوية باستخدام هذه التقنية. بالإضافة إلى ذلك ، يمكن استكشاف الدراسات الخلوية في الأعضاء أو الأنسجة ذات الأهمية ، مثل الأمعاء الوسطى للبعوض ، والتي تعد هدفا لغزو الطفيليات ، أو الخلفيات الجينية غير النمطية ، مثل تلك الموجودة في البعوض الهجين ،43. علاوة على ذلك ، يمكن نقل هذه التقنية إلى كائنات أخرى ضمن رتبة Diptera.

وتفرض الملاريا عبئا هائلا على صحة ورفاه سكان العالم. في عام 2021 ، قدرت منظمة الصحة العالمية (WHO) أن الملاريا تسببت في وفاة 619,000 ، 96٪ منها حدثت في أفريقيا جنوب الصحراءالكبرى 1. ينتقل المرض عن طريق البعوض الذي ينتمي إلى جنس Anopheles ، وفي أفريقيا جنوب الصحراء الكبرى ، تلعب ثلاثة أنواع ، وهي Anopheles gambiae (An. gambiae) و Anopheles coluzzi (An، coluzzi) و Anopheles arabiensis (An. Arabiensis) دورا كبيرا بشكل غير متناسب في انتقال الملاريا ، حيث تمثل 95٪ من حالات الملاريا على مستوى العالم. وقد أنقذت برامج المكافحة التي تعتمد على الطرق التقليدية مثل المبيدات الحشرية والأدوية المضادة للملاريا ملايين الأرواح؛ ومع ذلك ، في السنوات الأخيرة ، تحدت المقاومة المتزايدة لطرق التحكم هذه فعاليتها 1,2. وبالإضافة إلى ذلك، أثرت القيود التي فرضتها جائحة كوفيد-19 على توافر التدخلات الرئيسية لمكافحة الملاريا، والتي أدت إلىزيادة حالات الإصابة بالملاريا 1 وفقا لتقرير منظمة الصحة العالمية عن الملاريا لعام 2022. في العقدين الماضيين ، تم تطوير طرق مكافحة وراثية جديدة في البيئات المختبرية لاستهداف بعوض الأنوفيليس 3،4،5،6،7،8،9،10. من بين هذه الاستراتيجيات ، تبدو تلك القائمة على أنظمة محرك الجينات (GDSs) ومشوهات نسبة الجنس الاصطناعية (SDs) واعدة. تعتمد GDS على إمكانية نقل ، بتردد عال جدا ، تعديل وراثي يؤثر على خصوبة الإناث أو يضعف دورة حياة الطفيلي في البعوض5،11،12. بدلا من ذلك ، تعمل SDs عن طريق تحريف النسبة الجنسية لذرية البعوض نحو الذكور ، مما يؤدي ، بمرور الوقت ، إلى انهيار السكان المستهدفين بسبب نقص الإناث4،6،13. تؤثر المكونات الرئيسية لهذه الأجهزة الوراثية بشكل أساسي على الأعضاء التناسلية للبعوض؛ حيث تنتج الجاميتات والبويضات والحيوانات المنوية بعد الانقسامالميوزي 14.
في هذا البروتوكول ، يتم استخدام التقدم في تقنيات الوراثة الخلوية لاستكشاف تكوين الحيوانات المنوية في An. gambiae مع التركيز على سلوك الكروموسومات في الموقع. تم التحقيق سابقا في بنية خصية البعوض والعمليات البيولوجية التي تحدث داخلها باستخدام عدد من الطرق الخلوية ، مثل التألق المناعي ، والجينات المحورة الفلورية ، ومضان الحمض النووي والحمض النووي الريبي في الموقع (FISH)15،16،17،18،19،20; تظهر الأعضاء شكلا يشبه المغزل ، حيث يتم توصيل القطب السفلي بقناة مختلفة متصلة بالغدد الملحقة الذكرية. في القطب العلوي ، تتكاثر مكانة الخلايا الجذعية الجرثومية وتتمايز إلى خلايا أمهات منوية مدمجة داخل أكياس الحيوانات المنوية التي تشكلها الخلايا الجسدية. بعد جولات متعددة من الانقسام الميتوزي، تتمايز أمهات المني إلى خلايا منوية، تدخل الانقسام الميوزي. عند الطور التمهيدي، يقترن الكروموسوم الجسمي والكروموسومات الجنسية مع متجانساتهما، ويحدث التقاطع. بعد الانقسامات الاختزالية ، يتم إنشاء النطائن الأحادية الصيغة الصبغية المستديرة وتدخل في تكوين الحيوانات المنوية ، وتؤدي هذه العملية إلى تكوين منوية أحادية الصيغة الصبغية ناضجة يتم فيها إزالة السيتوبلازم ، ويتكثف الكروماتين النووي ، ويظهر سوط في الجزء القاعدي من النوى21,22 (الشكل 1 والشكل 2).
بشكل عام ، يبدأ تكوين الحيوانات المنوية في مرحلة منتصف العذراء ، ويمكن اكتشاف الحيوانات المنوية الناضجة في مرحلة العذراء المتأخرة في خزان الحيوانات المنوية23. تستمر عملية نضوج الأكياس المنوية خلال حياة البالغين23،24،25. في خصيتي الأنوفيلة، يمكن التعرف بسهولة على كل خطوة من خطوات تكوين الحيوانات المنوية من خلال النظر إلى التشكل النووي للخلايا في كل كيس منوي (الشكل 2). يسمح التهجين الفلوري الكامل في الموقع (WFISH) ، الموصوف في هذا البروتوكول ، للباحثين بتسمية منطقة الكروموسومات على وجه التحديد وتتبعها أثناء تكوين الحيوانات المنوية مع الحفاظ على البنية الأصلية لموضع نوى العضو والخلية. يمثل هذا ميزة عند مقارنته ببروتوكول DNA FISH القياسي الذي يتم فيه سحق العضو عادة ، مما يؤدي إلى تلف الأنسجة19. في البروتوكول الحالي ، يتم استخدام مجسات الفلورسنت لتلطيخ التسلسلات المتكررة على الكروموسومات الجنسية ، وبالتالي تتبع سلوكها أثناء تكوين الحيوانات المنوية ، من الخلايا المنقسمة ثنائية الصيغة الصبغية إلى الحيوانات المنوية الأحادية الصيغة الصبغية الناضجة. يمكن أن يكون WFISH مفيدا بشكل خاص لدراسة الاقتران الاختزالي للكروموسوم الجنسي والتحقيق في الأنماط الظاهرية الخلوية المرتبطة ، على سبيل المثال ، بمشوهات نسبة الجنس الاصطناعية ، وعقم الذكور الهجين ، وخروج الجينات المشاركة في تكوين الحيوانات المنوية4،19،26،27.
ونظرا لدور بعوض الأنوفيلة كناقل للملاريا، فإنه يستهدف عددا متزايدا من استراتيجيات مكافحة النواقل الوراثية، التي غالبا ما تعمل في الأعضاء التناسلية لهذه الكائنات. تم إنشاء العديد من طفرات البعوض والأنماط الظاهرية الخلوية التي تتطلب تقنيات خلوية جديدة للتحقيقفي 26،27،28،29. تلقي الطريقة الموصوفة في هذه الدراسة الضوء على فهم تكوين الحيوانات المنوية ، وكذلك الآليات الخلوية وراء الاستراتيجيات الجينية التي لديها القدرة على السيطرة على البعوض الناقل للملاريا.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amersham CyDye Fluorescent Nucleotides, Cy3-dUTP</td>
			<td>Cytiva</td>
			<td>PA53022</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham CyDye Fluorescent Nucleotides, Cy5-dUTP</td>
			<td>Cytiva</td>
			<td>PA55022</td>
			<td></td>
		</tr>
		<tr>
			<td>ART Wide Bore Filtered Pipette Tips</td>
			<td>ThermoFisher Scientific</td>
			<td>2079GPK</td>
			<td></td>
		</tr>
		<tr>
			<td>CytoBond Removable Coverslip Sealant</td>
			<td>SciGene</td>
			<td>2020-00-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Dextran sulfate sodium salt from Leuconostoc spp.</td>
			<td>Sigma-Aldrich</td>
			<td>D8906-5G</td>
			<td></td>
		</tr>
		<tr>
			<td>DNeasy Blood &#38; Tissue Kits&#160;</td>
			<td>Qiagen</td>
			<td>69504</td>
			<td></td>
		</tr>
		<tr>
			<td>Embryo Dishes</td>
			<td>VWR</td>
			<td>70543-30</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol, molecular grade</td>
			<td>Sigma-Aldrich</td>
			<td>51976</td>
			<td></td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>ThermoFisher Scientific</td>
			<td>17899</td>
			<td></td>
		</tr>
		<tr>
			<td>GoTaq G2 DNA Polymerase</td>
			<td>Promega</td>
			<td>M7841</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrochloric acid, 37%</td>
			<td>Sigma-Aldrich</td>
			<td>320331</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope slides, SuperFrost</td>
			<td>VWR&#160;</td>
			<td>631-0114</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS (10x), pH 7.4</td>
			<td>ThermoFisher Scientific</td>
			<td>70011044</td>
			<td></td>
		</tr>
		<tr>
			<td>Pierce 16% Formaldehyde (w/v), Methanol-free</td>
			<td>ThermoFisher Scientific</td>
			<td>28906</td>
			<td></td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade Mountant with DAPI</td>
			<td>ThermoFisher Scientific</td>
			<td>P36941</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase A/T1 Mix</td>
			<td>ThermoFisher Scientific</td>
			<td>EN0551</td>
			<td></td>
		</tr>
		<tr>
			<td>Set of dATP, dCTP, dGTP, dTTP</td>
			<td>Promega</td>
			<td>U1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate Solution</td>
			<td>ThermoFisher Scientific</td>
			<td>R1181</td>
			<td></td>
		</tr>
		<tr>
			<td>SP8 inverted confocal microscope</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>9036-19-5</td>
			<td></td>
		</tr>
		<tr>
			<td>TWEEN 20</td>
			<td>Sigma-Aldrich</td>
			<td>P1379</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure Salmon Sperm DNA Solution</td>
			<td>ThermoFisher Scientific</td>
			<td>15632011</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraPure SSC 20x</td>
			<td>ThermoFisher Scientific</td>
			<td>15557044</td>
			<td></td>
		</tr>
		<tr>
			<td>Primer sequences</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;-CAATAAATTTCCTTTTTAATGATGC 
			AAAATCTACGTCTCTAGC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>Contig_240 (X)</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;AGAAGAATAGAATCAGAATAGT 
			CGG 
			TTTCTTCATCCTGAAAGCC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>AgY53B (Y)</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8217;-TTCTAAGTTTCTAGGCTTTAAGGA 
			T 
			GAAGAAACCGACTATTC-3&#8217;-[Fluorochrome]</td>
			<td>Eurofins Genomics</td>
			<td>AgY477- 
			AgY53B 
			junction 
			region (Y)</td>
			<td></td>
		</tr>
		<tr>
			<td>F: AACTGTGGAAAAGCCAGAGC 
			R: TCCACTTGATCCTTGCAAAA</td>
			<td>Eurofins Genomics</td>
			<td>18S rDNA (X)</td>
			<td></td>
		</tr>
		<tr>
			<td>F: CCTTTAAACACATGCTCAAATT 
			R: GTTTCTTCATCCTTAAAGCCTAG</td>
			<td>Eurofins Genomics</td>
			<td>AgY53B (Y)</td>
			<td></td>
		</tr>
	</tbody>
</table>

whole-mount fluorescence in situ hybridization to study spermatogenesis in the anopheles mosquito

تكوين الحيوانات المنوية عملية بيولوجية معقدة تخضع خلالها الخلايا الثنائية الصيغة الصبغية لانقسام انقسامي واختزالي متتالي تليها تغيرات تركيبية كبيرة لتكوين الحيوانات المنوية الأحادية الصيغة الصبغية. إلى جانب الجانب البيولوجي ، فإن دراسة تكوين الحيوانات المنوية لها أهمية قصوى لفهم وتطوير التقنيات الوراثية مثل محرك الجينات ومشوهات نسبة الجنس الاصطناعية ، والتي ، من خلال تغيير الوراثة المندلية ونسبة جنس الحيوانات المنوية ، على التوالي ، يمكن استخدامها للسيطرة على مجموعات حشرات الآفات. وقد أثبتت هذه التكنولوجيات أنها واعدة جدا في البيئات المختبرية ويمكن استخدامها للسيطرة على المجموعات البرية من بعوض الأنوفيلة ، وهي ناقلات للملاريا. نظرا لبساطة تشريح الخصية وأهميتها الطبية ، يمثل Anopheles gambiae ، وهو ناقل رئيسي للملاريا في أفريقيا جنوب الصحراء الكبرى ، نموذجا خلويا جيدا لدراسة تكوين الحيوانات المنوية. يصف هذا البروتوكول كيف يمكن استخدام التهجين الفلوري الكامل في الموقع (WFISH) لدراسة التغيرات الدراماتيكية في البنية النووية للخلية من خلال تكوين الحيوانات المنوية باستخدام مجسات الفلورسنت التي تلطخ على وجه التحديد كروموسومات X و Y. يتطلب FISH عادة تعطيل الأعضاء التناسلية لفضح الكروموسومات الانقسامية أو الاختزالية والسماح بتلطيخ مناطق جينومية معينة بمجسات الفلورسنت. يتيح WFISH الحفاظ على البنية الخلوية الأصلية للخصية ، إلى جانب مستوى جيد من الكشف عن الإشارات من مجسات الفلورسنت التي تستهدف تسلسل الحمض النووي المتكرر. يسمح هذا للباحثين بمتابعة التغيرات في السلوك الكروموسومي للخلايا التي تخضع للانقسام الميوزي على طول بنية العضو ، حيث يمكن تمييز كل مرحلة من مراحل العملية بوضوح. يمكن أن تكون هذه التقنية مفيدة بشكل خاص لدراسة الاقتران الاختزالي للكروموسوم والتحقيق في الأنماط الظاهرية الخلوية المرتبطة ، على سبيل المثال ، بمشوهات نسبة الجنس الاصطناعية ، وعقم الذكور الهجين ، وخروج الجينات المشاركة في تكوين الحيوانات المنوية.

Malaria imposes an enormous burden on the health and well-being of the global human population. In 2021, the World Health Organization (WHO) estimated that malaria caused 619,000 deaths, of which 96% occurred in Sub-Saharan Africa1. The disease is transmitted by mosquitoes belonging to the Anopheles genus, and in Sub-Saharan Africa, three species, namely Anopheles gambiae (An. gambiae), Anopheles coluzzi (An, coluzzi) and Anopheles arabiensis (An. Arabiensis) have a disproportionately large role in malaria transmission, accounting for 95% of malaria cases globally. Control programs relying on traditional methods such as insecticides and antimalarial drugs have saved millions of lives; however, in recent years, the rising resistance to these control methods has challenged their efficacy1,2. In addition, restrictions imposed by the COVID-19 pandemic have affected the availability of key malaria control interventions, which, according to the 2022 WHO World Malaria Report, has increased malaria incidence1. In the last two decades, novel genetic control methods have been developed in laboratory settings to target&#160;Anopheles mosquitoes3,4,5,6,7,8,9,10. Among these strategies, those based on gene drive systems (GDSs) and synthetic sex ratio distorters (SDs) seem promising. GDSs rely on the possibility of transmitting, at a very high frequency, a genetic modification that affects female fertility or impairs the parasite life cycle in the mosquito5,11,12. SDs, instead, act by skewing the sex ratio of a mosquito progeny toward males, which leads, over time, to the collapse of a target population due to a lack of females4,6,13. The main components of these genetic systems act primarily on the reproductive organs of the mosquitoes, where the gametes, eggs, and sperm are produced following meiotic division14.
In this protocol, advances in cytogenetic techniques are employed to explore spermatogenesis in An. gambiae focusing on the chromosomes&#39; behavior in situ. The structure of the mosquito testis and the biological processes that take place within it have been previously investigated using a number of cytological methods, such as immunofluorescence, fluorescent reporter transgenes, and DNA and RNA fluorescence in situ hybridization (FISH)15,16,17,18,19,20; the organs show a spindle-like shape, in which the lower pole is attached to a deferent duct connected to the male accessory glands. In the upper pole, the germline stem cells niche proliferates and differentiates into spermatogonia cells embedded inside spermatocysts formed by somatic cells. Following multiple rounds of mitotic division, the spermatogonia differentiate into spermatocytes, which enter meiosis. At prophase, autosome and sex chromosomes pair with their homologs, and crossing over takes place. After the meiotic divisions, round haploid spermatids are generated and enter spermiogenesis, and this process leads to the formation of mature haploid spermatozoa in which the cytoplasm has been removed, the nuclear chromatin is condensed, and flagella emerge at the basal part of the nuclei21,22 (Figure 1 and Figure 2).
In general, spermiogenesis starts around the mid-pupal stage, and mature spermatozoa can be detected in the late pupal stage in the sperm reservoir23. The maturation process of the spermatocysts continues during adult life23,24,25. In Anopheles testes, each step of spermatogenesis can be easily identified by looking at the nuclear morphology of the cells in each spermatocyst (Figure 2). Whole-mount fluorescence in situ hybridization (WFISH), described in this protocol, allows researchers to specifically label a chromosomal region and track it during spermatogenesis while preserving the native structure of the organ and cell nuclei position; this represents an advantage when compared to the standard DNA FISH protocol in which the organ is usually squashed, leading to tissue damage19. In the current protocol, fluorescent probes are used to stain repetitive sequences on the sex chromosomes and, thus, track their behavior during spermatogenesis, from diploid dividing cells to mature haploid spermatozoa. WFISH can be particularly useful for studying sex chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis4,19,26,27.
Given their role as malaria vectors, Anopheles mosquitoes are the target of an increasing number of genetic vector control strategies, which often act in the reproductive organs of these organisms. Several mosquito mutants and cytological phenotypes have been generated that require novel cytological techniques to be investigated26,27,28,29. The method described in this study sheds light on the understanding of spermatogenesis, as well as the cytological mechanisms behind genetic strategies that have the potential to control malaria-transmitting mosquitoes.

تسليط الضوء على المؤلف: التهجين الفلوري الكامل في الموقع لدراسة تكوين المنوية في بعوضة الأنوفيليس  

التهجين الفلوري الكامل في الموقع لدراسة تكوين الحيوانات المنوية في بعوضة الأنوفيليس

The scope of our research is to develop and share cost-effective and sustainable genetic strategies that aim at reducing the number of malaria-transmitting mosquitoes in South Saharan Africa. In the last few years, we have demonstrated the power of gene drive technologies in suppressing caged mosquito populations. We are currently running a number of experiments to challenge these technologies in more complex experimental setup and to answer the regulatory requirements that are absolutely necessary for the potential implementation of these technologies in the field.FISH is a molecular cytogenetic technique that allows for the staining of a specific DNA sequence. It typically involves the squashing of the organ of interest, which can results in the loss of information about the spatial arrangement of cells. Wellman FISH allows for the preservation of the native cytological structure of the organs.Wellman FISH can be used to study chromosome behavior in mosquito reproductive organs. Reproductive organs are the target of several genetic strategies for vector control. Wellmann FISH has the potential to shed light on the mechanism that take place in the reproductive organs of well-time mosquito, as well as in any genetic strain of interest.

في هذا العمل ، تم استخدام WFISH للتحقيق في سلوك الكروموسوم أثناء تكوين الحيوانات المنوية في An. gambiae. الخطوة الأولى الحاسمة لتطبيق هذا البروتوكول هي الحصول على الخصيتين التي تظهر مستوى منخفض من التغيير المورفولوجي بعد التشريح. مطلوب معرفة أساسية بتشريح البعوض لإجراء تشريح ناجح للخصية ، وفيما يلي بعض الإرشادات لهذا الإجراء. في بعوضة Anopheles ، يمكن العثور على الخصيتين الناضجة ملقاة في الجزء البطني السادس من مراحل العذراء والكبار21. كما هو موضح في الشكل 1، يربط الأسهر الخصيتين بالغدد الملحقة الذكرية (MAGs)، التي تقع في الجزء الأخير من البطن. ترتبط MAGs بقناة قذف فريدة تنقل الحيوانات المنوية والسوائل المنوية إلى العضو التناسلي والجزء الخارجي من الجهاز التناسلي الذكري21. يمكن تشريح الجهاز التناسلي الذكري الداخلي بأكمله باستخدام طرق مختلفة اعتمادا على مرحلة حياة البعوض. خلال مرحلة العذراء ، يمكن التعرف بسهولة على الخصيتين باستخدام مجهر مجسم في جميع أنحاء بشرة الضوء من خلال النظر إلى الجانب البطني من البطن بالقرب من الجزء السادس (الشكل 1). لتشريح الخصيتين ، يمكن عزل الجزء السفلي من البطن ، بما في ذلك الجزء السادس ، عن بقية الجسم باستخدام زوج من الإبر ونقله إلى قطرة نظيفة من 1x PBS. بعد إزالة الجزء الأخير ، يمكن سحق الجهاز بأكمله من البطن عن طريق الضغط اللطيف باستخدام إبر التشريح. لتشريح الخصيتين من الذكور البالغين ، تتضمن الخطوة الأولى عزل البطن بالكامل في قطرة جديدة من 1x PBS ثم سحب الجزء الأخير الذي يحمل المشابك ، وهي الهياكل الجماعية الذكرية (الشكل 1). في هذه المرحلة ، يجب أن يظهر الجزء السفلي من MAGs ويمكن التعرف عليه بسهولة بسبب لونه الأصفر. يمكن بعد ذلك سحب الجهاز الذكري بالكامل ببطء بمساعدة إبرة أو ملقط في قطرة 1x PBS حتى يصبح زوج الخصيتين المتصلين بالأسهر مرئيا. قبل الشروع في التثبيت ، من المهم عزل الخصيتين عن الأجزاء الأخرى من الجهاز الذكري عن طريق قطع بالقرب من الجزء السفلي من الأسهر (الشكل 1).
يعد عمر الشرانق أو الذكور البالغين عاملا مهما يجب مراعاته اعتمادا على مرحلة تكوين الحيوانات المنوية قيد الفحص. في An. gambiae ، يبدأ تكوين الحيوانات المنوية في مرحلة مبكرة / منتصف العذراء ، ويستمر طوال حياة الفرد24. بين 3 ساعات إلى 10 ساعات بعد التشرد ، يتم تمثيل المراحل الأولية والانقسام الاختزالي بشكل أكبر في الخصية (الطور الاختزالي ، الانقسامات الاختزالية) ، والحمض النووي للحيوانات المنوية غير مكثف نسبيا ، ولم تتشكل الحيوانات المنوية الناضجة بعد. توفر الشرانق المتأخرة والبالغين من العمر يوما واحدا توازنا جيدا بين المراحل السابقة والاختزالية وما بعد الانقسام الاختزالي (الشكل 2 والشكل 3). في البالغين الذين يزيد عمرهم عن 4 أيام ، تكون المراحل الأولية و spermatocysts أقل تمثيلا ، وتشغل الخصيتين بشكل أساسي الحيوانات المنوية الناضجة الموجودة في خزان الحيوانات المنوية.
للتحقيق في سلوك الكروموسومات الجنسية خلال مراحل مختلفة من تكوين الحيوانات المنوية ، تم إجراء WFISH على الخصيتين تشريح في مرحلة العذراء المتأخرة لضمان تمثيل جيد للعملية برمتها. لمتابعة سلوك هذه الكروموسومات ، تم استخدام مجسات الفلورسنت الخاصة بالتسلسلات المتكررة الموجودة حصريا على كروموسوم X أو Y. يمكن إنشاء مجسات الفلورسنت باستخدام تفاعل البوليميراز المتسلسل أو الحصول عليها تجاريا على شكل أوليغونيوكليوتيدات 3 'ذات علامة نهائية. يوصى باستخدام oligo بطول >40 بت في الثانية للسماح باكتشاف إشارة جيدة من مسبار oligo الفلوري. في تجربتنا ، تعمل oligos ذات العلامات النهائية مقاس 3 بوصات بشكل أفضل من المجسات التي تحمل علامة PCR من حيث اكتشاف الإشارة. بالإضافة إلى ذلك ، فإن رقم نسخة التسلسل المستهدف هو عامل قد يؤثر على فعالية WFISH. إذا لم ينجح وضع العلامات ، يقترح استخدام طريقة وضع العلامات PCR على جزء أطول أو تصميم العديد من oligos الخاصة بالمنطقة المستهدفة.
تسمح الطرق الحالية ، القائمة على استخدام محلول اختراق (1٪ Triton / 0.1 M HCl في 1x PBST) ، بمستوى جيد من نفاذية الخصية واختراق المجسات ، مما يؤدي إلى تفاعل تهجين ناجح. يمكن تصميم مجسات Oligo الخاصة بالتسلسلات المتكررة للكروموسوم الجنسي بناء على التوصيف الشامل للعناصر المتكررة التي يقوم بها Hall et al.20. بالإضافة إلى ذلك ، يمكن الحصول على تسلسلات إجماع خاصة بالعناصر المتكررة المرتبطة ب X أو Y باستخدام منصة معلوماتية حيوية مثل خط أنابيب RedKmer30. من المهم ملاحظة أن مجسات الكروموسومات الجنسية يمكن أن تستهدف العناصر المتكررة مثل الأقمار الصناعية و retrotransposons ، ويمكن أن يكون لها مستوى مختلف من التهجين مع الكروموسومات X أو Y اعتمادا على الأنواع قيد الفحص20،31،32. كما هو موضح في الشكل 3 ، سمح المستوى الجيد من تهجين المجسات والخلفية المنخفضة بتصور الكروموسومات المستهدفة خلال تكوين الحيوانات المنوية. يمكن رؤية اقتران الكروموسومات الجنسية الموصوفة في مرحلتي ما قبل الكروموسوم والانقسام الاختزالي. تبع ذلك اكتشاف الكروموسومات X أو Y في كروموسومات نوى الخلايا الأحادية الصيغة الصبغية الناتجة عن الانقسامات الاختزالية. بعد ذلك، يمكن تتبع الطلائع المنوية الحاملة ل X أو Y خلال تكوين الحيوانات المنوية، والتي تتميز بمستويات مختلفة من تكثيف الحمض النووي، إلى الخطوة الأخيرة من الحيوانات المنوية الناضجة على شكل سهم. في الإعداد التجريبي الحالي ، تم استخدام مكدسات Z متحدة البؤر للحصول على معلومات تتعلق بالتنظيم المكاني ثلاثي الأبعاد للخلايا أثناء هذه العملية (الفيديو 1).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65356/65356fig01v2.jpg"> الشكل 1: تشريح الخصيتين من الشرانق وذكور الأنوفيلة الغامبية البالغة من العمر يوما واحدا. (أ) تشريح البطن في مرحلة العذراء المتأخرة يوضح موضع الخصيتين بالقرب من الجزء السادس من البطن. يمكن التعرف على الخصيتين في جميع أنحاء بشرة وتظهر كهياكل بنية على جانبي البطن (مع السهام). (ب) تشريح الخصيتين في مرحلة العذراء ، مع إظهار الخصيتين الناضجتين (1) ، الأسهر (2) ، MAGs (3) ، وقناة القذف (4). (ج) تشريح البطن من ذكر بالغ يبلغ من العمر 1 يوم بعد إزالة جزء المشبك القاعدي. يمكن سحق MAGs من البطن عن طريق الضغط اللطيف (السهم الأبيض). (د) جهاز تناسلي داخلي للذكور تم تشريحه من ذكر بالغ عمره 1 يوم. يشير السهم الأبيض إلى الموضع الذي تشغله الحيوانات المنوية الناضجة ، والتي تظهر على شكل تجمع أبيض في القطب القاعدي للخصية. قضبان المقياس: (A ، C) 200 ميكرومتر ؛ (ب ، د) 100 ميكرومتر. تشير الأرقام الرومانية من الأول إلى الثامن إلى شرائح البطن. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig01large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65356/65356fig02v2.jpg"> الشكل 2: تمثيل تكوين الحيوانات المنوية في الأنوفيلة الغامبية. تظهر الصورة الموجودة على اليسار خصية خادرة متأخرة من An. gambiae بعد تلطيخ DAPI بالكامل. على اليمين نسخة تخطيطية لتصور أفضل. من خلال مراقبة الشكل النووي ومستوى التكثيف، من السهل نسبيا متابعة جميع مراحل تكوين الحيوانات المنوية من الخلايا الثنائية الصيغة الصبغية إلى الحيوانات المنوية الأحادية الصيغة الصبغية. يقع مكان الخلايا الجذعية في القطب العلوي للعضو ، حيث يبدأ التمايز إلى أمهات المني. يزداد عدد خلايا أمهات المني بعد الانقسام الانقسامي (الخلايا الخضراء) ، ويزداد حجم الكيسات المنوية (الخلايا الصفراء). تتمايز خلايا أمهات المني إلى خلايا منوية بعد جولات متعددة من الانقسامات الانقسامية (الخلايا الزرقاء). الخلايا المنوية ، التي تتميز بنوى أكبر نسبيا من خلايا المراحل الأخرى من العملية ، هي الخلايا التي ستخضع للانقسام الميوطي. يمكن الكشف عن الخلايا التي تخضع للانقسام الاختزالي من خلال النظر في وجود الكروموسومات في مراحل الانقسام الاختزالي المختلفة. يمكن اكتشاف كروموسومات Chiasmata و metaphase حتى عند التكبير المنخفض. يتم تمثيل المراحل الأولية بشكل مفرط في الخصيتين التي تم تشريحها في مرحلة العذراء المبكرة. بعد الانقسامين الميوتي الأول والثاني، تنتج الطلائع المنوية، وعادة ما توجد ملقاة في منتصف الخصية. تظهر نوى الطلائع المنوية درجة معينة من الاختلاف في شكلها ، من شكل دائري إلى شكل يشبه السهم. تدخل الطلائع المنوية في عملية تكوين الحيوانات المنوية ، والتي تبدأ خلالها النوى في التكثيف ، ويتغير هيكلها إلى نقاط تشبه السهم. عندما ينضج البعوض جنسيا بعد ظهوره ، يمكن أن تشغل الأكياس المنوية التي تحتوي على منوية ناضجة معظم حجم الخصية على حساب أكياس الحيوانات المنوية في مرحلة مختلفة من التطور. شريط المقياس: 20 ميكرومتر. تشير العلامة النجمية (*) إلى الجزء القمي من الخصية. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig02large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/65356/65356fig03v2.jpg"> الشكل 3: WFISH على خصية An. gambiae تشريح من مرحلة العذراء المتأخرة. تم إجراء WFISH باستخدام مجسات محددة للكروموسومات X (Contig_240) و Y (مسبار oligo الخاص ب AgY53B). (أ) يسمح WFISH بمتابعة سلوك الكروموسوم الجنسي أثناء تكوين الحيوانات المنوية من الخلايا الثنائية الصيغة الصبغية إلى الحيوانات المنوية الأحادية الصيغة الصبغية. في هذه الصورة ، من الممكن تقدير التغيرات الدراماتيكية التي تمر بها النوى أثناء تكوين الحيوانات المنوية. يسمح تصنيف الكروموسومات الجنسية بالتمييز بين الخلايا الثنائية الصيغة الصبغية والأحادية الصيغة الصبغية. في الخلايا الثنائية الصيغة الصبغية ، ترتبط الإشارة من الكروموسومات الجنسية بنفس النوى. في الخلايا الأحادية الصيغة الصبغية (الطلائع المنوية والحيوانات المنوية) ، لا ترتبط إشارة الكروموسومات الجنسية بسبب الانقسام الاختزالي الاختزالي. (ب، ج) صورة تكبير أعلى (63x) للخصية موضحة في (A). تم الحصول عليها في مواقع مختلفة على طول المحور Z. تشير الإطارات المنقطة البيضاء إلى منطقة الاستحواذ. ب: المرحلة الانتقالية بين الخلايا المنوية والطلائع المنوية، التي توضح تكوين الخلايا الأحادية الصيغة الصبغية وفصل الإشارات من الكروموسومات الجنسية إلى نوى منفصلة. ج: المرحلة الانتقالية بين الطلائع المنوية الأحادية الصيغة الصبغية والحيوانات المنوية الناضجة. تظهر هذه المرحلة التغيرات في مستوى التكثيف النووي. تظهر الحيوانات المنوية الناضجة شكلا أكثر كثافة واستطالة من الحيوانات المنوية. قضبان المقياس: (A) ، 30 ميكرومتر ؛ (ب ، ج) ، 10 ميكرومتر ؛ الرمادي: دابي. <a href="https://www.jove.com/files/ftp_upload/65356/65356fig03large.jpg" target="_blank">يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td>التسلسل المستهدف</td>
			<td>تسلسل التمهيدي وإجماع مسبار Oligo</td>
			<td>مرجع</td>
		</tr><tr><td>Contig_240 (X)</td>
			<td>5'-CAATAAATTTCCTTTTTAATGATGC AAAATCTACGTCTCTAGC-3'-[فلوروكروم]</td>
			<td>19</td>
		</tr><tr><td>AgY53B (Y)</td>
			<td>5'AGAAGAATAGAATCAGAATAGTCGG TTTCTTCATCCTGAAAGCC-3'-[فلوروكروم]</td>
			<td>هذه الدراسة</td>
		</tr><tr><td>AgY477- AgY53B تقاطع المنطقة (Y)</td>
			<td>5'-TTCTAAGTTTCTAGGCTTTAAGGAT GAAGAAACCGACTATTC-3'-[فلوروكروم]</td>
			<td>19</td>
		</tr><tr><td>18S rDNA (X)</td>
			<td>F: AACTGTGGAAGAGCAGC R: TCCACTTGATCCTTGCAAAA</td>
			<td>19</td>
		</tr><tr><td>AgY53B (Y)</td>
			<td>F: CCTTTAAACACATGCTCAAATT R: GTTTCTTCATCCTTAAAGCCTAG</td>
			<td>19</td>
		</tr></tbody></table>الجدول 1: قائمة مجسات oligo الخاصة بالكروموسوم X أو Y في An. gambiae.
فيديو 1: كومة 3D على WFISH أجريت على An. gambiae testis تشريح من مرحلة العذراء المتأخرة. للحصول على تمثيل ثلاثي الأبعاد لعملية تكوين الحيوانات المنوية ، يمكن إجراء مكدس ثلاثي الأبعاد متحد البؤر على الخصيتين تظهر عددا منخفضا من التعديلات الهيكلية. في هذه الدراسة ، تم إجراء المداخن بفاصل 1.25 ميكرومتر بين قسمين بصريين تحت عدسة زيت 63x أو 40x حتى لا تفقد المعلومات حول التنظيم المكاني ثلاثي الأبعاد للخلايا. الرمادي: DAPI ، الأصفر: Contig_240 (X) ، أرجواني: AgY53B (Y). <a href="https://www.jove.com/files/ftp_upload/65356/Video-1.zip" target="_blank">الرجاء الضغط هنا لتنزيل هذا الفيديو.</a>

Watch this Scientific Journal Video about Whole-Mount Fluorescence In Situ Hybridization to Study Spermatogenesis in the Anopheles Mosquito at JoVE.com

نظرا لتشريحها البسيط ، تقدم خصيتا الأنوفيلة نموذجا خلويا جيدا لدراسة تكوين الحيوانات المنوية. يصف هذا البروتوكول التهجين الفلوري الكامل في الموقع ، وهي تقنية تستخدم للتحقيق في هذه العملية البيولوجية ، بالإضافة إلى النمط الظاهري للسلالات المعدلة وراثيا التي تؤوي طفرات في الجينات المشاركة في إنتاج الحيوانات المنوية.

Spermatogenesis is a complex biological process during which diploid cells undergo successive mitotic and meiotic division followed by large structural ...

يتمثل نطاق بحثنا في تطوير وتبادل استراتيجيات وراثية فعالة من حيث التكلفة ومستدامة تهدف إلى تقليل عدد البعوض الناقل للملاريا في جنوب الصحراء الكبرى. في السنوات القليلة الماضية ، أظهرنا قوة تقنيات محرك الجينات في قمع مجموعات البعوض المحبوسة. نحن نجري حاليا عددا من التجارب لتحدي هذه التقنيات في إعداد تجريبي أكثر تعقيدا وللإجابة على المتطلبات التنظيمية الضرورية للغاية للتنفيذ المحتمل لهذه التقنيات في هذا المجال.FISH هي تقنية وراثية خلوية جزيئية تسمح بتلطيخ تسلسل معين من الحمض النووي. وعادة ما ينطوي على سحق العضو محل الاهتمام ، مما قد يؤدي إلى فقدان المعلومات حول الترتيب المكاني للخلايا. يسمح Wellman FISH بالحفاظ على البنية الخلوية الأصلية للأعضاء.يمكن استخدام Wellman FISH لدراسة سلوك الكروموسوم في الأعضاء التناسلية للبعوض. الأعضاء التناسلية هي هدف العديد من الاستراتيجيات الجينية لمكافحة النواقل. لدى Wellmann FISH القدرة على إلقاء الضوء على الآلية التي تحدث في الأعضاء التناسلية للبعوض في الوقت المناسب ، وكذلك في أي سلالة وراثية ذات أهمية.

whole-mount-fluorescence-situ-hybridization-to-study-spermatogenesis

Research

JoVE Journal

Immunology and Infection

Whole-Mount Fluorescence In Situ Hybridization to Study Spermatogenesis in the Anopheles Mosquito

1.5K Views.  Imperial College London. يتمثل نطاق بحثنا في تطوير وتبادل استراتيجيات وراثية فعالة من حيث التكلفة ومستدامة تهدف إلى تقليل عدد البعوض الناقل للملاريا في جنوب الصحراء الكبرى. في السنوات القليلة الماضية ، أظهرنا قوة تقنيات محرك الجينات في قمع مجموعات البعوض المحبوسة. نحن نجري حاليا عددا من التجارب ل...

Video: تسليط الضوء على المؤلف: التهجين الفلوري الكامل في الموقع لدراسة تكوين المنوية في بعوضة الأنوفيليس  

Spermatogenesis is a complex biological process during which diploid cells undergo successive mitotic and meiotic division followed by large structural changes to form haploid spermatozoa. Besides the biological aspect, studying spermatogenesis is of paramount importance for understanding and developing genetic technologies such as gene drive and synthetic sex ratio distorters, which, by altering Mendelian inheritance and the sperm sex ratio, respectively, could be used to control pest insect populations. These technologies have proven to be very promising in lab settings and could potentially be used to control wild populations of Anopheles mosquitoes, which are vectors of malaria. Due to the simplicity of the testis anatomy and their medical importance, Anopheles gambiae, a major malaria vector in sub-Saharan Africa, represents a good cytological model for studying spermatogenesis. This protocol describes how whole-mount fluorescence in situ hybridization (WFISH) can be used to study the dramatic changes in cell nuclear structure through spermatogenesis using fluorescent probes that specifically stain the X and Y chromosomes. FISH usually requires the disruption of the reproductive organs to expose mitotic or meiotic chromosomes and allow the staining of specific genomic regions with fluorescent probes. WFISH enables the preservation of the native cytological structure of the testis, coupled with a good level of signal detection from fluorescent probes targeting repetitive DNA sequences. This allows researchers to follow changes in the chromosomal behavior of cells undergoing meiosis along the structure of the organ, where each phase of the process can clearly be distinguished. This technique could be particularly useful for studying chromosome meiotic pairing and investigating the cytological phenotypes associated with, for example, synthetic sex ratio distorters, hybrid male sterility, and the knock-out of genes involved in spermatogenesis.

Given their simple anatomy, Anopheles testes offer a good cytological model for studying spermatogenesis. This protocol describes whole-mount fluorescence in situ hybridization, a technique used to investigate this biological process, as well as the phenotype of transgenic strains harboring mutations in the genes involved in sperm production.

Generating DNA Probes to Label the Sex Chromosomes of Anopheles Mosquitoes and Preparing the Hybridization Solution

Generating DNA Probes to Label the Sex Chromosomes of Anopheles Mosquitoes and Preparing the Hybridization Solution  

Begin by using a commercial extraction kit to extract the genomic DNA from the pupae or from adult male Anopheles mosquitoes. Next, prepare the PCR reaction mixture. Label the 18 SR-DNA and satellite AGY 53B by performing a PCR reaction.For the preparation of the hybridization solution, add five microliters of labeled DNA probe to a 1.5 milliliter tube. Then add five microliters of salmon sperm DNA. Precipitate the DNA probe by adding two volumes of 100%ethanol and 0.1 volume of three molar sodium acetate.Keep at minus 20 degrees Celsius for at least 2.5 hours. Centrifuge the tube at 17, 000 G for 20 minutes at four degrees Celsius. Then remove the ethanol and air dry the pellet at room temperature in the dark for 20 minutes.Next, prepare the hybridization buffer in a 1.5 milliliter tube. Vortex the solution for one minute and allow the dextran sulfate to dissolve at 37 degrees Celsius for 30 minutes. To obtain the hybridization solution, dissolve the DNA palette in 20 to 30 microliters of the hybridization buffer.Vortex the solution for one minute. Perform a quick spin, and store the tubes at 37 degrees Celsius in the dark.

توليد مجسات الحمض النووي لتسمية الكروموسومات الجنسية لبعوض الأنوفيليس وإعداد محلول التهجين

Anopheles Mosquito Testis Dissection and Hybridisation

Anopheles Mosquito Testis Dissection and Hybridisation  

Begin by excising at least 20 testes from the pupae of Anopheles mosquitoes in sterile PBS. Transfer the testes to a clean microscope slide containing a fresh drop of PBS. Using P1000 boarded filtered tips or the tip of a dissection needle, transfer the testes into an embryo dish containing 3.7%formaldehyde in PBST.Incubate for 10 minutes at room temperature. Next, wash the testes in PBST for five minutes at room temperature. Transfer the testes to the embryo dish containing RNase A and incubated for a half hour at 37 degrees Celsius.Remove the RNA solution and add one milliliter of the penetrating solution. Incubate the testes in the penetrating solution at room temperature for 10 minutes. Then wash the testes and PBST two times for five minutes each.Transfer the testes to a 1.5 milliliter tube containing 20 to 30 microliters of hybridization solution with the labeled DNA probe. Incubate the mixture overnight at 37 degrees Celsius in the dark to allow hybridization. With the help of AP 1000 white bore filtered tip, transfer the testes into an embryo dish, then wash them in two XSSC for five minutes.Remove the SSC then mount the testes on a frosted glass slide using a commercially available mounting medium containing DAPI. Seal the slide with a cover slip sealant and incubate it at room temperature in the dark for two hours. A good level of hybridization allowed for the visualization of the targeted chromosomes throughout spermatogenesis.The pairing of the labeled sex chromosomes could be seen in the prebiotic and myotic stages. X or Y bearing spermatids could be followed throughout spermiogenesis marked by different levels of DNA condensation to the final step of arrow shaped mature spermatozoa.