a-contrast-three-inoculation-techniques-used-to-determine-race

A Contrast of Three Inoculation Techniques used to Determine the Race of Unknown <em>Fusarium oxysporum</em> f.sp. <em>niveum</em> Isolates

Fusarium wilt of watermelon (Citrullus lanatus), caused by Fusarium oxysporum f. sp. niveum (Fon), has reemerged as a major production constraint in the ...

University of Georgia

&#x7B2C;&#x4E00;&#x5355;&#x6838;&#x82F7;&#x9178;&#x591A;&#x6001;&#x6027; (SNP) &#x6620;&#x5C04;&#x4E3A;&#x897F;&#x74DC; [&#x65E0;&#x7C7D;&#x897F;&#x74DC; (&#x2174;)&#x9547;&#x75DB;&#x3002;et &#x4E2D;&#x4EA5;] &#x88AB;&#x6784;&#x9020;&#x548C;&#x6BD4;&#x8F83;&#x3002;&#x4ECE;&#x4E24;&#x4E2A;&#x4F18;&#x826F;&#x54C1;&#x79CD;&#x3001; &#x514B;&#x6717;&#x4EE3;&#x514B;&#x9ED1;&#x7C7D; &times; &#x65B0;&#x7F55;&#x5E03;&#x4EC0;&#x5C14;&#x4F8F;&#x5112; (KBS &times; &#x516C;&#x53F8;&#x4ECB;&#x7ECD;)&#x3001; &#x4F18;&#x826F;&#x54C1;&#x79CD;&#x548C;&#x91CE;&#x751F; egusi &#x52A0;&#x5165;&#x3001; &#x5E94;&#x53D8;&#x4E8C; &times; PI 560023 (SII &times; Egusi) &#x548C;&#x7CBE;&#x82F1;&#x7684;&#x54C1;&#x79CD;&#x548C;&#x91CE;&#x751F;&#x4F5B;&#x624B;&#x52A0;&#x5165;&#xFF0C;ZWRM50 &times; PI 244019 (ZWRM &times; Citroides) &#x4E4B;&#x95F4;&#x7684;&#x5341;&#x5B57;&#x67B6;&#x5236;&#x5B9A;&#x4E86;&#x4E09;&#x4E2A;&#x7FA4;&#x4F53;&#x3002;SII Egusi &#x548C; ZWRM &times; &times; Citroides F(2) &#x4EBA;&#x53E3;&#x5305;&#x62EC; 187 &#x548C; 182 &#x4E2A;&#x4EBA;&#x5206;&#x522B;&#x867D;&#x7136; KBS &times; &#x516C;&#x53F8;&#x4ECB;&#x7ECD;&#x91CD;&#x7EC4;&#x81EA;&#x4EA4;&#x7684;&#x7CFB; (&#x91CD;&#x7EC4;&#x767D;&#x7EC6;&#x80DE;&#x4ECB;&#x7D20;) &#x4EBA;&#x53E3;&#x7531; 164 &#x884C;&#x7EC4;&#x6210;&#x3002;&#x9057;&#x4F20;&#x56FE;&#x8C31;&#x7684;&#x957F;&#x5EA6;&#x5206;&#x522B;&#x4E3A; 3.8&#xFF0C;4.2 &#x548C; 3.4 &#x5398;&#x7C73; &times; KBS &#x516C;&#x53F8;&#x4ECB;&#x7ECD;&#x3001; &#x53E4;&#x6811; &times; Egusi &#x548C; ZWRM &times; Citroides &#x4EBA;&#x53E3;&#xFF0C;&#x5E73;&#x5747;&#x6807;&#x8BB0;&#x7684;&#x8DDD;&#x79BB;&#xFF0C;&#x4E0E; 1,438&#x3001; 1,514 &#x548C; 1,144 &#x5398;&#x7C73;&#x3002;&#x5171;&#x4EAB;&#x7684;&#x6807;&#x8BB0;&#x88AB;&#x7528;&#x6765;&#x5BF9;&#x9F50;&#x4E09;&#x4E2A;&#x5730;&#x56FE;&#xFF0C;&#x4F7F;&#x8FDE;&#x9501;&#x7FA4; (LGs) &#x4EE3;&#x8868; 11 &#x67D3;&#x8272;&#x4F53;&#x7684;&#x7269;&#x79CD;&#x3002;&#x6807;&#x8BB0;&#x9694;&#x79BB;&#x5931;&#x771F;&#x5347;&#x5E45;&#x7684;&#x6240;&#x6709;&#x4E09;&#x4E2A;&#x7FA4;&#x4F53;&#xFF0C;&#x4F46; ZWRM &times; Citroides &#x4EBA;&#x53E3;&#xFF0C;&#x90A3;&#x91CC;&#x7684; Citroides &#x7B49;&#x4F4D;&#x57FA;&#x56E0;&#x88AB;&#x9752;&#x7750;&#x4E2D;&#x662F;&#x6700;&#x9AD8;&#x7684; (12.7%)&#x3002;&#x4E09;&#x4E2A;&#x5730;&#x56FE;&#x88AB;&#x7528;&#x6765;&#x6784;&#x5EFA;&#x542B; 378 &#x5355;&#x6838;&#x82F7;&#x9178;&#x591A;&#x6001;&#x6027;&#x6807;&#x8BB0;&#x7684; 5.1 &#x5398;&#x7C73;&#x6807;&#x5FD7;&#x4E4B;&#x95F4;&#x7684;&#x5E73;&#x5747;&#x8DDD;&#x79BB;&#x5171;&#x8BC6;&#x5730;&#x56FE;&#x3002;&#x4E3A;&#x6C34;&#x679C;&#x91CD;&#x91CF; (&#x5B50;)&#x3001; &#x6C34;&#x679C;&#x957F;&#x5EA6; (FL)&#x3001; &#x6C34;&#x679C;&#x5BBD;&#x5EA6; &#xFF08;FWD&#xFF09;&#x3001; &#x679C;&#x5F62;&#x6307;&#x6570; &#xFF08;FSI&#xFF09;&#x3001; &#x679C;&#x76AE;&#x539A;&#x5EA6; &#xFF08;&#x4EFB;&#x610F;&#x9636;&#x539F;&#x70B9;) &#x548C;&#x7CD6;&#x5EA6; (BRX) &#x6536;&#x96C6;&#x5E76;&#x5206;&#x6790;&#x6570;&#x91CF;&#x6027;&#x72B6;&#x4F4D;&#x70B9; (QTL) &#x4E0E;&#x8FD9;&#x4E9B;&#x6027;&#x72B6;&#x76F8;&#x5173;&#x8054;&#x7684;&#x8868;&#x578B;&#x6570;&#x636E;&#x3002;&#x603B;&#x5171;&#x6709; 40 QTL &#x53D1;&#x73B0;&#x4E09;&#x4E2A;&#x7FA4;&#x4F53;&#xFF0C;&#x5305;&#x62EC;&#x4E3B;&#x8981; QTL &#x679C;&#x5B9E;&#x5927;&#x5C0F;&#x548C;&#x5F62;&#x72B6;&#xFF0C;&#x8DE8;&#x9057;&#x4F20;&#x80CC;&#x666F;&#x548C;&#x73AF;&#x5883;&#x662F;&#x7A33;&#x5B9A;&#x7684;&#x3002;&#x672C;&#x7814;&#x7A76;&#x62A5;&#x544A;&#x7B2C;&#x4E00;&#x5355;&#x6838;&#x82F7;&#x9178;&#x591A;&#x6001;&#x6027;&#x65E0;&#x7C7D;&#x548C;&#x7684;&#x7B2C;&#x4E00;&#x4E2A;&#x6620;&#x5C04;&#x6620;&#x5C04;&#x6784;&#x9020;&#x4F7F;&#x7528;&#x4E24;&#x4E2A;&#x4F18;&#x79C0;&#x5BB6;&#x957F;&#x3002;&#x6211;&#x4EEC;&#x8FD8;&#x62A5;&#x544A; QTL &#x4E0E;&#x679C;&#x5B9E;&#x5927;&#x5C0F;&#x548C;&#x65E0;&#x7C7D;&#x897F;&#x74DC;&#x7684;&#x5F62;&#x72B6;&#x76F8;&#x5173;&#x8054;&#x7684;&#x7B2C;&#x4E00;&#x6B21;&#x7A33;&#x5B9A;&#x3002;&#x8FD9;&#x4E9B;&#x5730;&#x56FE;&#x3001; QTL &#x548C;&#x5355;&#x6838;&#x82F7;&#x9178;&#x591A;&#x6001;&#x6027;&#x5E94;&#x662F;&#x6709;&#x76CA;&#x7684;&#x897F;&#x74DC;&#x793E;&#x4F1A;&#x548C;&#x5BF9;&#x897F;&#x74DC;&#x80B2;&#x79CD;&#x4E2D;&#x7684;&#x5206;&#x5B50;&#x5DE5;&#x5177;&#x53EF;&#x80FD;&#x4F7F;&#x7528;&#x7684;&#x91CD;&#x5927;&#x4E00;&#x6B65;&#x3002;

[&#x65E0;&#x7C7D;&#x897F;&#x74DC; (&#x2174;) &#x897F;&#x74DC;&#x6BD4;&#x8F83;&#x6620;&#x5C04;&#x9547;&#x75DB;&#x3002;et &#x4E2D;&#x4EA5;]&#x3002;

The first single-nucleotide polymorphism (SNP) maps for watermelon [Citrullus lanatus (Thunb.) Matsum. et Nakai] were constructed and compared. Three populations were developed from crosses between two elite cultivars, Klondike Black Seeded Ã— New Hampshire Midget (KBS Ã— NHM), an elite cultivar and wild egusi accession, Strain II Ã— PI 560023 (SII Ã— Egusi) and an elite cultivar and a wild citron accession, ZWRM50 Ã— PI 244019 (ZWRM Ã— Citroides). The SII Ã— Egusi and ZWRM Ã— Citroides F(2) populations consisted of 187 and 182 individuals respectively while the KBS Ã— NHM recombinant inbred line (RIL) population consisted of 164 lines. The length of the genetic maps were 1,438, 1,514 and 1,144 cM with average marker distances of 3.8, 4.2, and 3.4 cM for the KBS Ã— NHM, SII Ã— Egusi and ZWRM Ã— Citroides populations, respectively. Shared markers were used to align the three maps so that the linkage groups (LGs) represented the 11 chromosomes of the species. Marker segregation distortion were observed in all three populations, but was highest (12.7 %) in the ZWRM Ã— Citroides population, where Citroides alleles were favored. The three maps were used to construct a consensus map containing 378 SNP markers with an average distance of 5.1 cM between markers. Phenotypic data was collected for fruit weight (FWT), fruit length (FL), fruit width (FWD), fruit shape index (FSI), rind thickness (RTH) and Brix (BRX) and analyzed for quantitative trait loci (QTL) associated with these traits. A total of 40 QTL were identified in the three populations, including major QTL for fruit size and shape that were stable across genetic backgrounds and environments. The present study reports the first SNP maps for Citrullus and the first map constructed using two elite parents. We also report the first stable QTL associated with fruit size and shape in Citrullus lanatus. These maps, QTL and SNPs should be useful for the watermelon community and represent a significant step towards the potential use of molecular tools in watermelon breeding.

Comparative mapping in watermelon [Citrullus lanatus (Thunb.) Matsum. et Nakai].

Le premier single-nucleotide polymorphism (SNP) cartes pour la past&egrave;que [Citrullus lanatus (Thunb.) Matsum. et Nakai] ont &eacute;t&eacute; construits et compar&eacute;es. Trois populations ont &eacute;t&eacute; mis au point d&#39;un croisement entre deux cultivars d&#39;&eacute;lites, Klondike noir sem&eacute; &times; New Hampshire Midget (KBS &times; NHM), un cultivar &eacute;lite et adh&eacute;sion egusi sauvage, souche II &times; PI 560023 (SII &times; Egusi) et un cultivar &eacute;lite et une adh&eacute;sion citron sauvage, ZWRM50 &times; PI 244019 (ZWRM &times; Citroides). Les populations de Citroides f &times; &times; Egusi et ZWRM SII se composait de 187 et 182 personnes respectivement tandis que la population de lign&eacute;es recombinantes fix&eacute;es (RIL) KBS &times; NHM comprenait 164 lignes. La longueur des cartes g&eacute;n&eacute;tiques ont &eacute;t&eacute; de 1 438, 1 514 et 1 144 cM avec des distances de marqueur moyenne de 3,8 et 4,2 3,4 cM &times; KBS NHM, SII &times; Egusi et les populations ZWRM &times; Citroides, respectivement. Partag&eacute;es ont &eacute;t&eacute; employ&eacute;s pour aligner les trois cartes afin que les groupes de liaison (LGs) repr&eacute;sentaient les 11 chromosomes de l&#39;esp&egrave;ce. Distorsion de s&eacute;gr&eacute;gation des marqueurs ont &eacute;t&eacute; observ&eacute;es dans les trois populations, mais &eacute;tait plus &eacute;lev&eacute; (12,7 %) dans le ZWRM &times; Citroides population, o&ugrave; Citroides all&egrave;les ont &eacute;t&eacute; favoris&eacute;s. Les trois cartes ont &eacute;t&eacute; utilis&eacute;es pour construire une carte contenant des 378 SNP marqueurs avec une distance moyenne de 5,1 cM entre les marqueurs. Donn&eacute;es ph&eacute;notypiques ont &eacute;t&eacute; recueillies pour le poids de fruits (FWT), longueur (FL), largeur de fruits (FWD), indice de forme de fruit (FSI), &eacute;paisseur de la cro&ucirc;te (RTH) et Brix (BRX) et analys&eacute;es pour quantitative trait loci (QTL) associ&eacute;s &agrave; ces traits. Un total de 40 QTL ont &eacute;t&eacute; identifi&eacute;s dans les trois populations, y compris un QTL majeur pour le calibre des fruits et leur forme &eacute;taient stables &agrave; travers des environnements et des ant&eacute;c&eacute;dents g&eacute;n&eacute;tiques. Les rapports d&#39;&eacute;tude pr&eacute;sente le SNP premi&egrave;re cartes de Citrullus et la premi&egrave;re carte construit &agrave; l&#39;aide de deux parents d&#39;&eacute;lites. Nous rapportons &eacute;galement l&#39;&eacute;curie premier que QTL associ&eacute; &agrave; fruits taille et la forme de Citrullus lanatus. Ces cartes, QTL et SNP devraient &ecirc;tre utile pour la communaut&eacute; de past&egrave;que et repr&eacute;sentent une &eacute;tape importante vers l&#39;utilisation potentielle des outils mol&eacute;culaires dans l&#39;am&eacute;lioration de la past&egrave;que.

Cartographie compar&eacute;e chez la past&egrave;que [Citrullus lanatus (Thunb.) Matsum. et Nakai].

Die erste Einzel-Nukleotid Polymorphie (SNP) Karten f&uuml;r Wassermelone [Citrullus Lanatus (Thunb.) Matsum. et Nakai] konstruiert und verglichen wurden. Drei Populationen wurden aus Kreuzungen zwischen zwei Elite-Sorten, Klondike schwarz Seeded &times; New Hampshire Midget (KBS &times; NHM), einer elit&auml;ren Sorte und wild Egusi Beitritt, Strain II &times; PI 560023 (SII &times; Egusi) und einer elit&auml;ren Sorte und eine wilde Zitrone Beitritt, ZWRM50 &times; PI 244019 (ZWRM &times; Citroides) entwickelt. Die SII &times; Egusi und ZWRM &times; Citroides f Absatz 2 Bev&ouml;lkerung bestand aus 187 und 182 Personen bzw. w&auml;hrend die KBS &times; NHM rekombinante Inzuchtlinie (RIL) Bev&ouml;lkerung aus 164 Linien bestand. Die L&auml;nge der genetischen Karten waren 1.438, 1.514 und 1.144 cM mit durchschnittlichen Markierung Distanzen von 3,8 und 4,2 3,4 cM f&uuml;r KBS &times; NHM, SII &times; Egusi und ZWRM &times; Citroides Populationen, beziehungsweise. Freigegebene Marker wurden verwendet, um die drei Karten so ausrichten, dass die Linkage-Gruppen (LGs) die 11 Chromosomen der Arten vertreten. Markierung Rassentrennung Verzerrung in allen drei Populationen beobachtet wurden, aber war h&ouml;chste (12,7 %) in die ZWRM &times; Citroides Bev&ouml;lkerung, wo Citroides Allele bevorzugt wurden. Die drei Karten dienten eine Konsens-Landkarte mit 378 SNP-Marker mit einer durchschnittlichen Entfernung von 5,1 cM zwischen Markern zu erstellen. Ph&auml;notypische Daten wurde f&uuml;r Obst Gewicht (FWT), Obst-L&auml;nge (FL), Frucht-Breite (FWD), Obst Shape Index (FSI), Dicke Rinde (RTH) und Brix (BRX) gesammelt und analysiert f&uuml;r quantitative Trait Loci (QTL) diese Merkmale zugeordnet. Wurden insgesamt &uuml;ber 40 QTL identifiziert, in der drei Bev&ouml;lkerungsgruppen, einschlie&szlig;lich gro&szlig;e QTL f&uuml;r Obst-Gr&ouml;&szlig;e und Form, die &uuml;ber genetische Hintergr&uuml;nde und Umgebungen stabil waren. Die vorhanden Untersuchungsberichte, die die erste SNP Citrullus und der ersten Karte Karten mit zwei Elite-Eltern gebaut. Wir berichten auch den ersten Stall, dem, den Obst-Gr&ouml;&szlig;e und Form in Citrullus Lanatus QTL zugeordnet. Diese Karten, QTL und SNPs sollte n&uuml;tzlich sein f&uuml;r die Wassermelone-Gemeinschaft und einen wesentlichen Baustein f&uuml;r die m&ouml;gliche Verwendung von molekularen Instrumente in Wassermelone Zucht darstellen.

Vergleichende Zuordnung in Wassermelone [Citrullus Lanatus (Thunb.) Matsum. et Nakai].

Il primo polimorfismo a singolo nucleotide (SNP) mappe per cocomero [Citrullus lanatus (Thunb.) Matsum. et Nakai] sono stati costruiti e rispetto. Tre popolazioni sono state sviluppate da incroci tra due cultivar d&#39;elite, Klondike nero seminato &times; New Hampshire Midget (KBS &times; NHM), una cultivar d&#39;Elita e adesione egusi selvaggio, II ceppo &times; PI 560023 (SII &times; Egusi) e una cultivar d&#39;Elita e un&#39;adesione di cedro selvatico, &times; ZWRM50 PI 244019 (ZWRM &times; Citroides). Le popolazioni di Citroides f &times; &times; Egusi e ZWRM SII consistevano di 187 e 182 individui rispettivamente mentre il KBS &times; NHM linea inbred ricombinante (RIL) popolazione &egrave; costituita da 164 linee. La lunghezza delle mappe genetico sono stati 1.438, 1.514 e 1.144 cM con distanze indicatore medio di 3,8 4,2 e 3,4 cM &times; KBS NHM, SII &times; Egusi e popolazioni di Citroides &times; ZWRM, rispettivamente. Marcatori condivisi sono stati utilizzati per allineare le tre mappe, in modo che i gruppi di collegamento (LGs) rappresentato l&#39;11 cromosomi della specie. Distorsione di segregazione di marcatori sono stati osservati in tutte e tre le popolazioni, ma era pi&ugrave; alto (12,7%) nella ZWRM &times; Citroides popolazione, dove sono stati favoriti Citroides alleli. Le tre mappe sono state utilizzate per costruire una consenso mappa contenente 378 marcatori SNP con una distanza media di 5,1 cM tra i marcatori. Dati fenotipici &egrave; stato raccolti per peso frutta (FWT), lunghezza frutta (FL), larghezza di frutta (FWD), indice di forma del frutto (FSI), spessore cotenna (RTH) e Brix (BRX) e analizzati per loci tratto quantitativo (QTL) associati a questi tratti. Un totale di 40 QTL sono stati identificati in tre popolazioni, tra cui importanti QTL per frutta dimensioni e forma che erano stabili attraverso ambienti e background genetico. I presente studio rapporti il primo SNP mappe per Citrullus e la prima mappa costruito utilizzando due genitori d&#39;eliti. Segnaliamo anche il primo stabile che QTL associati con dimensioni di frutti e forma in Citrullus lanatus. Queste mappe, QTL e SNPs dovrebbero essere utile per la comunit&agrave; di anguria e rappresentano un significativo passo verso l&#39;uso potenziale di strumenti molecolari in allevamento di anguria.

Mappatura comparativa nel cocomero [Citrullus lanatus (Thunb.) Matsum. et Nakai].

&#x6700;&#x521D;&#x306E;&#x5358;&#x4E00;&#x30CC;&#x30AF;&#x30EC;&#x30AA;&#x30C1;&#x30C9;&#x591A;&#x578B; (SNP) &#x30B9;&#x30A4;&#x30AB; [&#x30B9;&#x30A4;&#x30AB;&#x5730;&#x3070;&#x3044;&#x683D;&#x57F9; (&#x306B;&#x3064;&#x3044;&#x3066;) &#x30DE;&#x30C3;&#x30D7;&#x3057;&#x307E;&#x3059;&#x3002;&#x6210;&#x5206;&#x3002;et &#x4E2D;&#x4E95;] &#x69CB;&#x7BC9;&#x3057;&#x3001;&#x6BD4;&#x8F03;&#x3057;&#x307E;&#x3057;&#x305F;&#x3002;3 &#x3064;&#x306E;&#x96C6;&#x56E3;&#x306F;&#x3001;&#x30A8;&#x30EA;&#x30FC;&#x30C8;&#x54C1;&#x7A2E;&#x3001;&#x30AF;&#x30ED;&#x30F3;&#x30C0;&#x30A4;&#x30AF; &#x30D6;&#x30E9;&#x30C3;&#x30AF; &#x30B7;&#x30FC;&#x30C9; &times; &#x30CB;&#x30E5;&#x30FC;&#x30CF;&#x30F3;&#x30D7;&#x30B7;&#x30E3;&#x30FC; &#x30DF;&#x30BC;&#x30C3;&#x30C8; (KBS &times; NHM)&#x3001;&#x30A8;&#x30EA;&#x30FC;&#x30C8;&#x54C1;&#x7A2E;&#x3068;&#x91CE;&#x751F;&#x306E;&#x30B9;&#x30CA;&#x30C3;&#x30D7;&#x3078;&#x306E;&#x52A0;&#x76DF;&#x3001;&#x3072;&#x305A;&#x307F; II &times; PI 560023 (SII &times; &#x30B9;&#x30CA;&#x30C3;&#x30D7;) &#x3068;&#x30A8;&#x30EA;&#x30FC;&#x30C8;&#x306E;&#x54C1;&#x7A2E;&#x3068;&#x91CE;&#x751F;&#x67DA;&#x5B50;&#x52A0;&#x76DF;&#x3001;ZWRM50 &times; PI 244019 &#xFF08;ZWRM &times; Citroides&#xFF09; &#x304B;&#x3089;&#x958B;&#x767A;&#x3055;&#x308C;&#x307E;&#x3057;&#x305F;&#x3002;KBS &times; NHM &#x7D44;&#x63DB;&#x3048;&#x81EA;&#x6B96;&#x7DDA; &#xFF08;RIL&#xFF09; &#x4EBA;&#x53E3;&#x306E; 164 &#x884C;&#x4E2D;&#x305D;&#x308C;&#x305E;&#x308C; 187 182 &#x500B;&#x4EBA;&#x306E; SII &#x30B9;&#x30CA;&#x30C3;&#x30D7;&#x3068; ZWRM &times; Citroides F(2) &#x96C6;&#x56E3;&#x304B;&#x3089;&#x6210;&#x3063;&#x3066;&#x3044;&#x305F;&#x3002;1,438, 1,514 1,144 CM 3.8&#x3001;4.2 &#x3068; 3.4 cM KBS &times; NHM &#x3068; SII &times; &#x30B9;&#x30CA;&#x30C3;&#x30D7; ZWRM &times; Citroides &#x4EBA;&#x53E3;&#x306E;&#x305F;&#x3081;&#x306E;&#x5E73;&#x5747;&#x30DE;&#x30FC;&#x30AB;&#x30FC;&#x9593;&#x306E;&#x8DDD;&#x96E2;&#x3092;&#x305D;&#x308C;&#x305E;&#x308C;&#x907A;&#x4F1D;&#x306E;&#x30DE;&#x30C3;&#x30D7;&#x306E;&#x9577;&#x3055;&#x3067;&#x3042;&#x3063;&#x305F;.&#x5171;&#x6709;&#x30DE;&#x30FC;&#x30AB;&#x30FC;&#x306F;&#x3001;&#x7A2E;&#x306E; 11 &#x306E;&#x67D3;&#x8272;&#x4F53;&#x9023;&#x9396;&#x7FA4; (LGs) &#x8868;&#x3055;&#x308C;&#x308B; 3 &#x3064;&#x306E;&#x30DE;&#x30C3;&#x30D7;&#x3092;&#x914D;&#x7F6E;&#x306B;&#x4F7F;&#x7528;&#x3055;&#x308C;&#x307E;&#x3057;&#x305F;&#x3002;&#x30DE;&#x30FC;&#x30AB;&#x30FC;&#x306E;&#x5206;&#x96E2;&#x306E;&#x6B6A;&#x307F;&#x3059;&#x3079;&#x3066;&#x306E; 3 &#x3064;&#x306E;&#x96C6;&#x56E3;&#x3067;&#x89B3;&#x5BDF;&#x3055;&#x308C;&#x305F;&#x304C;&#x3001;ZWRM &times; Citroides &#x306E;&#x5BFE;&#x7ACB;&#x907A;&#x4F1D;&#x5B50;&#x304C;&#x597D;&#x307E;&#x308C;&#x3066;&#x3001;Citroides &#x306E;&#x4EBA;&#x53E3;&#x306F;&#x6700;&#x9AD8; (12.7 &#xFF05;&#xFF09; &#x3060;&#x3063;&#x305F;&#x3002;3 &#x3064;&#x306E;&#x30DE;&#x30C3;&#x30D7;&#x306F;&#x3001;378 &#x306E; SNP &#x30DE;&#x30FC;&#x30AB;&#x30FC;&#x3001;5.1 cM &#x30DE;&#x30FC;&#x30AB;&#x30FC;&#x306E;&#x9593;&#x306E;&#x5E73;&#x5747;&#x8DDD;&#x96E2;&#x3068;&#x3092;&#x542B;&#x3080;&#x30B3;&#x30F3;&#x30BB;&#x30F3;&#x30B5;&#x30B9; &#x30DE;&#x30C3;&#x30D7;&#x306E;&#x69CB;&#x7BC9;&#x306B;&#x4F7F;&#x7528;&#x3055;&#x308C;&#x307E;&#x3057;&#x305F;&#x3002;&#x8868;&#x73FE;&#x578B;&#x30C7;&#x30FC;&#x30BF;&#x306F;&#x679C;&#x5B9F;&#x91CD; (FWT)&#x3001;&#x30D5;&#x30EB;&#x30FC;&#x30C4;&#x306E;&#x9577;&#x3055; &#xFF08;&#x30D5;&#x30ED;&#x30EA;&#x30C0;&#x5DDE;&#xFF09;&#x3001;&#x30D5;&#x30EB;&#x30FC;&#x30C4;&#x5E45; (FWD)&#x3001;&#x30D5;&#x30EB;&#x30FC;&#x30C4;&#x5F62;&#x72B6;&#x6307;&#x6570; &#xFF08;FSI&#xFF09;&#x3001;&#x76AE;&#x819C;&#x306E;&#x539A;&#x3055; &#xFF08;RTH) &#x3084;&#x7CD6;&#x5EA6; (BRX) &#x306E;&#x305F;&#x3081;&#x306B;&#x53CE;&#x96C6;&#x3055;&#x308C;&#x305F;&#x3001;&#x3053;&#x308C;&#x3089;&#x306E;&#x7279;&#x6027;&#x306B;&#x95A2;&#x9023;&#x4ED8;&#x3051;&#x3089;&#x308C;&#x3066;&#x3044;&#x308B;&#x91CF;&#x7684;&#x5F62;&#x8CEA;&#x907A;&#x4F1D;&#x5B50;&#x5EA7; (QTL) &#x306E;&#x5206;&#x6790;&#x3092;&#x884C;&#x3063;&#x305F;&#x3002;&#x679C;&#x5B9F;&#x306E;&#x5927;&#x304D;&#x3055;&#x3084;&#x907A;&#x4F1D;&#x7684;&#x80CC;&#x666F;&#x3084;&#x74B0;&#x5883;&#x3067;&#x5B89;&#x5B9A;&#x3057;&#x305F;&#x5F62;&#x306E;&#x4E3B;&#x8981;&#x306A; QTL &#x3092;&#x542B;&#x3080; 3 &#x3064;&#x306E;&#x96C6;&#x56E3;&#x3001;40 QTL &#x306E;&#x5408;&#x8A08;&#x304C;&#x7279;&#x5B9A;&#x3057;&#x307E;&#x3059;&#x3002;&#x6700;&#x521D;&#x306E; SNP &#x30DE;&#x30C3;&#x30D7; &#x30B9;&#x30A4;&#x30AB;&#x3068;&#x306E;&#x6700;&#x521D;&#x306E;&#x30DE;&#x30C3;&#x30D7;&#x306E;&#x5B58;&#x5728;&#x306E;&#x7814;&#x7A76;&#x30EC;&#x30DD;&#x30FC;&#x30C8;&#x306F;&#x3001;&#x30A8;&#x30EA;&#x30FC;&#x30C8;&#x306E; 2 &#x3064;&#x306E;&#x4E21;&#x89AA;&#x3092;&#x4F7F;&#x7528;&#x3057;&#x3066;&#x69CB;&#x7BC9;&#x3002;&#x679C;&#x5B9F;&#x306E;&#x5927;&#x304D;&#x3055;&#x3068;&#x5F62;&#x306B;&#x30B9;&#x30A4;&#x30AB;&#x5730;&#x3070;&#x3044;&#x683D;&#x57F9;&#x306B;&#x304A;&#x3051;&#x308B; QTL &#x306B;&#x95A2;&#x9023;&#x4ED8;&#x3051;&#x3089;&#x308C;&#x3066;&#x3044;&#x308B;&#x6700;&#x521D;&#x306E;&#x5B89;&#x5B9A;&#x3082;&#x5831;&#x544A;&#x3059;&#x308B;.&#x3053;&#x308C;&#x3089;&#x306E;&#x30DE;&#x30C3;&#x30D7;&#x306F;&#x3001;QTL &#x3068; SNPs &#x306F;&#x30B9;&#x30A4;&#x30AB; &#x30B3;&#x30DF;&#x30E5;&#x30CB;&#x30C6;&#x30A3;&#x306B;&#x3068;&#x3063;&#x3066;&#x6709;&#x7528;&#x3057;&#x3001;&#x30B9;&#x30A4;&#x30AB;&#x80B2;&#x7A2E;&#x306B;&#x304A;&#x3051;&#x308B;&#x5206;&#x5B50;&#x30C4;&#x30FC;&#x30EB;&#x306E;&#x6F5C;&#x5728;&#x7684;&#x306A;&#x4F7F;&#x7528;&#x3078;&#x306E;&#x91CD;&#x8981;&#x306A;&#x4E00;&#x6B69;&#x3092;&#x8868;&#x3057;&#x3066;&#x304F;&#x3060;&#x3055;&#x3044;&#x3002;

&#x30B9;&#x30A4;&#x30AB; [&#x30B9;&#x30A4;&#x30AB;&#x5730;&#x3070;&#x3044;&#x683D;&#x57F9;&#x306B;&#x304A;&#x3051;&#x308B; &#xFF08;&#x306B;&#x3064;&#x3044;&#x3066;&#xFF09; &#x306E;&#x6BD4;&#x8F03;&#x30DE;&#x30C3;&#x30D4;&#x30F3;&#x30B0;&#x6210;&#x5206;&#x3002;et &#x4E2D;&#x4E95;]&#x3002;

&#xC218; &#xBC15; [Citrullus lanatus (Thunb.)&#xC5D0; &#xB300; &#xD55C; &#xCCAB; &#xBC88;&#xC9F8; &#xB2E8;&#xC77C; &#xC5FC;&#xAE30; &#xB2E4;&#xD615;&#xC131; (SNP) &#xC9C0;&#xB3C4; Matsum&#xC785;&#xB2C8;&#xB2E4;. &#xB3D9;&#xBD80; &#xD45C;&#xC900;&#xC2DC; &#xB098;&#xCE74;&#xC774;] &#xB418; &#xACE0; &#xBE44;&#xAD50; &#xD588;&#xB2E4;. 3 &#xC778;&#xAD6C; &#xB450; &#xC5D8;&#xB9AC;&#xD2B8; cultivars, &#xD074;&#xB860; &#xB2E4;&#xC774;&#xD06C; &#xBE14;&#xB799; &#xC2DC;&#xB4DC; &times; &#xB274; &#xD584;&#xD504;&#xC154; &#xB09C;&#xC7C1;&#xC774; (KBS &times; NHM), &#xC5D8;&#xB9AC;&#xD2B8; &#xD488;&#xC885; &#xBC0F; &#xC57C;&#xC0DD; egusi &#xC7AC;&#xC0B0; &#xAC00;&#xCE58;, &#xC2A4;&#xD2B8;&#xB808;&#xC778; II &times; PI 560023 (SII &times; Egusi)&#xC640; &#xC5D8;&#xB9AC;&#xD2B8; &#xD488;&#xC885; &#xBC0F; &#xC57C;&#xC0DD; &#xC720;&#xC790; &#xC7AC;&#xC0B0; &#xAC00;&#xCE58;, ZWRM50 &times; PI 244019 (ZWRM &times; Citroides) &#xC0AC;&#xC774;&#xC758; &#xC2ED;&#xC790;&#xAC00;&#xC5D0;&#xC11C; &#xAC1C;&#xBC1C; &#xB418;&#xC5C8;&#xB2E4;. SII &times; &#xC218;&#xC794;&#xACFC; ZWRM &times; Citroides F(2) &#xC778;&#xAD6C; &#xAC01;&#xAC01; KBS &times; NHM &#xC7AC;&#xC870;&#xD569; &#xD0C0;&#xACE0; &#xB09C;&#xB41C; &#xC120; (RIL) &#xC778;&#xAD6C; 164 &#xB77C;&#xC778;&#xC758; &#xAD6C;&#xC131; &#xD558;&#xB294; &#xB3D9;&#xC548; 187 182 &#xAC1C;&#xC778;&#xC758; &#xAD6C;&#xC131;. &#xC720;&#xC804;&#xC790; &#xC9C0;&#xB3C4;&#xC758; &#xAE38;&#xC774; 3.8, 4.2, KBS &times; NHM SII &times; Egusi, ZWRM &times; Citroides &#xC778;&#xAD6C; 3.4 &#x339D;&#xC758; &#xAC70;&#xB9AC; &#xD3C9;&#xADE0; &#xB9C8;&#xCEE4; 1438, 1,514 &#xBC0F; 1144 Cm&#xB97C; &#xAC01;&#xAC01; &#xAE30;&#xB85D; &#xD588;&#xB2E4;. &#xACF5;&#xC720; &#xB9C8;&#xCEE4; &#xC5F0;&#xB3D9; &#xADF8;&#xB8F9; (LGs) &#xC885; 11 &#xC5FC;&#xC0C9;&#xCCB4; &#xD45C;&#xD604; &#xB420; 3 &#xAC1C;&#xC758; &#xC9C0;&#xB3C4; &#xC815;&#xB82C; &#xC0AC;&#xC6A9; &#xD588;&#xB2E4;. &#xB9C8;&#xCEE4; &#xBD84;&#xB9AC; &#xC65C;&#xACE1; ZWRM &times; Citroides &#xB300;&#xB9BD; &#xC120;&#xD638; &#xD588;&#xB2E4; Citroides &#xC778;&#xAD6C;&#xC5D0;&#xC11C;&#xC5D0;&#xC11C; &#xAC00;&#xC7A5; &#xB192;&#xC740; (12.7%)&#xB97C; &#xD588;&#xC9C0;&#xB9CC; &#xBAA8;&#xB4E0; &#xC138; &#xC778;&#xAD6C;&#xC5D0;&#xC11C; &#xAD00;&#xCC30; &#xB418;&#xC5C8;&#xB2E4;. 3 &#xC9C0;&#xB3C4; &#xB9C8;&#xCEE4; &#xC0AC;&#xC774; 5.1 c M&#xC758; &#xD3C9;&#xADE0; &#xAC70;&#xB9AC;&#xC640; 378 SNP &#xB9C8;&#xCEE4;&#xB97C; &#xD3EC;&#xD568; &#xD558;&#xB294; &#xD569;&#xC758; &#xC9C0;&#xB3C4; &#xC0DD;&#xC131; &#xC0AC;&#xC6A9; &#xD588;&#xB2E4;. Phenotypic &#xB370;&#xC774;&#xD130; &#xACFC;&#xC77C; &#xBB34;&#xAC8C; (FWT), &#xC5F4;&#xB9E4; &#xAE38;&#xC774; (&#xD50C;&#xB85C;&#xB9AC;&#xB2E4;), &#xACFC;&#xC77C; &#xD3ED; (FWD), &#xACFC;&#xC77C; &#xBAA8;&#xC591; &#xC778;&#xB371;&#xC2A4; (FSI), &#xAECD;&#xC9C8; &#xB450;&#xAED8; (&#xC0DD;)&#xC640; &#xBE0C;&#xB9AD;&#xC2A4; (BRX)&#xC5D0; &#xB300; &#xD55C; &#xC218;&#xC9D1; &#xB418;&#xC5C8;&#xACE0;, &#xC591;&#xC801; &#xD2B9;&#xC131;&#xC774; loci (QTL) &#xAD00;&#xB828; &#xB41C; &#xC774;&#xB7EC;&#xD55C; &#xD2B9;&#xC131;&#xC5D0; &#xB300; &#xD55C; &#xBD84;&#xC11D;. &#xCD1D; 40 QTL &#xACFC;&#xC77C; &#xD06C;&#xAE30;&#xC640; &#xC720;&#xC804; &#xBC30;&#xACBD;&#xACFC; &#xD658;&#xACBD;&#xC5D0; &#xAC78;&#xCCD0; &#xC548;&#xC815; &#xB41C; &#xBAA8;&#xC591;&#xC5D0; &#xB300; &#xD55C; &#xC8FC;&#xC694; QTL&#xC744; &#xD3EC;&#xD568; &#xD558; &#xC5EC; &#xC138; &#xC778;&#xAD6C;&#xC5D0;&#xC11C; &#xD655;&#xC778; &#xB418;&#xC5C8;&#xB2E4;. &#xCCAB; &#xBC88;&#xC9F8; SNP &#xC9C0;&#xB3C4; Citrullus&#xC640; &#xCCAB; &#xBC88;&#xC9F8; &#xC9C0;&#xB3C4; &#xD604;&#xC7AC; &#xC5F0;&#xAD6C; &#xBCF4;&#xACE0;&#xC11C; &#xB450; &#xC5D8;&#xB9AC;&#xD2B8; &#xBD80;&#xBAA8;&#xB97C; &#xC0AC;&#xC6A9; &#xD558; &#xC5EC; &#xAD6C;&#xC131;. &#xC6B0;&#xB9AC;&#xB294; &#xB610;&#xD55C; &#xCCAB; &#xBC88;&#xC9F8; &#xC548;&#xC815; QTL &#xACFC;&#xC77C; &#xD06C;&#xAE30;&#xC640; &#xBAA8;&#xC591;&#xC5D0; Citrullus lanatus&#xC640; &#xAD00;&#xB828; &#xB41C; &#xBCF4;&#xACE0; &#xD569;&#xB2C8;&#xB2E4;. QTL &#xBC0F; Snp&#xC774;&#xC774; &#xC9C0;&#xB3C4; &#xC218; &#xBC15; &#xCEE4;&#xBBA4;&#xB2C8;&#xD2F0;&#xC5D0; &#xB300; &#xD55C; &#xC720;&#xC6A9; &#xD558; &#xACE0; &#xC218; &#xBC15; &#xBC88; &#xC2DD;&#xC5D0;&#xC11C; &#xBD84;&#xC790; &#xB3C4;&#xAD6C; &#xC0AC;&#xC6A9; &#xAC00;&#xB2A5;&#xC131;&#xC744; &#xD5A5;&#xD55C; &#xC911;&#xC694; &#xD55C; &#xB2E8;&#xACC4;&#xB97C; &#xB300;&#xD45C; &#xD574;&#xC57C; &#xD569;&#xB2C8;&#xB2E4;.

&#xC218; &#xBC15; [Citrullus lanatus (Thunb.) &#xBE44;&#xAD50; &#xB9E4;&#xD551; Matsum&#xC785;&#xB2C8;&#xB2E4;. &#xB3D9;&#xBD80; &#xD45C;&#xC900;&#xC2DC; &#xB098;&#xCE74;&#xC774;].

El primer polimorfismo de nucle&oacute;tido simple (SNP) todos los mapas de sand&iacute;a [Citrullus lanatus (Thunb.) Matsum. et Nakai] fueron construidos y comparadas. Tres poblaciones fueron desarrolladas a partir de cruces entre dos cultivares de &eacute;lite, Klondike negro sembradas &times; Midget de New Hampshire (KBS &times; NHM), una &eacute;lite cultivar y adhesi&oacute;n egusi salvaje, cepa II &times; PI 560023 (SII &times; Egusi) y un cultivar de &eacute;lite y una adhesi&oacute;n de citron salvaje, ZWRM50 &times; 244019 de PI (ZWRM &times; Citroides). Las poblaciones de Citroides f &times; &times; Egusi y ZWRM SII consisti&oacute; en 187 y 182 personas respectivamente mientras que la poblaci&oacute;n de la l&iacute;nea consangu&iacute;nea recombinante (RIL) KBS &times; NHM consisti&oacute; en 164 l&iacute;neas. La longitud de los mapas gen&eacute;ticos fueron 1.438, 1.514 y 1.144 cM con distancias de marcador promedio de 3,8 y 4,2 3,4 cM &times; KBS NHM, SII &times; Egusi y poblaciones de ZWRM &times; Citroides, respectivamente. Se utilizaron marcadores compartidos para alinear los tres mapas para que los grupos de ligamiento (LGs) represent&oacute; los 11 cromosomas de la especie. Distorsi&oacute;n de segregaci&oacute;n de marcador fueron observados en todas las poblaciones de tres, pero fue m&aacute;s alto (12,7%) en el ZWRM &times; Citroides poblaci&oacute;n, donde fueron favorecidos los alelos Citroides. Los tres mapas fueron utilizados para construir un mapa de consenso que contiene 378 marcadores SNP con una distancia promedio de 5,1 cM entre los marcadores. Datos fenot&iacute;picos fue recogidos por el peso de la fruta (FWT), longitud de fruto (FL), ancho de fruto (FWD), &iacute;ndice de forma de fruta (FSI), espesor de la corteza (RTH) y Brix (BRX) y analizan para loci de rasgos cuantitativos (QTL) asociados con estas caracter&iacute;sticas. Se identificaron un total de 40 QTL en las tres poblaciones, incluyendo importante QTL para fruta tama&ntilde;o y forma que fueron estables en todos los ambientes y fondos gen&eacute;ticos. El presente estudio reporta el SNP primero mapas para Citrullus y el primer mapa construido usando dos padres de &eacute;lite. Tambi&eacute;n Divulgamos el primer establo que QTL asociado con el tama&ntilde;o de la fruta y la forma en Citrullus lanatus. Estos mapas, QTL y SNP deben ser &uacute;til para la comunidad de sand&iacute;a y representa un paso significativo hacia el potencial uso de herramientas moleculares en el cultivo de la sand&iacute;a.

Mapeo comparativo en sand&iacute;a [Citrullus lanatus (Thunb.) Matsum. et Nakai].

Modern watermelon (Citrullus lanatus L.) cultivars share a narrow genetic base due to many years of selection for desirable horticultural qualities. Wild subspecies within C. lanatus are important potential sources of novel alleles for watermelon breeding, but successful trait introgression into elite cultivars has had limited success. The application of marker assisted selection (MAS) in watermelon is yet to be realized, mainly due to the past lack of high quality genetic maps. Recently, a number of useful maps have become available, however these maps have few common markers, and were constructed using different marker sets, thus, making integration and comparative analysis among maps difficult. The objective of this research was to use single-nucleotide polymorphism (SNP) anchor markers to construct an integrated genetic map for C. lanatus.

An integrated genetic map based on four mapping populations and quantitative trait loci associated with economically important traits in watermelon (Citrullus lanatus).

Years of selection for desirable fruit quality traits in dessert watermelon (Citrullus lanatus) has resulted in a narrow genetic base in modern cultivars. Development of novel genomic and genetic resources offers great potential to expand genetic diversity and improve important traits in watermelon. Here, we report a high-quality genome sequence of watermelon cultivar 'Charleston Gray', a principal American dessert watermelon, to complement the existing reference genome from '97103', an East Asian cultivar. Comparative analyses between genomes of 'Charleston Gray' and '97103' revealed genomic variants that may underlie phenotypic differences between the two cultivars. We then genotyped 1365 watermelon plant introduction (PI) lines maintained at the U.S. National Plant Germplasm System using genotyping-by-sequencing (GBS). These PI lines were collected throughout the world and belong to three Citrullus species, C. lanatus, C. mucosospermus and C. amarus. Approximately 25 000 high-quality single nucleotide polymorphisms (SNPs) were derived from the GBS data using the 'Charleston Gray' genome as the reference. Population genomic analyses using these SNPs discovered a close relationship between C. lanatus and C. mucosospermus and identified four major groups in these two species correlated to their geographic locations. Citrullus amarus was found to have a distinct genetic makeup compared to C. lanatus and C. mucosospermus. The SNPs also enabled identification of genomic regions associated with important fruit quality and disease resistance traits through genome-wide association studies. The high-quality 'Charleston Gray' genome and the genotyping data of this large collection of watermelon accessions provide valuable resources for facilitating watermelon research, breeding and improvement.

Genome of 'Charleston Gray', the principal American watermelon cultivar, and genetic characterization of 1,365 accessions in the U.S. National Plant Germplasm System watermelon collection.

Different species of edible seed watermelons ( spp.) are cultivated in Asia and Africa for their colorful nutritious seeds. Consumer preference varies for watermelon seed coat color. Therefore, it is an important consideration for watermelon breeders. In 1940s, a genetic model of four genes, , ,  and , was proposed to elucidate the inheritance of seed coat color in watermelon. In this study, we developed three segregating F populations: Sugar Baby (dotted black seed, ) × plant introduction (PI) 482379 (green seed, ), Charleston Gray (dotted black seed, ) × PI 189225 (red seed, ), and Charleston Gray (dotted black seed, ) × UGA147 (clump seed, ) to re-examine the four-gene model and to map the four genes. In the dotted black × green population, the dotted black seed coat color () is dominant to green seed coat color (). In the dotted black × red population, the dominant dotted black seed coat color and the recessive red seed coat color segregate for the  and  genes, where the  gene is dominantly epistatic to the  gene. However, the inheritance of the  locus did not fit the four-gene model, thus we named it  . In the dotted black × clump population, the clump seed coat color and the dotted black seed coat color segregate for  and , where  is recessively epistatic to . The ,  , , and  loci were mapped on chromosomes 3, 5, 6, and 8, respectively, using QTL-seq and genotyping-by-sequencing (GBS). Kompetitive Allele Specific PCR (KASP™) assays and SNP markers linked to the four loci were developed to facilitate maker-assisted selection (MAS) for watermelon seed coat color.

Chromosomal Locations and Interactions of Four Loci Associated With Seed Coat Color in Watermelon.

Cultivated watermelon (Citrullus lanatus) is one of the most important food crops in the Cucurbitaceae family. Diversification after domestication has led cultivated watermelons to exhibit diverse fruit flesh colors, including red, yellow, and orange. Recently, there has been increased interest in red-fleshed watermelons because they contain the antioxidant cis-isomeric lycopene. We performed whole genome resequencing (WGRS) of 24 watermelons with different flesh colors to identify single-nucleotide polymorphisms (SNPs) related to high lycopene content. The resequencing data revealed 203,894-279,412 SNPs from read mapping between inbred lines and the 97103 reference genome. In total, 295,065 filtered SNPs were identified, which had an average polymorphism information content of 0.297. Most of these SNPs were intergenic (90.1%) and possessed a transversion (Tv) rate of 31.64%. Overall, 2,369 SNPs were chosen at 0.5 Mb physical intervals to analyze genetic diversity across the 24 inbred lines. A neighbor-joining dendrogram and principal coordinate analysis (PCA) based on the 2,369 SNPs revealed that the 24 inbred lines could be grouped into high and low lycopene-type watermelons. In addition, we analyzed SNPs that could discriminate high lycopene content, red-fleshed watermelon from low lycopene, yellow or orange watermelon inbred lines. For validation, 19 SNPs (designated as WMHL1-19) were chosen randomly, and cleavage amplified polymorphic sequence (CAPS) markers were designed. Genotyping of the above 24 lines and 12 additional commercial cultivars using WMHL1-19 CAPS markers resulted in match rates of over 0.92 for most validated markers in correlation with the flesh color phenotypes. Our results provide valuable genomic information regarding the high lycopene content phenotype of red-fleshed cultivated watermelons, and the identified SNPs will be useful for the development of molecular markers in the marker-assisted breeding of watermelons with high lycopene content.

Whole genome resequencing of watermelons to identify single nucleotide polymorphisms related to flesh color and lycopene content.

The Cucurbitaceae family hosts many economically important fruit vegetables (cucurbits) such as cucumber, melon, watermelon, pumpkin/squash, and various gourds. The cucurbits are probably best known for the diverse fruit sizes and shapes, but little is known about their genetic basis and molecular regulation. Here, we reviewed the literature on fruit size (FS), shape (FSI), and fruit weight (FW) QTL identified in cucumber, melon, and watermelon, from which 150 consensus QTL for these traits were inferred. Genome-wide survey of the three cucurbit genomes identified 253 homologs of eight classes of fruit or grain size/weight-related genes cloned in Arabidopsis, tomato, and rice that encode proteins containing the characteristic CNR (cell number regulator), CSR (cell size regulator), CYP78A (cytochrome P450), SUN, OVATE, TRM (TONNEAU1 Recruiting Motif), YABBY, and WOX domains. Alignment of the consensus QTL with candidate gene homologs revealed widespread structure and function conservation of fruit size/shape gene homologs in cucurbits, which was exemplified with the fruit size/shape candidate genes CsSUN25-26-27a and CsTRM5 in cucumber, CmOFP1a in melon, and ClSUN25-26-27a in watermelon. In cucurbits, the andromonoecy (for 1-aminocyclopropane-1-carboxylate synthase) and the carpel number (for CLAVATA3) loci are known to have pleiotropic effects on fruit shape, which may complicate identification of fruit size/shape candidate genes in these regions. The present work illustrates the power of comparative analysis in understanding the genetic architecture of fruit size/shape variation, which may facilitate QTL mapping and cloning for fruit size-related traits in cucurbits. The limitations and perspectives of this approach are also discussed.

Genetic architecture of fruit size and shape variation in cucurbits: a comparative perspective.

Watermelon () is an economically important fruit crop grown for consumption of its large edible fruit flesh.  (PPR) encoding genes, one of the large gene families in plants, are important RNA-binding proteins involved in the regulation of plant growth and development by influencing the expression of organellar mRNA transcripts. However, systematic information regarding the PPR gene family in watermelon remains largely unknown. In this comprehensive study, we identified and characterized a total of 422  PPR () genes in the watermelon genome. Most  were intronless and were mapped across 12 chromosomes. Phylogenetic analysis showed that  proteins could be divided into P and PLS subfamilies. Gene duplication analysis suggested that 11 pairs of segmentally duplicated genes existed. In-silico expression pattern analysis demonstrated that  may participate in the regulation of fruit development and ripening processes. Genotyping of 70 lines using 4 single nucleotide polymorphisms (SNPs) from 4  resulted in match rates of over 0.87 for each validated SNPs in correlation with the unique phenotypes of flesh color, and could be used in differentiating red, yellow, or orange watermelons in breeding programs. Our results provide significant insights for a comprehensive understanding of  genes and recommend further studies on their roles in watermelon fruit growth and ripening, which could be utilized for cultivar development of watermelon.

A Genome-Wide Analysis of the  (PPR) Gene Family and PPR-Derived Markers for Flesh Color in Watermelon ().

We identified QTLs associated with gummy stem blight resistance in an interspecific F Citrullus population and developed marker assays for selection of the loci in watermelon. Gummy stem blight (GSB), caused by three Stagonosporopsis spp., is a devastating fungal disease of watermelon (Citrullus lanatus) and other cucurbits that can lead to severe yield losses. Currently, no commercial cultivars with genetic resistance to GSB in the field have been reported. Utilizing GSB-resistant cultivars would reduce yield losses, decrease the high cost of disease control, and diminish hazards resulting from frequent fungicide application. The objective of this study was to identify quantitative trait loci (QTLs) associated with GSB resistance in an F interspecific Citrullus mapping population (N = 178), derived from a cross between Crimson Sweet (C. lanatus) and GSB-resistant PI 482276 (C. amarus). The population was phenotyped by inoculating seedlings with Stagonosporopsis citrulli 12178A in the greenhouse in two separate experiments, each with three replications. We identified three QTLs (ClGSB3.1, ClGSB5.1 and ClGSB7.1) associated with GSB resistance, explaining between 6.4 and 21.1% of the phenotypic variation. The genes underlying ClGSB5.1 includes an NBS-LRR gene (ClCG05G019540) previously identified as a candidate gene for GSB resistance in watermelon. Locus ClGSB7.1 accounted for the highest phenotypic variation and harbors twenty-two candidate genes associated with disease resistance. Among them is ClCG07G013230, encoding an Avr9/Cf-9 rapidly elicited disease resistance protein, which contains a non-synonymous point mutation in the DUF761 domain that was significantly associated with GSB resistance. High throughput markers were developed for selection of ClGSB5.1 and ClGSB7.1. Our findings will facilitate the use of molecular markers for efficient introgression of the resistance loci and development of GSB-resistant watermelon cultivars.

QTL associated with gummy stem blight resistance in watermelon.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by the sweet potato whitefly () have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples ( = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA.

The Cucurbitaceae family provides numerous important crops including watermelons (), melons (), cucumbers (), and pumpkins and squashes ( spp.). Centers of domestication in Africa, Asia, and the Americas were followed by distribution throughout the world and the evolution of secondary centers of diversity. Each of these crops is challenged by multiple fungal, oomycete, bacterial, and viral diseases and insects that vector disease and cause feeding damage. Cultivated varieties are constrained by market demands, the necessity for climatic adaptations, domestication bottlenecks, and in most cases, limited capacity for interspecific hybridization, creating narrow genetic bases for crop improvement. This analysis of crop vulnerabilities examines the four major cucurbit crops, their uses, challenges, and genetic resources. ex situ germplasm banks, the primary strategy to preserve genetic diversity, have been extensively utilized by cucurbit breeders, especially for resistances to biotic and abiotic stresses. Recent genomic efforts have documented genetic diversity, population structure, and genetic relationships among accessions within collections. Collection size and accessibility are impacted by historical collections, current ability to collect, and ability to store and maintain collections. The biology of cucurbits, with insect-pollinated, outcrossing plants, and large, spreading vines, pose additional challenges for regeneration and maintenance. Our ability to address ongoing and future cucurbit crop vulnerabilities will require a combination of investment, agricultural, and conservation policies, and technological advances to facilitate collection, preservation, and access to critical Cucurbitaceae diversity.

Cecilia McGregor

Department of Horticulture

University of Georgia

A Contrast of Three Inoculation Techniques used to Determine the Race of Unknown Fusarium oxysporum f.sp. niveum Isolates

Cecilia McGregor

.css-o250i3{font-size:18px;font-family:Open Sans,sans-serif;line-height:21.6px;}Department of Horticulture

University of Georgia

A Contrast of Three Inoculation Techniques used to Determine the Race of Unknown Fusarium oxysporum f.sp. niveum Isolates

Department of Horticulture