transfecting primary macrophages with modified mrna

Transfecting Primary Macrophages with Modified mRNA

Prepare for transfection by adding the pre-calculated volume of mRNA transfection buffer minus the volumes of mRNA transfection reagent and the mRNA to a reaction tube. Thaw the mRNA stock and mix it gently by flipping the tube. Then, add the pre-calculated volume of mRNA to the reaction tube.
Vortex and spin down the reaction mix and the mRNA transfection reagent, then add the appropriate volume of the mRNA transfection reagent to the reaction mix tube. Vortex the tube, and spin it down, then incubate it at room temperature for 15 minutes. Meanwhile, replace the culture medium of the macrophages with fresh, warm culture medium.
Once incubation of the transfection mix is complete, add the mix to the plate wells containing the macrophages dropwise and in a circle from the outside to the middle of the well. To ensure uniform distribution of the transfection mix, gently rock the plate in a vertical and horizontal direction.
Then incubate the plate at 37 degrees Celsius and 5% carbon dioxide for at least six hours. After the incubation, analyze transfection efficiency with fluorescence microscopy, flow cytometry, or immunoblot.
The most important part of this procedure is to ensure uniform distribution of the transfection mix so that all macrophages come in contact with the same amount of mRNA.

transfecting-primary-macrophages-with-modified-mrna

Research

JoVE Encyclopedia of Experiments

Immunology

Immunotherapy

Cellular Immunotherapy

EoE Sub Articles

eoe sub articles

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>5-methyl-CTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1138S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase</td>
			<td>New England BioLabs</td>
			<td>M0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase reaction buffer (10X)</td>
			<td>New England BioLabs</td>
			<td>B0289</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-NEMO/IKK&#947; antibody</td>
			<td>Invitrogen</td>
			<td>MA1-41046</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>anti-&#946;-actin antibody</td>
			<td>Sigma-Aldrich</td>
			<td>A2228</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Petri dishes 92,16 mm with cams</td>
			<td>Sarstedt</td>
			<td>8,21,473</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>CD11b Microbeads mouse and human</td>
			<td>Miltenyi Biotec</td>
			<td>130-049-601</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA 
			GGGGCAGCCGCCACCATGTCC 
			AATTTACTGACCGTAC-3&#39;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Cre recombinase + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-CTAATCGCCATCTTCCAGCAGG 
			C-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>DNA purification kit: QIAquick PCR purification Kit</td>
			<td>Qiagen</td>
			<td>28104</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-GAAATTAATACGACTCACTATA 
			GGGATCCATCGCCACCATGGTG 
			AGCAAGG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>eGFP + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#180;-TGGTATGGCTGATTA 
			TGATCTAGAGTCG-3&#180;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Fast Digest buffer (10X)</td>
			<td>Thermo Scientific</td>
			<td>B64</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>FastDigest XbaI</td>
			<td>Thermo Scientific</td>
			<td>FD0684</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>High-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase</td>
			<td>New England Biolabs Inc</td>
			<td>M0491S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor forward primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAAATTAATACGACTCACTATA 
			GGGTTGATCTACCATGGACTACA 
			AAGACG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>IKK&#946; + T7-Promotor reverse primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#8242;-GAGGAAGCGAGAGCT-CCATCTG-3&#8242;, stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>in vitro&#160;mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)</td>
			<td>New England BioLabs</td>
			<td>E2060</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>MACS MultiStand</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-303</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>mRNA transfection buffer and reagent: jetMESSENGER</td>
			<td>Polyplus transfection</td>
			<td>409-0001DE</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant IKK&#946; IKK-2S177/181E plasmid</td>
			<td>Addgene</td>
			<td>11105</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Mutant NEMOC54/347A plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pEGFP-N3 plasmid</td>
			<td>Addgene</td>
			<td>62043</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Poly(I:C)</td>
			<td>Calbiochem</td>
			<td>528906</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>pPGK-Cre plasmid</td>
			<td></td>
			<td></td>
			<td>F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Pseudo-UTP (100 mM)</td>
			<td>Jena Biosience</td>
			<td>NU-1139S</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>QuadroMACS Separator</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse CD11b antibody, APC-conjugated</td>
			<td>BioLegend</td>
			<td>101212</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>Rat-anti-mouse F4/80 antibody, PE-conjugated</td>
			<td>eBioscience</td>
			<td>12-4801-82</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>recombinant M-CSF</td>
			<td>Peprotech</td>
			<td>315-02</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>RNA purification kit: MEGAclear transcription clean-up kit</td>
			<td>ThermoFisher Scientific</td>
			<td>AM1908</td>
			<td>stored at 4 &#176;C</td>
		</tr>
		<tr>
			<td>RNAse-degrading surfactant: RnaseZAP</td>
			<td>Sigma-Aldrich</td>
			<td>R2020</td>
			<td>stored at RT</td>
		</tr>
		<tr>
			<td>Ultrapure LPS from E.coli O111:B4</td>
			<td>Invivogen</td>
			<td></td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type IKK&#946; plasmid</td>
			<td>Addgene</td>
			<td>11103</td>
			<td>stored at -20 &#176;C</td>
		</tr>
		<tr>
			<td>Wild type NEMO plasmid</td>
			<td>Addgene</td>
			<td>27268</td>
			<td>stored at -20 &#176;C</td>
		</tr>
	</tbody>
</table>

Source: Herb, M. et al., <a href="https://app.jove.com/v/60143">Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA.</a> J. Vis. Exp. (2019)
This video demonstrates the process of transfecting primary macrophages with modified mRNA encoding green fluorescent protein. These modified mRNAs, designed to reduce immunogenicity and improve its stability, ensure the successful transfection and subsequent expression of green fluorescent proteins, which is confirmed through fluorescence microscopy.

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
...

Begin with a tube containing in vitro transcribed mRNAs that encode green fluorescent proteins.
The mRNA contains modified nucleotides, 5-methyl-cytidine triphosphate, and pseudouridine triphosphate, which prevent immune response and enhance mRNA stability.
The 5&#39;-end of the mRNA is dephosphorylated, preventing its recognition by pattern recognition receptors on macrophages.
Add a cationic lipid-based transfection reagent to the mRNA, facilitating encapsulation of the mRNA through electrostatic interactions and forming a complex.
Introduce the lipid-mRNA complexes into a multi-well plate with adhered mouse-derived primary macrophages and gently agitate for uniform mixing.
The macrophages internalize the mRNA-containing complex into an endosome. Later, the complex fuses with the endosomal membrane, releasing the mRNAs into the cell cytoplasm.
The poly-A tail at the 3&#39;-end stabilizes the mRNA which undergoes protein synthesis to produce green fluorescent proteins.
Under a fluorescence microscope, green fluorescence within the macrophages suggests the successful transfection with modified mRNAs.

37 Views. Trasfezione di macrofagi primari con mRNA modificato

Video: Trasfezione di macrofagi primari con mRNA modificato - Experiment

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive properties of in vitro transcribed (IVT) mRNA. With the help of IVT mRNA, the de novo synthesis of a desired protein can be induced without changing the physiological state of the target cell. Moreover, protein biosynthesis can be precisely controlled due to the transient effect of IVT mRNA.
For the efficient transfection of cells, nanoliposomes (NLps) may represent a safe and efficient delivery vehicle for therapeutic mRNA. This study describes a protocol to generate safe and efficient cationic NLps consisting of DC-cholesterol and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) as a delivery vector for IVT mRNA. NLps having a defined size, a homogeneous distribution, and a high complexation capacity, and can be produced using the dry-film method. Moreover, we present different test systems to analyze their complexation and transfection efficacies using synthetic enhanced green fluorescent protein (eGFP) mRNA, as well as their effect on cell viability. Overall, the presented protocol provides an effective and safe approach for mRNA complexation, which may advance and improve the administration of therapeutic mRNA.

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

Here we describe a protocol for the generation of cationic nanoliposomes, which is based on the dry-film method and can be used for the safe and efficient delivery of in vitro transcribed messenger RNA.

Generazione di nanoliposomi cationici per la consegna efficiente In Vitro di trascritti di RNA messaggero

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive ...

Ricerca

JoVE Journal

Bioingegneria

Testing the In Vitro and In Vivo Efficiency of mRNA-Lipid Nanoparticles Formulated by Microfluidic Mixing

Lipid nanoparticles (LNPs) have attracted widespread attention recently with the successful development of the COVID-19 mRNA vaccines by Moderna and Pfizer/BioNTech. These vaccines have demonstrated the efficacy of mRNA-LNP therapeutics and opened the door for future clinical applications. In mRNA-LNP systems, the LNPs serve as delivery platforms that protect the mRNA cargo from degradation by nucleases and mediate their intracellular delivery. The LNPs are typically composed of four components: an ionizable lipid, a phospholipid, cholesterol, and a lipid-anchored polyethylene glycol (PEG) conjugate (lipid-PEG). Here, LNPs encapsulating mRNA encoding firefly luciferase are formulated by microfluidic mixing of the organic phase containing LNP lipid components and the aqueous phase containing mRNA. These mRNA-LNPs are then tested in vitro to evaluate their transfection efficiency in HepG2 cells using a bioluminescent plate-based assay. Additionally, mRNA-LNPs are evaluated in vivo in C57BL/6 mice following an intravenous injection via the lateral tail vein. Whole-body bioluminescence imaging is performed by using an in vivo imaging system. Representative results are shown for the mRNA-LNP characteristics, their transfection efficiency in HepG2 cells, and the total luminescent flux in C57BL/6 mice.

Testing the In Vitro and In Vivo Efficiency of mRNA-Lipid Nanoparticles Formulated by Microfluidic Mixing

Here, a protocol for formulating lipid nanoparticles (LNPs) that encapsulate mRNA encoding firefly luciferase is presented. These LNPs were tested for their potency in vitro in HepG2 cells and in vivo in C57BL/6 mice.

Test dell'efficienza in vitro e in vivo di nanoparticelle mRNA-lipidi formulate mediante miscelazione microfluidica

Lipid nanoparticles (LNPs) have attracted widespread attention recently with the successful development of the COVID-19 mRNA vaccines by Moderna and ...

Efficient Transfection of In vitro Transcribed mRNA in Cultured Cells Using Peptide-Poloxamine Nanoparticles

In vitro transcribed messenger RNA (mRNA) vaccines have displayed enormous potential in fighting against the coronavirus disease 2019 (COVID-19) pandemic. Efficient and safe delivery systems must be included in the mRNA vaccines due to the fragile properties of mRNA. A self-assembled peptide-poloxamine nanoparticle (PP-sNp) gene delivery system is specifically designed for the pulmonary delivery of nucleic acids and displays promising capabilities in mediating successful mRNA transfection. Here, an improved method for preparing PP-sNp is described to elaborate on how the PP-sNp&#160;encapsulates Metridia luciferase (MetLuc) mRNA and successfully transfects cultured cells. MetLuc-mRNA is obtained by an in vitro transcription process from a linear DNA template. A PP-sNp&#160;is produced by mixing synthetic peptide/poloxamine with mRNA solution using a microfluidic mixer, allowing for the self-assembly of PP-sNp. The charge of PP-sNp&#160;is subsequently evaluated by measuring the zeta potential. Meanwhile, the polydispersity and hydrodynamic size of PP-sNp&#160;nanoparticles are measured using dynamic light scattering. The mRNA/PP-sNp nanoparticles are transfected into cultured cells, and supernatants from the cell culture are assayed for luciferase activity. The representative results demonstrate their capacity for in vitro transfection. This protocol may shed light on developing next-generation mRNA vaccine delivery systems.

Efficient Transfection of In vitro Transcribed mRNA in Cultured Cells Using Peptide-Poloxamine Nanoparticles

A self-assembled peptide-poloxamine nanoparticle (PP-sNp) is developed using a microfluidic mixing device to encapsulate and deliver in vitro transcribed messenger RNA. The described mRNA/PP-sNp could efficiently transfect cultured cells in vitro.

Trasfezione efficiente di mRNA trascritto in vitro in cellule in coltura utilizzando nanoparticelle peptide-poloxamina

In vitro transcribed messenger RNA (mRNA) vaccines have displayed enormous potential in fighting against the coronavirus disease 2019 (COVID-19) pandemic. ...

Transfecting Primary Macrophages with Modified mRNA

Trascrizione

Transfecting Primary Macrophages with Modified mRNA