JoVE 비디오를 활용하시려면 도서관을 통한 기관 구독이 필요합니다. 전체 비디오를 보시려면 로그인하거나 무료 트라이얼을 시작하세요.
In this video, we discuss the quantitative polymerase chain reaction, qPCR, to enumerate T7 bacteriophages through DNA quantification. The fluorescent dye in the PCR mixture binds with the newly synthesized DNA strands and emits fluorescence, which is measured.
1. Prepare qPCR reactions
NOTE: One PCR reaction is for one sample. Each PCR reaction contains 5 µL of qPCR master mix (see materials), 1 µL of 5 µM primer pair mix, 2 µL of H2O, and 2 µL of heat-treated T7 phage sample. For multiple PCR reactions, all the reagents except the phage sample are premixed in one 1.5 mL tube. The volume of each reagent in the premix depends on the number of phage samples for qPCR.
2. qPCR cycling conditions
NOTE: qPCR cycling conditions were set up on the specific qPCR equipment.
Figure 1: Phage sample treatment, qPCR reaction preparation, and qPCR run. DNase I pretreated T7 phage samples were heated at 100° C for 15 min to release the T7 DNA from intact phage particles (A); the qPCR mixture was prepared as described in the protocol. All the preparations were done on ice (A); qPCR equipment and compatible software (B...
Name | Company | Catalog Number | Comments |
Primers for T7 genomic DNA | IDT | F: CCTCTTGGGAGGAAGAGATTTG R: TACGGGTCTCGTAGGACTTAAT | |
T7 Select packaging control DNA | EMD Millipore | 69679-1UG | |
MicroAmp optical 96-well reaction plate | ThermoFisher Scientific | N8010560 | |
qPCR master mix-Power up SYBR Green master mix | Applied biosystems | Applied biosystems | |
MicroAmp optical adhesive film kit | ThermoFisher Scientific | ThermoFisher Scientific | |
UltraPure DNase/RNase-Free Distilled H2O | Invitrogen | 10977015 | |
ViiA7 Real-Time PCR System with Fast 96-Well Block | ThermoFisher Scientific | 4453535 | |
QuantStudio Real-time PCR software | ThermoFisher Scientific | v1.2 |
This article has been published
Video Coming Soon
Source: Peng, X., et al., Quantitative PCR of T7 Bacteriophage from Biopanning. J. Vis. Exp. (2018)
Copyright © 2025 MyJoVE Corporation. 판권 소유