differentiating engineered human induced pluripotent stem cells into functional motor neurons

Differentiating Engineered Human Induced Pluripotent Stem Cells into Functional Motor Neurons

For motor neuron differentiation, dissociate the stably transfected cell cultures with dissociation reagent as demonstrated to allow the cells to be collected in a 15-milliliter tube containing 5 volumes of DMEM/F12 medium. After centrifugation, resuspend the cells in human iPSC medium supplemented with micromolar ROCK inhibitor for counting.
Seed the cells on matrix-coated dishes at a 6.25 x 104 cells per centimeter squared density. For the next two days, replace the supernatants with fresh differentiation medium supplemented with doxycycline.
On day two, change the medium to Neurobasal B27 medium supplemented with gamma-secretase inhibitor, vascular endothelial growth factor receptor inhibitor, and doxycycline. On day five, dissociate the cells as demonstrated, and resuspend the detached cells in 4 milliliters of DMEM/F12 medium for counting.
Pipetting is important for a complete dissociation of the cells.
Freeze an aliquot of the motor neuron progenitors in cell freezing medium according to the manufacturer&#39;s instructions, and collect the rest of the cells by centrifugation. Resuspend the pellet in neuronal medium supplemented with 10 micromolar ROCK inhibitor.
Seed the cells on poly-ornithine laminin-coated microslide supports with polymer coverslips at a 1 x 105 cells per centimeter squared density. On day six, carefully replace the medium with fresh neuronal medium without inhibitor for culture until downstream analysis without detaching the cells from the support surface.

differentiating-engineered-human-induced-pluripotent-stem-cells-into

Research

JoVE Encyclopedia of Experiments

Neuroscience

Neuronal Culture Techniques

Advanced Neuronal Models

EoE Sub Articles

eoe sub articles

1. Maintenance of Human iPSCs
<ol>
	<li>Preparation of matrix-coated plates
	<ol>
		<li>Thaw one 5 mL vial of matrix (see Table of Materials) at 4 &#176;C overnight. The original matrix stocks come at different stock concentrations, and aliquots are made according to the dilution factor indicated on the datasheet and are specific for the individual lot. It is crucial to keep the vial and tubes ice cold to prevent premature gelling of the matrix. Dispense matrix into aliquots in pre-chilled cryotubes on ice. Freeze unused aliquots at -20 &#176;C.</li>
		<li>Place one aliquot on ice for about 2 h to thaw.</li>
		<li>Dilute the aliquot of the matrix with 20 mL of cold DMEM/F12 in a 50 mL conical tube.</li>
		<li>Mix well and dispense 1 mL of diluted matrix into 35 mm dishes (equivalent amounts per surface area of other dishes).</li>
		<li>Keep the dishes containing diluted matrix for 1 h at room temperature to allow coating. 
		NOTE: Dishes, sealed with parafilm, can be stored at 4 &#176;C for up to 2 weeks.</li>
	</ol>
	</li>
	<li>Preparation of the stock solution (20 mL) and 1x working aliquots of the gentle cell dissociation reagent (see Table of Materials).
	<ol>
		<li>Dissolve powder to 10 mg/mL in PBS (Ca2+/Mg2+ free)</li>
		<li>Filter sterilize through a 0.22 &#956;m filter membrane.</li>
		<li>Prepare 20 aliquots (1 mL each) and store them at -20 &#176;C.</li>
		<li>Before use, dilute one aliquot in PBS (Ca2+/Mg2+ free) to 1 mg/mL (1x working aliquots). 
		NOTE: 1x working aliquots can be stored at 4 &#176;C for 2 weeks.</li>
	</ol>
	</li>
	<li>Passaging human iPSCs.
	<ol>
		<li>Before starting: If stored at 4 &#176;C, pre-warm matrix-coated plates in the incubator at 37 &#176;C for 20-30 min. Pre-warm at room temperature the amount of human iPSC medium (see Table of Materials) needed. Pre-warm the DMEM/F12.</li>
		<li>Aspirate culture medium.</li>
		<li>Rinse iPSCs with PBS (Ca2+/Mg2+ free).</li>
		<li>Add 1x gentle dissociation solution (0.5 mL for a 35 mm dish). Incubate at 37 &#176;C until the edges of the colonies begin to detach from the plate, usually 3-5 min.</li>
		<li>Aspirate the gentle dissociation solution, being careful not to detach iPSC colonies.</li>
		<li>Wash the cells with DMEM/F12 (2 mL for a 35 mm dish) and aspirate, being careful not to detach the cells. Repeat this step one more time.</li>
		<li>Add human iPSC medium (1 mL for a 35 mm dish).</li>
		<li>Gently detach the colonies with a cell lifter and transfer them to a 15 mL tube.</li>
		<li>Gently break cell clumps by pipetting up and down with a P1000 pipettor 3-4 times.</li>
		<li>Aspirate the supernatant from the matrix-coated plate(s).</li>
		<li>Seed the cells in the appropriate culture volume of the human iPSC medium. The split ratio can vary from line to line and is about 1:4-1:8. Change the medium daily.&#160;&#160;&#160;</li>
	</ol>
	</li>
</ol>
2. Generation of NIL and NIP Inducible iPSC Lines
<ol>
	<li>Cell transfection
	<ol>
		<li>Rinse the cells with PBS (Ca2+/Mg2+ free).</li>
		<li>Add cell dissociation reagent (see Table of Materials) (0.35 mL for a 35 mm dish) and incubate at 37 &#176;C until single cells are separated (5-10 min).</li>
		<li>Gently complete cell separation by pipetting up and down with a P1000 pipettor 3-4 times.</li>
		<li>Collect in a 15 mL tube and add PBS (Ca2+/Mg2+ free) to 10 mL. Count the cells.</li>
		<li>Pellet 106 cells and resuspend in 100 &#956;l of Buffer R (included in the cell electroporation kit; see Table of Materials).</li>
		<li>Add plasmid DNA for transfection: 4.5 &#956;g of transposable vector (epB-Bsd-TT-NIL or epB-Bsd-TT-NIP12) and 0.5 &#956;g of the piggyBac transposase plasmid.</li>
		<li>Transfect with the cell electroporation system (see Table of Materials) according to the manufacturer&#39;s instructions and as previously described with the following parameters: 1,200 V voltage, 30 ms width, 1 pulse. Seed the cells in a human iPSC medium supplemented with 10 &#956;M Y-27632 (ROCK inhibitor, see Table of Materials) in a 6 mm matrix-coated dish.</li>
	</ol>
	</li>
	<li>Selection with antibiotics
	<ol>
		<li>Two days after transfection, add 5 &#956;g/mL blasticidin to the culture medium.</li>
		<li>Most non-transfected cells will die within 48 h of blasticidin selection. Keep the cells in blasticidin for at least 7-10 days to counter-select the cells that have not integrated the transgenes in the genome.</li>
		<li>Maintain stably transfected cells as a mixed population, composed of cells with different numbers of transgenes and different integration sites, or isolate single clones.</li>
		<li>Prepare an additional dish to check for effective expression of the transgenes upon 1 &#956;g/mL doxycycline induction by RT-PCR with transgene-specific primers for Ngn2 (Forward: TATGCACCTCACCTCCCCATAG; Reverse: GAAGGGAGGAGGGCTCGACT).</li>
		<li>At this stage, freeze stocks of the novel NIL- and NIP-iPSC lines in a freezing medium for human iPSCs (see Table of Materials).</li>
	</ol>
	</li>
</ol>
3. Motor Neuron Differentiation
<ol>
	<li>Dissociate the cells with cell dissociation reagent as described (steps 2.1.1.-2.1.3.). Collect dissociated cells in a 15 mL tube and dilute with 5 volumes of DMEM/F12. Pellet the cells and resuspend in a human iPSC medium supplemented with 10 &#956;M ROCK inhibitor. Count the cells and seed on matrix-coated dishes at a density of 62,500 cells/cm2.</li>
	<li>The following day, replace the medium with DMEM/F12, supplemented with 1x stable L-glutamine analog, 1x non-essential amino acid (NEAA) cell culture supplement and 0.5x penicillin/streptomycin, containing 1 &#956;g/mL doxycycline. This is considered as day 0 of differentiation. On day 1, refresh the medium and doxycycline.</li>
	<li>On day 2, change the medium to Neurobasal/B27 medium (Neurobasal Medium supplemented with 1x B27, 1x stable L-glutamine analog, 1x NEAA and 0.5x penicillin/streptomycin), containing 5 &#956;M DAPT, 4 &#956;M SU5402, and 1 &#956;g/mL doxycycline (see Table of Materials). Refresh the medium and doxycycline every day until day 5.</li>
	<li>Day 5: Cells dissociation with cell dissociation reagent (see Table of Materials).
	<ol>
		<li>Rinse the cells with PBS (Ca2+/Mg2+ free).</li>
		<li>Add cell dissociation reagent (0.35 mL for a 35 mm dish) and incubate at 37 &#176;C until the entire cell monolayer separates from the dish. 
		NOTE that single cells will not be separated during incubation.</li>
		<li>Add 1 mL of DMEM/F12 and collect the cells in a 15 mL tube.</li>
		<li>Gently complete cell separation by pipetting up and down with a P1000 pipettor 10-15 times.</li>
		<li>Add 4 mL of DMEM/F12 and count the cells.</li>
		<li>At this stage, freeze motor neuron progenitors in a cell freezing medium (see Table of Materials), according to manufacturer instructions.</li>
		<li>Pellet the cells and resuspend in Neuronal Medium (Neurobasal/B27 medium supplemented with 20 ng/mL BDNF, 10 ng/mL GDNF, and 200 ng/mL L-ascorbic acid, see Table of Materials) supplemented with 10 &#956;M ROCK inhibitor.</li>
		<li>Seed the cells on poly-ornithine/laminin- or alternatively on matrix-coated supports at 100,000 cells/cm2 density. Use &#956;-Slide plastic supports with polymer coverslip (see Table of Materials) for immunostaining analysis.</li>
	</ol>
	</li>
	<li>On day 6, change the medium to fresh Neuronal Medium devoid of ROCK inhibitor. In the following days, refresh half of the medium every 3 days. The culture medium must be changed very carefully to prevent detachment from the surface.</li>
</ol>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Accutase</td>
			<td>Sigma-Aldrich</td>
			<td>A6964-100ML</td>
			<td>Cell dissociation reagent</td>
		</tr>
		<tr>
			<td>B27</td>
			<td>Miltenyi Biotec</td>
			<td>130-093-566</td>
			<td>Serum free supplement for neuronal cell maintenance</td>
		</tr>
		<tr>
			<td>Bambanker</td>
			<td>Nippon Genetics</td>
			<td>NGE-BB02</td>
			<td>Cell freezing medium, used here for motor neuron progenitors</td>
		</tr>
		<tr>
			<td>BDNF</td>
			<td>PreproTech</td>
			<td>450-02</td>
			<td>Brain-Derived Neurotrophic Factor</td>
		</tr>
		<tr>
			<td>Blasticidin</td>
			<td>Sigma-Aldrich</td>
			<td>203350</td>
			<td>Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes</td>
		</tr>
		<tr>
			<td>BSA</td>
			<td>Sigma-Aldrich</td>
			<td>A2153</td>
			<td>Bovine Serum Albumin. Blocking agent to prevent non- specific binding of antibodies in immunostaining assays</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>Sigma-Aldrich</td>
			<td>C3881</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr>
			<td>Corning Matrigel hESC-qualified Matrix</td>
			<td>Corning</td>
			<td>354277</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr>
			<td>CRYOSTEM ACF FREEZING MEDIA</td>
			<td>Biological Industries</td>
			<td>05-710-1E</td>
			<td>Freezing medium for human iPSCs</td>
		</tr>
		<tr>
			<td>D-Glucose</td>
			<td>Sigma-Aldrich</td>
			<td>G5146</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>AdipoGen</td>
			<td>AG-CR1-0016-M005</td>
			<td>Gamma secretase inhibitor</td>
		</tr>
		<tr>
			<td>Dispase</td>
			<td>Gibco</td>
			<td>17105-041</td>
			<td>Reagent for gentle dissociation of human iPSCs</td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>Sigma-Aldrich</td>
			<td>D6421-500ML</td>
			<td>Basal medium for cell culture</td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>Sigma-Aldrich</td>
			<td>D9891-1G</td>
			<td>Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors</td>
		</tr>
		<tr>
			<td>DS2U</td>
			<td>WiCell</td>
			<td>UWWC1-DS2U</td>
			<td>Commercial human iPSC line</td>
		</tr>
		<tr>
			<td>GDNF</td>
			<td>PreproTech</td>
			<td>450-10</td>
			<td>Glial-Derived Neurotrophic Factor</td>
		</tr>
		<tr>
			<td>Gibco Episomal hiPSC Line</td>
			<td>Thermo Fisher Scientific</td>
			<td>A18945</td>
			<td>Commercial human iPSC line</td>
		</tr>
		<tr>
			<td>Glutamax</td>
			<td>Thermo Fisher Scientific</td>
			<td>35050038</td>
			<td>An alternative to L-glutamine with increased stability. Improves cell health.</td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Sigma-Aldrich</td>
			<td>H4034</td>
			<td>chemicals for electrophysiological solutions</td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>LKT Laboratories</td>
			<td>A7210</td>
			<td>Used in cell culture as an antioxidant</td>
		</tr>
		<tr>
			<td>Laminin</td>
			<td>Sigma-Aldrich</td>
			<td>11243217001</td>
			<td>Promotes attachment and growth of neural cells in vitro</td>
		</tr>
		<tr>
			<td>NEAA</td>
			<td>Thermo Fisher Scientific</td>
			<td>11140035</td>
			<td>Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.</td>
		</tr>
		<tr>
			<td>Neon 100 &#956;L Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>MPK10096</td>
			<td>Cell electroporation kit</td>
		</tr>
		<tr>
			<td>Neon Transfection System</td>
			<td>Thermo Fisher Scientific</td>
			<td>MPK5000</td>
			<td>Cell electroporation system</td>
		</tr>
		<tr>
			<td>Neurobasal Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>21103049</td>
			<td>Basal medium designed for long- term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer</td>
		</tr>
		<tr>
			<td>NutriStem-XF/FF</td>
			<td>Biological Industries</td>
			<td>05-100-1A</td>
			<td>Human iPSC culture medium</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Sigma-Aldrich</td>
			<td>D8662-500ML</td>
			<td>Dulbecco&#39;s Phosphate Buffer Saline, with Calcium, with Magnesium</td>
		</tr>
		<tr>
			<td>PBS Ca2+/Mg2+ free</td>
			<td>Sigma-Aldrich</td>
			<td>D8537-500ML</td>
			<td>Dulbecco&#39;s Phosphate Buffer Saline, w/o Calcium, w/o Magnesium</td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Sigma-Aldrich</td>
			<td>P4333-100ML</td>
			<td>Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.</td>
		</tr>
		<tr>
			<td>poly-ornithine</td>
			<td>Sigma-Aldrich</td>
			<td>P4957</td>
			<td>Promotes attachment and growth of neural cells in vitro</td>
		</tr>
		<tr>
			<td>SU5402</td>
			<td>Sigma-Aldrich</td>
			<td>SML0443-5MG</td>
			<td>Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Sigma-Aldrich</td>
			<td>T8787</td>
			<td>4-(1,1,3,3-Tetramethylbutyl)phenyl- polyethylene glycol, t- Octylphenoxypolyethoxyethanol, Polyethylene glycol tert- octylphenyl ether. Used for cell permeabilization in immunostaining assays</td>
		</tr>
		<tr>
			<td>Y-27632 (ROCK inhibitor)</td>
			<td>Enzo Life Sciences</td>
			<td>ALX-270-333-M005</td>
			<td>Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival</td>
		</tr>
		<tr>
			<td>&#956;-Slide 8 Well</td>
			<td>Ibidi</td>
			<td>80826</td>
			<td>Support for high&#8211;end microscopic analysis of fixed cells</td>
		</tr>
	</tbody>
</table>

Source: Garone, M. G., et al. <a href="https://app.jove.com/v/59321">Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors.</a> J. Vis. Exp. (2019).
This video showcases the process of differentiating human iPSCs into motor neurons. The rationale involves utilizing iPSCs that have been genetically modified to express specific transcription factors. When cultured in a media containing doxycycline, this antibiotic triggers the expression of transcription factors, thereby promoting iPSC differentiation into motor neuron progenitors. Ultimately, the progenitors are cultured in a neuronal medium to yield mature and functional motor neurons.

1. Maintenance of Human iPSCs

	Preparation of matrix-coated plates
	
		Thaw one 5 mL vial of matrix (see Table of Materials) at 4 &#176;C overnight. The ...

Take human induced pluripotent stem cell, or iPSC, colonies cultured on an extracellular matrix-coated plate.
The iPSCs are genetically modified to express transcription factors that induce motor neuron differentiation.&#160;
Remove the media and add enzymes to detach the colonies.
Mechanically dissociate the cells into a single-cell suspension and collect them.
Centrifuge and remove the supernatant.
Resuspend the cells in media containing an inhibitor that prevents cellular apoptosis.
Plate the cells on a matrix-coated dish.
Add fresh differentiation media containing the antibiotic doxycycline and small molecule inhibitors.
Doxycycline induces transcription factor expression, while the inhibitors block specific signaling pathways, promoting iPSC differentiation into motor neuron progenitors.
Add enzymes to detach the cells.&#160;
Collect the cells and mechanically dissociate them.
Centrifuge and discard the supernatant. Resuspend the cells in neuronal media.
Plate the cells on adhesion protein-coated microslides to promote cell adherence.
Growth factors in the media induce progenitor maturation into motor neurons.

15 조회수. 공학적 인간 유도 만능 줄기세포를 기능적 운동 뉴런으로 분화시키기

Differentiating Engineered Human Induced Pluripotent Stem Cells into Functional Motor Neurons

내레이션 대본