This research was performed while the author (JAM) held a National Research Council Research Associateship Award at Air Force Research Laboratories. Co-author MW held a Wright Scholar Fellowship supported by the Air Force Office of Scientific Research. This work was supported by Air Force Office of Scientific Research, Air Force Research Laboratory, and Bio-X Strategic Technology Thrust.

1. 도서관 프라이머 설계 및 합성 <ol><li> 초기 라이브러리와 프라이머 (이 항목은 이전의 출판물에서 광범위하게 검토되었다) (25), (26)을 디자인합니다. <ol><li> 표준 포스 포르 아미 다이 트 화학을 이용하여 본 연구를위한 다음의 서열을 합성 : 라이브러리 : GAATGGATCCACATCCATGG-N (40) -TTCACTGCAGACTTGACGAAGCTTGACGAA 앞으로 프라이머 : GGAATGGATCCACATCCATGG 역방향 프라이머 : 비오틴 AAGCTTCGTCAAGTCTGCAGTGAA </li><li> 라이브러리의 5&#39;- 영역에 상보하는 cDNA로 캡쳐 프로브 디자인. 증가 된 용융 온도를 공급하는 각각의 후속 염기와 약간 RT 상기 용융 온도를 제공하는 온라인 융점 소프트웨어 분석에 의해 초기 길이를 선택한다. 메르 캡처 프로브 : CCATTCC - 비오틴 메르 캡처 프로브 : TCCATTCC - 비오틴 메르 캡처 프로브 : ATCCATTCC - 비오틴 </li></ol></li><li> 표준 HPLC에 의해 라이브러리를 정화. 탈염 suffi입니다프라이머 및 캡처 프로브 효율적인. 업에 대한 몇 개월 -20 ° C에서 원하는 농도와 매장에서 뉴 클레아 무료 물에 올리고 뉴클레오티드를 복원합니다. </li></ol> 2. 버퍼, 라이브러리 및 샘플 준비 <ol><li> 밀리 포아 또는 50 mM 트리스, 137 mM의 염화나트륨, 5 mM의의 MgCl 2, 산도 7.4의 농도 뉴 클레아없는 수준의 물에 버퍼의 500 ml의를 준비합니다. 멸균 된 0.2 ㎛ 멤브레인을 통해 버퍼 필터; 저장 달 동안 주변 조건에서 가능하다. <ol><li> 대안 적으로, 등을 PBS (인산 완충 생리 식염수), HEPES (4- (2- 히드 록시 에틸) -1- 피페 라진 에탄 술폰산) 등의 다른 버퍼를 사용 </li></ol></li><li> 두 thermomixers를 설정; 95 ° C에 1을 설정하고 주변 환경 (이 작품 ~ 20 ° C)에서 다른 보관하십시오. 얼음 양동이를 준비합니다. </li><li> 열 / 100 μL 라이브러리를 배치하여 DNA 라이브러리를 냉각 스냅 (~ 10 15 -10 16 시퀀스 2.5 nmol의) 써모 설정5 분 t 95 ° C의. 자석 구슬이 (섹션 3.1-3.6)을 준비하는 동안 얼음에 튜브를 놓습니다. λ = 260 nm에서의 UV 흡수에 의한 DNA 라이브러리의 실제 농도를 측정하고 적절한 라이브러리 변환율 적용. </li><li> 대상 매체에 대한 용해도가 적절한 타겟 스톡 용액을 제조 하였다. <ol><li> DMSO 100 MM의 분석 주식을 준비합니다. 주위 조건에서 저장,하지만 서로 다른 목표는 다른 저하 프로필을 설명 할 것이다 때 이러한 주식은 약 1 개월 가능한입니다. </li></ol></li></ol> 자석 구슬 및 선택의 초기 라운드 3. 준비 <ol><li> 소용돌이 6.7 × 10 8 구슬 / ㎖ 스트렙 타비 딘 - 코팅 자석 구슬과 새로운 microcentrifuge 관 400 μl를 제거합니다. 2 분 동안 자석에 튜브를 삽입하고 상층 액을 제거합니다. </li><li> 바인딩 버퍼, 와동 400 μl를 추가하고 배치 한 후 상층 액을 흡입하여 구슬을 씻으십시오자석에 튜브는 구슬을 분리합니다. 이 과정을 세 번 반복합니다. </li><li> 50 μM (최종) 캡처 프로브 400 μL 바인딩 버퍼에있는 구슬을 재현 탁과 주변 조건에서 써모에 부드러운 교반과 함께 10 분 동안 배양하여 자기 구슬 캡처 프로브를 고정. </li><li> 무료 캡쳐 프로브를 제거하기 위해 3.2 절에 설명 된 세척 단계를 반복하여 비즈 바인딩 버퍼 400 μL로 3 회 세척 할 것. </li><li> 결합 완충액 400 μL에 구슬을 재현 탁. 다음 단계는 비드 용액 100 μl를 제거하고 삼주의 최대 추가 선택 라운드에 사용할 4 ° C에서 나머지 300 μl를 유지합니다. </li><li> 3.2 절에 설명 된대로 결합 완충액 200 μL로 두 번 구슬을 씻으십시오. </li><li> 세척 구슬 2.3 절에서 스냅의 100 μL가 DNA를 냉각 추가하고 주위 조건에서 써모을 사용하여 부드러운 교반과 함께 30 분 동안 품어. NOTE : 제 라운드에서 DNA 농도는 고유 시퀀스 이론적 존재 이전 라운드에서 시퀀스의 손실을 최소화하기 위해 후속 발사 속도보다 더 높다. </li><li> 섹션 2.3에서와 같이 UV 흡수를 이용하여 상등액 DNA 정량 및 비드에 결합 된 DNA의 양을 평가하기 위해 3.7 첨가 초기 량으로부터이를 빼기. <ol><li> 200 μL 주위 조건에서 5 분 동안 써모에 부드러운 교반과 함께 버퍼를 바인딩 두 개의 추가 세척 한 다음 바인딩 버퍼 200 μL와 구슬을 씻으십시오. </li></ol></li><li> 결합 완충액에 희석 된 100 μM 표적을 200 μL의 비드를 재현 탁하고, 주위 조건에서 30 분 동안 회전에 써모. 대상 및 제어가 시간이 지남에 따라 수용액 밖으로 집계 관찰 되었기 때문에 이전의 선택에 하루의 시작 부분에서 작업 솔루션은 신선한 준비합니다. 타겟 용출 서열을 함유 상등액을 보관추가 연구에 대한의. </li><li> 섹션 3.8.1에서 제조 한 비드 μM 프로게스테론 200 μl를 첨가하여 1-2 발사 종료 후의 음성 선별을 수행한다. 주위 조건에서 써모에 30 분 동안 부드럽게 흔들. </li><li> 구슬을 캡처하고 3.9 절에서와 같이 이전에 코티솔 추가로 결합 완충액 200 μL에 두 번 구슬을 세척, 상층 액을 제거하기 위해 자기 스탠드를 사용합니다. </li></ol> 4. 심화 모니터링, PCR, 및 단일 가닥 DNA 세대 <ol><li> 선택 농축을 모니터링하는 투석 카세트 상등액을 추가한다. 투석 코티솔이 존재하기 때문에 DNA에 비해 훨씬 더 높은 농도에서 용출 된 DNA에서 코티솔을 제거 할 필요가 있고, 또한 표준 DNA UV λ 최대 = 260 nm의 중첩 UV 흡수 피크를 갖는다. <ol><li> 이 단계 선택의 초기 라운드에서 다른 모든 라운드 (라운드 2, 4, 6, 8)을 수행합니다. 이 샘플 로스를 완화의 각 시퀀스의 잠재적 몇 사본 번호가 존재 (최고 다양성) 때. 빠른 결과를 들어, 크기 배제 컬럼과 같은 대체 방법도 활용 될 수있다. </li></ol></li><li> 두번 주위 조건에서 2 시간 동안 결합​​ 완충액 250 ㎖ 중의 신선한 샘플을 투석 카세트. 버퍼를 교체하고 4 ° CO / N 품어. </li><li> 대상이 용출 된 DNA의 비율을 결정하기 위해 UV 분광법에 의한 투석 풀을 분석 (섹션 3.8의 결과를 비교). </li><li> / V에 티듐 브로마이드 w 1 %와 3 % 아가 로즈 젤을 준비한다. 본 연구에서는 아가로 오스 1.5 g, TAE 버퍼 (40 mM 트리스 아세테이트, 1 mM의 EDTA, pH가 8.0) 50 ㎖ 및 에티 디움 브로마이드 10 μL에서 겔을 준비합니다. </li><li> ~ 5-15 사이클을 사용하여 작은 규모의 PCR (5 × 50 μL 씩)을 수행하여 투석 풀을주기-최적화 할 수 있습니다. PCR 성분의 경우, 1X PCR 반응 완충액 (모두 최종 농도), 200 μM의 dNTPs, DNA 템플릿의 10 % 반응 부피 500 nM의 각각의 프라이머, 2.5을 사용하여U 중합 효소 (2.5 U / μL 주식). <ol><li> 실행 PCR은 2 분 동안 95 ° C에서의 조건을 최적화 95 ° C (30 초), 55 ℃ (30 초)의 반복 사이클,이어서 72 ℃ (1 분) 후, 72 ° C (10 사용 하 분) 최종 확장을 4 ℃에서 개최. </li><li> 비교를 위해 25 bp의 표준 사다리를 채택하고 젤 이미 저에 시각화. 원치 않는 부산물없이 올바른 크기 마커에서 가장 높은 강도의 밴드를 생산 사이클의 수를 선택합니다. </li><li> 6X 블루 / 오렌지 로딩 염료 2㎕의 각 PCR 사이클의 10 μL를 결합하고, 단계 4.4 (45 분, 125 V)에서 제조 한 3 % 아가 로즈 겔 5 별도 웰에 로딩하여주기 최적화의 결과를 분석한다. </li></ol></li><li> 4.5 절에서 결정된 조건과 적절한 사이클 수를 이용하여 대규모 PCR을 수행합니다. 일반적으로 PCR 반응의 6-8 ml의이 선택의 각 라운드에 사용되는 1-2.5 nmol의를 얻기 위해 필요했다. 단순화하기 위해 8 스트립 튜브를 사용하여필요한 많은 튜브의 취급은 PCR 증폭이 볼륨을 나누어지는 수 있습니다. </li><li> 4.4 절에 설명 된대로 3 % 아가 로스 젤을 준비하고, PCR 제품 밴드 섹션 4.5.2-4.5.3의 단계에 따라 정확한 위치에 표시되는지 확인합니다. </li><li> 아래에서 설명하는 단계에 의해 단일 ​​가닥 DNA에 섹션 4.7에서 전체 이중 가닥 DNA 제품을 변환 : <ol><li> 프릿에 의해 차단 작은 열 스트렙 타비 딘 - 코팅 구슬 (자기되지 않음)의 300 μl를 추가합니다. 5 ml의 루어 잠금 주사기를 부착하고, 플런저에 부드러운 압력을 적용하여 버퍼를 바인딩 구슬을 씻으십시오. 열에서 주사기를 제거하고 구슬이 플런저 흡인에 의해 방해되지 않도록 각 물질의 첨가 후 주사기 오프라인에서 플런저를 제거합니다. </li><li> PCR 제품을 추가하고 플런저에 부드러운 압력을 사용하여 열을 통해 전달합니다. PCR 제품의 더 이상 1-1.2보다 ㎖를 각각의 컬럼에 추가되도록 여러 열을 사용합니다. 최종 FL 폐기아우 통해 DNA 보낸 안티센스 가닥 비오틴 부위 것에 의하여 컬럼 상에 보유 될 것이다. </li><li> 결합 완충액 5 mL로 열을 씻으십시오. </li><li> 0.2 M의 NaOH 0.5ml를 첨가하여 DNA를 Dehybridize. 이 단일 가닥 센스 DNA가 들어 있으므로 용출액을 유지. </li></ol></li><li> 클레아없는 물로 세척하여 제조 탈염 컬럼에 0.5 ml에 첨가하여 0.2 M의 NaOH에서 ssDNA를을 탈염. 다음 1 ml의 뉴 클레아 무료 물을 추가하고이 탈염 ssDNA의 샘플을 수집, 초기 0.5 ml의 유체를 폐기하십시오. 복수 탈염 컬럼의 각 부에 대해, 0.5 ml를 요구한다. <ol><li> λ = 260 nm에서의 UV 흡수에 의해 용출 된 DNA의 농도를 결정. </li><li> 진공 건조 샘플을 결합 완충액의 적절한 부피 재구성. 선택의 다음 라운드 얻어 충분한 DNA가 아니었다면, 섹션 4.6-4.9.2를 반복합니다. </li></ol></li></ol> 선택 및 시퀀싱 5. 후속 라운드 <ol><li> 농축 감시 (4.1)의 결과에 따라 선정 조건의 엄격함을 조정한다. 일반적으로, 풀에서 가장 높은 선호도 바인더를 선택하기 위해 연속적인 선택 라운드에서 조건이 더 엄격합니다. 주 :이 네거티브 선택 화합물의 농도, 또는 다른 방법 (27)의 다양한 증가 목표 농도를 감소, DNA 농도를 증가 세척 공정 수, 시간, 또는 볼륨 증가의 조합을 포함 할 수있다. <ol><li> 표적 분자에 대한 서열의 특이성을 보장하기 위해 적절한 적절한 컨트롤을 적용합니다. 본 연구에서는 시스템 (표 1) 3 라운드 시작과 선택을 통해 농도 증가에 부정적인 선택 분자 (프로게스테론)을 적용한다. 라운드 11 년부터 10 ~ 20 μm의 프로게스테론 이전 (3.7 이전) 비드에 고정화에 30 분 동안 DNA 풀을 미리 배양한다. </리&gt; <li> 최대 농축 관찰 후 포획 프로브의 길이를 증가시킨다. </li></ol></li><li> 호환 프라이머 및 고성능 폴리머와 PCR 증폭하여 염기 서열에 대한 최대로 농축 (라운드 13)과 최소 농축 (6 라운드) 상태를 나타내는 최종 풀 (라운드 15)과 다른 풀을 준비합니다. <ol><li> 1X (반응 완충액) 중 최종 농도를 사용하여 50 ㎕의 반응 부피로, 200 μM (각각의 dNTP), 400 nM의 (각 프라이머), DNA 풀 0.5 μL, 폴리머 및 0.5 μl를 설정한다. 사이클의 최종 연장 72 ℃에서 7 분 유지 제외한 동일한 PCR 조건을 사용하여 4.5 절에 설명 된 단계를 이용하여 각 라운드 최적화. </li><li> 철저하게 비 접착 포장으로 밀봉 캡 마이크로 원심 튜브에 순서 시설로 제조 된 풀의 50 μl를 보냅니다. 버블 랩 및 선박 O / N 시퀀싱 시설에 얼음 팩과 함께 포장 15 ML 원뿔 튜브에 튜브를 놓습니다. </li></ol&gt; </li><li> 시퀀스 된 풀 (들)의 농축을 평가하기 위해 각 시퀀스의 카피 수를 결정합니다. <ol><li> 시퀀싱 시설에서 제공하는 모든 풀에 대한 데이터에 반복 된 각 시퀀스의 주파수 / 복사 번호를 결정하는 FASTA 형식으로 차세대 시퀀싱 데이터에 대한 단계를 (보충 코드 파일 참조) 정렬 / 코드 작성을 사용하여 </li></ol></li><li> 가장 높은 카피 수 서열의 특이성과 친화력을 분석합니다. 상호 작용 (단백질 또는 작은 분자), 결합시 앱 타머의 구조적 특성, 예상 친 화성의 유형은 적합한 방법을 지시한다. 이 항목 참조 1,28-30의 숫자에 더 상세히 검토한다. </li></ol> 6. AuNP 합성 및 인식 <ol><li> 시트르산 환원 방법을 사용하여 (21)을 합성 AuNPs. 끓는 2의 50 mM HAuCl 4 ㎖의 가열 밀리 포아 물 98 ㎖의 혼합. </li><li> 로서 38.8 mM의 시트르산 나트륨 10 ㎖를 추가역류가 시작하자마자. 색상은 몇 분 후 붉은 색으로 변경됩니다. 열을 끄고 20 분 동안 용액을 교반을 계속합니다. </li><li> AuNP 솔루션은 0.2 μm의 폴리 에스테르 막을 통과 한 후, 실온으로 냉각 필터링 할 수 있습니다. 어두운 호박색 병에 모든 AuNP 현탁액을 저장합니다. </li><li> 2.4 × 10 8 L 몰 cm -1 -1 (31)의 흡광 계수를 이용하여, UV 흡수에 AuNP 농도를 계산한다. 농도는 동적 인 빛 (21) 산란에 의해 결정 17 ± 0.6 nm의 크기로,이 작품의 10 nm였다. </li><li> 알루미늄 호일에 의해 보호 주위 조건에서 1 시간 동안 10nM의 AuNP와 DNA를 인큐베이션. AuNP의 부피가 원하는 모든 테스트가 수행 될 수 있도록하기에 충분한 해결책을 제공 따른 가변 (~ 1-2 mL)을 첨가 하였다. 73, 120, 200 및 D / NP (AuNP 당 DNA 분자)의 적재 밀도가이 연구에서 조사하고, 부피 및 농도는 그에 따라 변할 것이다. </li><li> HEP를 사용하여 1 : DNA를 희석 / AuNP 액 (1)ES 완충액 (20 mM의 HEPES, 2 mM의의 MgCl 2, pH는 7.4). 혼합물을 알루미늄 호일에 포함 RT에서 평형을 허용합니다. 주 :이 단계에 필요한 시간은 연구원에 의해 최적화 될 필요가있을 것이다. 본 연구에서는 몇 분에서 O에 이르기까지 시간은 / N을 조사 하였다. </li><li> 분석 물 (코티졸, 콜산, 2- 메 톡시 나프탈렌) 100mm의 DMSO에 원액을 준비하고, 알루미늄 호일로 커버. 코티솔 결합 버퍼 (2.1)의 1/3 희석 100 μM에 주식의 희석하여 각 실험에 신선한 초기 솔루션은 이전에 확인합니다. 또한 1/3 결합 완충액으로 초기 용액을 희석되도록 타겟의 일정한 체적 (10 μL)의 농도 범위를 생성하기 위해 첨가된다. </li><li> 1/3 결합 완충액 10 μL와 DNA / AuNP 용액 80 μl를 첨가하여 요구되는 염 농도를 최적화 ( &quot;빈&quot;이라한다). <ol><li> RT 후 염화나트륨 오디오 솔루션의 다른 볼륨을 추가로 20 분 동안 품어이온. 소금 또한 (이 작품에 사용 된 1 M NaCl을 13-40 μL) 후 푸른 색조를 향해 거의 시각적으로 눈에 띄는 변화를 유도하는 소금의 양을 찾습니다. 이것은 좋은 출발점을 제공하지만, 또한 대상을 포함한 결과를 다음의 추가 조정이 필요할 수있다. </li></ol></li><li> 대상 용액 10 μL와 DNA / AuNP 용액 80 μL를 결합 RT에서 20 분 동안 배양한다. 항상 빈 (6.8 절)을 포함하여, 동시에 여러 대상 농도를 분석하기 위해 96 웰 플레이트와 멀티 채널 피펫을 활용합니다. <ol><li> NaCl 용액의 적절한 용적을 (1 M NaCl을 13 μL가이 연구에서 적용되었다)를 첨가하고, 즉시 플레이트 리더를 사용하여 650 및 530 nm에서 흡광도를 분석한다. </li></ol></li><li> 블랭크 측정 대상에 대하여 정규화 농도 대 흡광도 값의 비 (650 E / E (530))와 같은 결과를 플롯. </li></ol>

<ol>
	<li>McKeague, M., DeRosa, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Challenges+and+opportunities+for+small+molecule+aptamer+development.">Challenges and opportunities for small molecule aptamer development.</a> J. Nucleic Acids. 2012, 1-20 (2012).</li><li>Gatti, R., Antonelli, G., Prearo, M., Spinella, P., Cappellin, E., De Palo, E. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortisol+assays+and+diagnostic+laboratory+procedures+in+human+biological+fluids.">Cortisol assays and diagnostic laboratory procedures in human biological fluids.</a> Clin. Biochem. 42, 1205-1217 (2009).</li><li>Morgan, C. A., Wang, S., Rasmusson, A., Hazlett, G., Anderson, G., Charney, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Relationship+among+plasma+cortisol,+catecholamines,+neuropeptide+Y,+and+human+performance+during+exposure+to+uncontrollable+stress.">Relationship among plasma cortisol, catecholamines, neuropeptide Y, and human performance during exposure to uncontrollable stress.</a> Psychosom. Med. 63 (3), 412-422 (2001).</li><li>Michael, D. J., Valle, B., Cox, J., Lalns, J. E., Fogt, D. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salivary+Biomarkers+of+Physical+Fatigue+as+Markers+of+Sleep+Deprivation.">Salivary Biomarkers of Physical Fatigue as Markers of Sleep Deprivation.</a> J. Clin. Sleep Med. 9 (12), 1325-1331 (2013).</li><li>Kwak, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Volatile+biomarkers+from+human+melanoma+cells.">Volatile biomarkers from human melanoma cells.</a> J. Chrom. B. 931, 90-96 (2013).</li><li>Stevens, R. C., Soelberg, S. D., Near, S., Furlong, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Cortisol+in+Saliva+with+a+Flow-Filtered,+Portable+Surface+Plasmon+Resonance+Biosensor+System.">Detection of Cortisol in Saliva with a Flow-Filtered, Portable Surface Plasmon Resonance Biosensor System.</a> Anal. Chem. 80 (17), 6747-6751 (2008).</li><li>Arya, S. K., Ghornokur, G., Venugopal, M., Bhansali, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+functionalized+interdigitated+&#956;-electrode+(ID&#956;E)+based+impedimetric+cortisol+biosensor.">Antibody functionalized interdigitated &#956;-electrode (ID&#956;E) based impedimetric cortisol biosensor.</a> Analyst. 135 (8), 1941-1946 (2010).</li><li>Kapczinski, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allostatic+load+in+bipolar+disorder:+Implications+for+pathophysiology+and+treatment.">Allostatic load in bipolar disorder: Implications for pathophysiology and treatment.</a> Neurosci. Biobehav. Rev. 32 (4), 675-692 (2008).</li><li>Tuerk, C., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+evolution+of+ligands+by+exponential+enrichment:+RNA+ligands+to+bacteriophage+T4+DNA+polymerase.">Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase.</a> Science. 249 (4968), 505-510 (1990).</li><li>Ellington, A. D., Szostak, J. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+selection+of+RNA+molecules+that+bind+specific+ligands.">In vitro selection of RNA molecules that bind specific ligands.</a> Nature. 346 (6287), 818-822 (1990).</li><li>Ciesiolka, J., Gorski, J., Yarus, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+an+RNA+domain+that+binds+Zn2.">Selection of an RNA domain that binds Zn2.</a> RNA. 1 (5), 538-550 (1995).</li><li>Liu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+Aptamers+Specific+for+Adipose+Tissue.">Selection of Aptamers Specific for Adipose Tissue.</a> PlosOne. 7, e37789 (2012).</li><li>McCauley, T. G., Hamaguchi, N., Stanton, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-based+biosensor+arrays+for+detection+and+quantification+of+biological+macromolecules.">Aptamer-based biosensor arrays for detection and quantification of biological macromolecules.</a> Anal. Biochem. 319 (2), 244-250 (2003).</li><li>Huang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+label-free+electrochemical+biosensor+based+on+a+DNA+aptamer+against+codeine.">A label-free electrochemical biosensor based on a DNA aptamer against codeine.</a> Anal. Chim. Acta. 787, 203-210 (2013).</li><li>Stoltenburg, R., Reinemann, C., Strehlitz, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX&#8212;A+(r)evolutionary+method+to+generate+high-affinity+nucleic+acid+ligands.">SELEX&#8212;A (r)evolutionary method to generate high-affinity nucleic acid ligands.</a> Biomol. Eng. 24 (4), 381-403 (2007).</li><li>Jayasena, S. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamers:+An+Emerging+Class+of+Molecules+That+Rival+Antibodies+in+Diagnostics.">Aptamers: An Emerging Class of Molecules That Rival Antibodies in Diagnostics.</a> Clin Chem. 45 (9), 1628-1650 (1999).</li><li>Morse, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+selection+of+RNA+beacon+aptamers.">Direct selection of RNA beacon aptamers.</a> Biochem. Biophys. Res. Commun. 359, 94-101 (2007).</li><li>Nutiu, R., Li, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-Switching+Signaling+Aptamers.">Structure-Switching Signaling Aptamers.</a> J. Am. Chem. Soc. 125 (16), 4771-4778 (2003).</li><li>Luo, F., Zheng, L., Chen, S., Cai, Q., Lin, Z., Qiu, B., Chen, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+aptamer-based+fluorescence+biosensor+for+multiplex+detection+using+unmodified+gold+nanoparticles+Chem.">An aptamer-based fluorescence biosensor for multiplex detection using unmodified gold nanoparticles Chem.</a> Commun. 48 (51), 6387-6389 (2012).</li><li>Li, H., Rothberg, L. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-Free+Colorimetric+Detection+of+Specific+Sequences+in+Genomic+DNA+Amplified+by+the+Polymerase+Chain+Reaction.">Label-Free Colorimetric Detection of Specific Sequences in Genomic DNA Amplified by the Polymerase Chain Reaction.</a> J. Am. Chem. Soc. 126 (35), 10958-10961 (2004).</li><li>Ch&#225;vez, J. L., MacCuspie, R. I., Stone, M. O., Kelley-Loughnane, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+with+aptamer&#8211;gold+nanoparticle+conjugates:+effect+of+aptamer+length+on+response.">Colorimetric detection with aptamer&#8211;gold nanoparticle conjugates: effect of aptamer length on response.</a> J. Nanopart. Res. 14 (9), 1166-1177 (2012).</li><li>Hagen, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biofunctionalized+Zinc+Oxide+Field+Effect+Transistors+for+Selective+Sensing+of+Riboflavin+with+Current+Modulation.">Biofunctionalized Zinc Oxide Field Effect Transistors for Selective Sensing of Riboflavin with Current Modulation.</a> Sensors. 11 (7), 6645-6655 (2011).</li><li>Han, K., Liang, Z., Zhou, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+Strategies+for+Aptamer-Based+Biosensors.">Design Strategies for Aptamer-Based Biosensors.</a> Sensors. 10 (5), 4541-4557 (2010).</li><li>Martin, J. A., Ch&#225;vez, J. L., Chushak, Y., Chapleau, R. R., Hagen, J., Kelley-Loughnane, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+stringency+aptamer+selection+and+gold+nanoparticle+assay+for+detection+of+cortisol.">Tunable stringency aptamer selection and gold nanoparticle assay for detection of cortisol.</a> Anal. Bioanal. Chem. 406 (19), 4637-4647 (2014).</li><li>Hall, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis,+and+Amplification+of+DNA+Pools+for+In+Vitro+Selection.">Synthesis, and Amplification of DNA Pools for In Vitro Selection.</a> Curr. Protoc. Nucleic Acid Chem. 39, 9.2.1-9.2.28 (2009).</li><li>Sefah, K., Shangguan, D., Xiong, X., O&#8217;Donoghue, M. B., Tan, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+DNA+aptamers+using+Cell-SELEX.">Development of DNA aptamers using Cell-SELEX.</a> Nat. Protoc. 5 (6), 1169-1185 (2010).</li><li>Djordjevic, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SELEX+experiments:+New+prospects,+applications+and+data+analysis+in+inferring+regulatory+pathways.">SELEX experiments: New prospects, applications and data analysis in inferring regulatory pathways.</a> Biomol. Eng. 24 (2), 179-189 (2007).</li><li>Thomas, J. R., Hergenrother, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeting+RNA+with+Small+Molecules.">Targeting RNA with Small Molecules.</a> Chem. Rev. 108 (4), 1171-1224 (2008).</li><li>Jing, M., Boswer, M. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Review+of+Methods+for+Measuring+Aptamer-Protein+Equilibria.">A Review of Methods for Measuring Aptamer-Protein Equilibria.</a> Anal. Chim. Acta. 686 (1-2), 9-12 (2011).</li><li>Sachs, E. -. F., Diederichsen, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Binding of Triostin Analogues to DNA. , (2011).</li><li>Liu, J., Lu, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+aptamer-linked+gold+nanoparticle+purple+aggregates+for+colorimetric+sensing+of+analytes.">Preparation of aptamer-linked gold nanoparticle purple aggregates for colorimetric sensing of analytes.</a> Nat. Protoc. 1 (1), 246-252 (2006).</li><li>Cho, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+selection+of+DNA+aptamers+through+microfluidic+selection+and+high-throughput+sequencing.">Quantitative selection of DNA aptamers through microfluidic selection and high-throughput sequencing.</a> Proc. Natl. Acad. Sci. USA. 107 (35), 15373-15378 (2010).</li><li>Martin, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+an+Aptamer+Antidote+to+the+Anticoagulant+Drug+Bivalirudin.">Selection of an Aptamer Antidote to the Anticoagulant Drug Bivalirudin.</a> Plos One. 8 (3), e57341 (2013).</li><li>Sch&#252;tze, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+the+SELEX+Process+with+Next-Generation+Sequencing.">Probing the SELEX Process with Next-Generation Sequencing.</a> Plos One. 6 (12), e29604 (2011).</li><li>Kupakuwana, G. V., Crill, J. E., McPike, M. P., Borer, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Acyclic+identification+of+aptamers+for+human+alpha-thrombin+using+over-represented+libraries+and+deep+sequencing.">Acyclic identification of aptamers for human alpha-thrombin using over-represented libraries and deep sequencing.</a> Plos One. 6 (5), (2011).</li><li>Smith, J. E., Griffin, D. K., Leny, J. K., Hagen, J. A., Ch&#225;vez, J. L., Kelley-Loughnane, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colorimetric+detection+with+aptamer-gold+nanoparticle+conjugates+coupled+to+an+android-based+color+analysis+application+for+use+in+the+field.">Colorimetric detection with aptamer-gold nanoparticle conjugates coupled to an android-based color analysis application for use in the field.</a> Talanta. 121, 247-255 (2014).</li><li>Chatterton Jr, R. T., Vogelsong, K. M., Lu, Y. -. C., Hudgens, G. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hormonal+Responses+to+Psychological+Stress+in+Men+Preparing+for+Skydiving.">Hormonal Responses to Psychological Stress in Men Preparing for Skydiving.</a> J. Clin. Endocrinol. Metab. 82 (8), 2503-2509 (1997).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> Plos One. 5 (12), (2010).</li><li>Musheev, M. U., Krylov, S. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+aptamers+by+systematic+evolution+of+ligands+by+exponential+enrichment:+Addressing+the+polymerase+chain+reaction+issue.">Selection of aptamers by systematic evolution of ligands by exponential enrichment: Addressing the polymerase chain reaction issue.</a> Anal. Chim. Acta. 564 (1), 91-96 (2006).</li><li>Wiebe, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progesterone+metabolites+in+breast+cancer.">Progesterone metabolites in breast cancer.</a> Endocr.-Relat. Cancer. 13 (3), 717-738 (2006).</li></ol>

배포 진술서 A : 공개에 대한 승인; 분포 (88 ABW-2014-4103) 제한이 없습니다. 저자는 그들이 더 경쟁 금융 이익이 없다고 선언합니다.

작은 분자 생물학적 관심의 있지만보고 된 모든 앱 타머의 19 %를 구성한다는 사실은 큰 의미의 작은 분자에 적용 할 수있는 앱 타머를 선택하기위한 방법을 고안 렌더링한다. 소분자의 SELEX 단백질 1에 비해 서열과의 상호 작용 가능한 적은 작용기 구조적 모티프 및 표면적 등 특히 도전이며, 그것은 시도 된 모든 대상에 대한 선택의 30 % 미만은 앱 타머 이어질 것으로 추정 (38). 따라서, 하나는 성공적으로 작은 분자 대상으로 앱 타머를 선택하기 위해 실험 설계 및 실행의 매우주의해야합니다. 그들의 결합 특성을 변경시킬 수있는 화학적 변형을 필요로하지 않고 작은 분자에 적용 할 수 있기 때문에이 연구에서 기술 된 압 타머 선택 방법이 유리하다. 또한 t 이후 있다는 것을 의미 기반의 용출이다대상 분자에 결합제 상등액 버퍼로 방출되기 때문에 그 DNA는 오히려 목표보다 초기 비드 매트릭스와 상호 작용하는 DNA가 선택의 다음 라운드 증폭 할 수없는 것, 다음 목표 의해 자성 비드로부터 용출 바인딩 비특이적 매트릭스 바인더 바운드 남아있다. 반대로, 매트릭스에 대해 네거티브 선택 방법은 매트릭스와 상호 작용하는 DNA가 목표 한 결합제 이외에 증폭되기 때문에 고체 지지체에 각 라운드를 타겟을 고정화하는 방법이 요구된다. 현재의 방법은 T m의 제한된 선택 전략으로 설계되었다. 이 cDNA를 / 풀 하이브리드의 T m을 실온에 가까운 유지 것을 의미한다. 모스는 비슷한 전략을 사용하지만, 4 ° C (17)에서 선택 조건 T의 m &lt;10 ° C로 6 메르의 cDNA 프로브를 적용했다. 우리의 응용 프로그램은 RT에서 수행 바이오 센싱 분석을 위해, 그래서의 cDNA의 길이에 따라 조정 하였다LY. 대상 바인딩 상호 작용이 결합 된 cDNA을 방해 할 수있는 형태 변화를 유도하지 않는 원격 위치에서 발생하기 때문에 잠재적 인 바인더가 손실되지 않도록이 충분히 낮게 선택의 엄격 성을 유지합니다. 일부 서열이 전적으로 열역학에 기초 dehybridize 것 때문에, 제안 된 방법의 분할 효율이 낮다. 15 량체의 T의 m은 소분자 타겟으로 방출 할 수 있도록 너무 높기 때문에 반대로 Nutiu 등은 알. 15 량체의 cDNA를 적용하고, 유일한 가능성, 네 대상 이틀 앱 타머를 확인할 수 있었다 (18). 따라서, 현재 선택 전략 선택의 엄격 성을 제어 성공 가능성이 증가 될 가능성이 바인더의 손실을 최소화함으로써, 배경 서열을 제거하기 위해 많은 라운드를 필요로한다. 앱 타머 선택에 새로운 많은 연구자의 PCR과 관련된 중요한 측면의 인식하지 못하고있다잠재적 인 바인더. DNA 라이브러리의 과도한 증폭 부산물 높은 사이클 번호에 (하여 대형) 불필요한 생성하고, 목적 생성물이 완전히 5 사이클 (39)의 과량 사라질 수 있기 때문에주기 최적화 (4.5 절)가 필요하다. 위에 증폭의 경우, PCR 생성물은 더 이상 타겟 용출 그 서열을 대표하지 않으며 선택 성공의 가능성은 크게 감소된다. (4)가이 연구에서 5 라운드에서 사이클 최적화의 일 예를 도시한다. 가장 낮은주기는 최소한의 제품 밴드, 8주기를 통해 양 밴드 증가를 생산; 10 사이클에서 높은 대역은 오버 사이즈의 증폭 산물로 전환을 시작하고, 약 12​​ 사이클 이내에 완전히 통해 증폭 산물로 구성된다. 많은 연구자들이 간과 할 수 SELEX에 미숙 한 또 다른 세부 사항은 전체 풀 대규모 PCR 증폭에 증폭되어야한다는 전나무 (4.6)이다ST는 라운드 바인더의 손실을 줄일 수 있습니다. 올리고 뉴클레오티드 서열로부터 가능한 고유의 수 (4)가 네 개의 핵산 염기를 나타내고 4 N,이고, N은 임의의 라이브러리 영역의 염기의 수이다. 1.2 × 10 24 가능한 고유 한 시퀀스의 시퀀스 공간의 결과로이 작품, N = 40,하십시오. 선택의 첫 번째 라운드에 사용되는 라이브러리의 2.5 nmol의는 대응에 10 ~ 15 분자, DNA의 각 사본이 가능성이 고유 한 순으로 초기 풀에 표시되는 것을 의미한다. 따라서, 대상이 비드로부터 용출 된 DNA의 전체 볼륨은 선택의 다음 라운드를위한 각각의 잠재적 결합제의 복사본을 유지하기 위해 증폭한다. 이 초기 증폭가 발생하면 여러 복사본은 균일 한 용액을 샘플링 가정 다음 라운드에서 선택할 수 있습니다. 대상의 농도는 신중하게 각 라운드에서 고려되어야한다. Nutiu 등. 사용다 선택 과정에서 1 ㎜ 대상의 농도, 그리고 K의 D = 600 μM (18) ATP 앱 타머를 선택했다. 현재 작업과 모스 (17)의 연구는 모두 선택의 과정을 통해 감소, 100 μM 대상으로 시작, 낮은 마이크로 친화와 앱 타머의 결과. 정확히 엄격 라운드 (낮은 목표 농도) 농축이 관찰되는 경우에 따라 증가되어야한다. 또 다른 중요한 단계는 앱 타머 분자 표적 특이성을 입증하도록 적절한 음성 선별 단계를 적용하는 것이다. 제어가 사용되는 선택된 앱 타머의 의도 된 적용에 달려있다. 예를 들어, 압 타머 (15-1)는 코티솔 바이오 센싱 분석에서 인식 요소로서 기능 할 수 있도록 설계되었으며, 그래서 생리적 유체 (40)에서 발견된다 코르티손 대사 전구체이기 때문에 프로게스테론 음성 선별 분자로서 사용 하였다. Nutiu 등에 의해 선택된 ATP 앱 타머. &lt;/ EM&gt;는 음의 선택 단계를 포함하며, ADP, AMP, 아데노신, 그리고으로 dATP (18)를 포함하여 구조적으로 유사한 분자와 상호 작용하지 않았다. 고려 마지막 노트는 AuNP 분석은 종종 각각의 앱 타머 / 대상 쌍에 대한 상당한 최적화를 필요로한다는 것이다. 염 첨가 후 푸른 색조를 향해 거의 시각적으로 눈에 띄는 변화를 유도 염 체적 찾고 좋은 출발점이지만, 시작점의 조정은 반응을 관찰하기 위해 요구 될 수도있다. 우리는 또한 분석은 (버퍼 농도 (버퍼의 염분 농도가 진한 자주 집계가 발생하기 때문에 선택 버퍼가 희석이 필요할 수 있습니다) 및 조성, DNA 범위의 정도 (그림 3), 샘플 준비에 대한 몇 가지 유기를 따라 완전히 다른 반응을 생산하는 것을 발견했다 대상을 용해하는 데 사용되는 용매는 높은 마스크 응답을 대상으로 배경), 온도, 소금의 종류와 농도, 및 incuba 원인이 될 수 있습니다(AuNP 및 대상 DNA / AuNP와 두 DNA의) 기 시간. 완전히 최적화 된 조건에서, 결과는 일반적 AuNP의 바이오 센싱 플랫폼의 신속한 응답 대상의 장점을 보여주는, 대상 배양 시간 &lt;5 분으로 관찰된다. 예를 들어,도 5 앱 타머의 인큐베이션 시간에 / AuNP 공정을 30 분에 O /로부터 N (도 3)를 작게하고, 염은 즉시 (&lt;10 초) 목표 첨가 후가 아닌 20 분 후 (도 3을 첨가 ) (73) D / NP의 로딩 밀도. 이것은 이전의 상태 (도 3)를 사용하여 40 % 대 ~ 10 μM 농도에서 표적 코르티솔 응답 ~ 빈 (도 5a)보다 82 % 이상 증가했다. 이 응답은 육안 (그림 5B)와 구별 할 수 있습니다. 코르티솔 검출의 선형 범위가 이전 조건을 이용하여 이러한 조건이 요구에 대해 최적화 될 수 있다는 것을 시사 다르다는 점에주의감지 범위. 콜산 및 2- 메 톡시 나프탈렌 (2MNP) 컨트롤은 중요한 반응 (도 5A-B)를 제조하지 않았다. 연구진은 이러한 배양 시간을 줄이는 것이 전체 향상된 신호 (대상) 또는 배경 (비 표적 분자)에 기여할 수 AuNP 표면 분석의 증가 반응을 용이하게 할 수 있음을 인식해야합니다. 따라서,주의 AuNP 분석 설계 및 성능 특성은 각 앱 타머 / 대상 쌍에 대한 필요가있다. 이 절차는 타겟의 존재를 검출하기 위해 DNA의 형태 변화 등을 요구하는 바와 같은 분석 AuNP 바이오 센싱 플랫폼으로 기능 작은 분자 구조 스위칭 앱 타머를 선택하기위한 프로토콜을 설명한다. 그러나,이 방법은 거의 모든 크기의 타겟에 대해 동일한 기능을 전제로 전기 화학 형광 또는 다른 바이오 센서 시스템에 적용 할 수있다. 프로토콜의 전력은 상기 실험에 의해 개발 될 수있다여러 가지 방법. 우선, 선택 자체가 잠재적으로 양을 줄일 수있을만큼 강하지, 소분자 표적과 상호 작용하기에 충분히 약한 상호 작용을 제공하는 cDNA / 라이브러리 혼성화 이상적인 T의 m을 결정 등의 최적화 방법을 조사함으로써 개선 될 수있다 배경의 시퀀스는 열역학에서 유일하게 dehybridized. 이는 노동 시간을 절약하고 시약 소비 감소, 선택에 필요한 사이클 수를 응축한다. 선택에 대한 수정에 추가 조사는 서열의 다양한 인종 특히 초기 라운드에서, 타겟에 노출되도록 구슬 및 DNA의 가장 바람직한 농도를 결정하는 것이다. 이러한 원리 증명 실험의 성공은 최적화 및 생리 학적 유체에 AuNP 버퍼 분석을 적응으로 추가 자원을 투자 할 수있는 기반을 제공합니다. 신속하고 강력한 바이오 센싱 플랫폼을위한 정당한 필요 쿵푸 수가있다nction은 인간 혈청에서 AuNP 분석의 개인의 생리 학적 상태를 진단 도구 및 추가 개발로, 땀, 타액은이 현재의 격차를 만날 것입니다.

작은 분자는 오래 전부터 생리 학적 독성 또는 영양, 세포 신호, 질병 1 약제 학적 치료 등 다양한 생물학적 과정에 중요한 역할을 수행하는 것으로 인식되고있다. 다양한 작은 분자는 또한 2,3- 응력, 피로 4, 5를 포함하여, 질병 생리적 조건을 나타내는 바이오 마커로서 제안되었다. 예를 들어, 상승 된 코르티솔 수준을 감소 생리 성능 및 기타 건강 상태 6-8 초래할 수 응력과 상관. 마찬가지로, 타액의 특정 펩티드의 비율의 변동은 생리적 증상은 집중력 부족, 손상된 반응 시간 및 감소 된인지 기능을 포함 4 피로의 예측이다. 따라서, 작은 분자의 수준을 모니터링하기위한 특정 타겟 바이오 센서의 개발은 개별 선택의 상태 및 성능을 평가하기위한 기능을 헤아릴 메트릭을 제공 할 수있다idual. 역사적으로, 작은 분자 검출이 노동 집약적 인 분리 기술에 의해 또는 항체 -6,7- 기반 인식에 의해 수행되었다. 더욱 최근에는, 핵산 압 타머 9,10 특정 애플리케이션에서 항체 위에 뚜렷한 장점을 갖는다 인식 요소로 떠오르고있다. (12) 조직으로 금속 이온 (11)에서 다양한 크기의 대상을 결합 할 수있는 능력으로, 앱 타머 널리 바이오 센싱 플랫폼 13, 14의 인식 요소로 적용되고있다. 항체에 비해, 압타는 화학적으로 합성하고, 표면 고정화 또는보고 재현성 화학적 변형을 도입하는 것이 간단하게된다. 항체는 생리 학적 조건 (15, 16)에 한정되는 반면 압타이 사용될 선정 조건을 수정하여 원하는 조건 하에서 고속 목표 특이성 선택 될 수있다. 또한, 압타 토륨 인해 높은 리간드 밀도 할 수있다바이오 센서 플랫폼에서 높은 효율을 시그널링 타겟 결과 작은 크기를 EIR, 압 타머와의 향상된 안정성은 반복 사용 및 장기 저장 센서 (16)을 허용한다. 앱 타머는 서열의 초기 라이브러리가 표적 분자에 결합하는 잠재적으로 여러 개의 (10 (1) -10 (2)) 서열을 함유하는 농축 된 최종 풀에 10 13 -10 15 개의 고유 분자로부터 방출되는 것을 특징으로 SELEX으로 알려진 절차를 이용하여 생성된다. 최종 농축 풀 시퀀싱되고, 해리 상수 (K D는) 표적 분자에 높은 카피 수 서열의 결합 분석에서 얻어진다. 최종 농축 인구 풀의 진화는 최대 농축을받을 때까지, 각 라운드에서 대상을 바인딩 풀의 비율을 모니터링하여 추적됩니다. 이 바인딩 시퀀스 nonbinders과 AMPL에서 분할되어 진화 라운드의 수에서 발생되며,중합 효소 연쇄 반응 (PCR)을 사용하여 지정한 본. 결합제를 효과적으로 분할하고 유지하는 능력에 직접적인 영향을 선택하고 선택된 아프타 머 (15)의 효율 특성의 주요 결정 요소 중 하나이다. 그들이 크기 또는 표적 단백질 1,15의 분할 처리를 돕는 다양한 관능기를 가지지 않기 때문에 SELEX 분할 단계는 더 작은 분자에 대한 도전이다. 예를 들어, 많은 단백질 분할 플랫폼은 그러나 결합 된 DNA-작은 분자 대상 단지의 특성이 효과가 분할 한 결과, 일반적 구속력 시퀀스에 비해 유의 한 차이가 있으며, 크기 나 전하 기반의 분리에 의존하고있다. 대안 SELEX 분할 방법은 잠재적으로 작은 분자의 결합 특성을 변화하는 고정화 또는 타겟의 표시를 포함 할 수있다. 소분자는 R을 타겟 따라서, 선택 절차의 디자인을 생성하는 앱 타머특별한 고려를 equires. 여러 가지의 변형, 분할 절차의 효율을 향상 최종 풀 서열의 특이성 또는 친 화성을 ​​개선하거나, 상이한 애플리케이션 (15, 16)에 더 순종하게 원래 SELEX 방법론에 적용되어왔다. 소분자에 대해 선택할 수있는 하나 SELEX 개질 표적 분자 (17, 18)와 상호 작용시에 형태 적 변화를 겪는다 구조 스위칭 앱 타머, 또는 앱 타머를 생성하도록 설계되었다. 이 방법의 한 예에서, 상기 라이브러리는 자성 비드 (17) 상에 고정화 구속력 상보 DNA의 짧은 조각 (의 cDNA)로 혼성화된다. 대상이 결합되면 nonbinders이 cDNA를 하이브리드 화를 유지하면서, 바인딩 시퀀스의 형태 변화는 / 비즈가 자기 분할 및 폐기, 상등액로를 방출하는 cDNA에서 dehybridize하도록 할 수 있습니다. 이 방법은 ADVAN입니다tageous 소분자 것은 분리를 달성하기 위해 표적 분자의 고정화 나 라벨을 필요로하지 않기 때문이다. 구조 스위칭 할 수있는 앱 타머는 표적 분자의 존재를 검출하는 압 타머의 구조의 변화를 필요로하는 잠재적 바이오 센서 플랫폼의 중요한 기능을 갖는다. 구체적으로는, 압타 소금 도전 19,20 후 표적 분자의 존재 하에서 반응을 비색 생성 구조 스위칭 원리 함수} 세이를 만들 금 나노 입자 (AuNPs)와 결합 될 수있다. AuNP 분석에서 단일 가닥 DNA (ssDNA를) 앱 타머 처음 AuNP 표면에 흡착과 소금의 도전으로부터 보호. 대상의 존재는 소금 또한 다음과 같은 빨간색 - 투 - 블루 색상 변경의 결과로, AuNP 표면을 노출하는 앱 타머의 구조적 변화를 유도한다. AuNP 신호 분석은 또한, 마이크로 몰 친화 앱 타머를 증폭하는 것으로 나타났다s는 해리 상수 (K d를) (21)보다 낮은 크기 수준의 주문에 목표를 검색 할 수 있습니다. 이 기능은 친화력은 일반적으로 낮은 마이크로 몰 밀리몰 농도 1.15의 범위 작은 분자 표적, 특히 매력적이다. 일반적으로, 분석은 바이오 센서 감지 플랫폼으로 앱 타머-AuNP 분석의 추가 연구를 장려하고, 수행도 신속하고 비교적 간단하다. 이 연구의 목적은 대표적인 분자로서 응력 마커를 사용 코티솔 바이오 센싱 응용을위한 작은 분자 구조 스위칭 앱 타머를 선택하기위한 범용 프로토콜을 제공하는 것이다. AuNP 바이오 센서 감지 방식으로 인해 운영 및 비색 판독의 단순함에 관심이지만, 구조 전환 앱 타머는 또한 압 타머 conformatio의 변화를 통해 감지 기능을 제공하는 전기 22 형광 (23)과 같은 대체 감지 플랫폼 출력에 적용 할 수있는대상에 따라 n은 바인딩. 이전 방법에 비해, 다수의 음성 선별 단계는 설계 (17, 18)에 도입하고, 간단한 UV 계 농축 검출 방식은 (도 1)을 시행 하였다. 이 프로토콜은 기존의 방법 (17)에 사용되는 방사성 리간드 농축 검출 방식과는 대조적이다. 제안 된 방법은 또한 최대 24 엔리치 관찰 후에 튜닝을 효과적으로 선택의 엄격 성을 분할 효율을 증가하도록 선택에 사용 된 cDNA 포획 프로브의 길이의 증가를 통합된다. 조정 엄격 최종 풀의 대상이 용출 된 DNA의 낮은 총 비율에 납,하지만 이전 라운드에서 가장 높은 사본 번호 순서에 비해 향상된 친 화성 결합 순서의 높은 사본 번호 결과. 최종 풀에서 높은 카피 수 시퀀스는 시퀀스 플랫폼 의무 것을 설명하기 AuNP 분석에 도포그 바인딩 대상을 나타내는 구조적 변화가 필요합니다. 이 버퍼 기재 분석법은 AuNP 분석법 응답 표면에 도포 DNA의 농도를 변화시킴으로써 변형 될 수 있음을 보여 주며, 원칙의 증명 작동에 작은 분자 앱 타머 기반 AuNP 바이오 센서 개발을 향해 앞으로의 연구 노력을 투자하는 역할 생리적 체액.

<table border="0" cellpadding="0" cellspacing="0" width="639">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:103px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:203px;">Comments/Description</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;">Dynabeads M280 Streptavidin</td>
			<td>Invitrogen</td>
			<td>112.06D</td>
			<td style="width:203px;">Compatible with DynaMag-2 Magnet</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">DynaMag-2 Magnet</td>
			<td>Invitrogen</td>
			<td>12321D</td>
			<td style="width:203px;">Compatible with Dynabeads M280 Streptavidin</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Streptavidin Sepharose High Performance</td>
			<td>GE Healthcare</td>
			<td>17-5113-01</td>
			<td style="width:203px;">This is a high density streptavidin product for ssDNA preparation</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hydrocortisone</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">H4001</td>
			<td style="width:203px;">&#8805;98%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Progesterone</td>
			<td style="width:103px;">Sigma</td>
			<td>P0130</td>
			<td style="width:203px;">&#8805;99%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cholic Acid</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">C1129</td>
			<td style="width:203px;">&#8805;98%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">NanoDrop ND-1000</td>
			<td style="width:103px;">NanoDrop</td>
			<td style="width:119px;">ND-1000</td>
			<td style="width:203px;">Replaced by ND-2000 model</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tris Base</td>
			<td style="width:103px;">Promega</td>
			<td style="width:119px;">H5135</td>
			<td style="width:203px;">&#8805;99.9%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Sodium Chloride</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">S9888</td>
			<td style="width:203px;">&#8805;99.5%</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Magnesium Chloride Hexahydrate</td>
			<td style="width:103px;">Fluka</td>
			<td style="width:119px;">63068</td>
			<td style="width:203px;">&#8805;98%</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">500 mL Filter System</td>
			<td style="width:103px;">Corning</td>
			<td style="width:119px;">430769</td>
			<td style="width:203px;">0.22 &#181;m cellulose acetate membrane</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">DNA Library</td>
			<td style="width:103px;">Operon</td>
			<td style="width:119px;">Custom</td>
			<td style="width:203px;">HPLC purified</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">All other DNA</td>
			<td style="width:103px;">IDT</td>
			<td style="width:119px;">Custom</td>
			<td style="width:203px;">Capture probes and primers- desalted; Aptamers- HPLC</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Thermomixer&#160;</td>
			<td style="width:103px;">Eppendorf</td>
			<td style="width:119px;">R</td>
			<td style="width:203px;">Any model with&#160; temperature and mixing speed control will work</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">PfuUltra II Fusion HotStart DNA Polymerase, 400 rxn</td>
			<td style="width:103px;">Agilent</td>
			<td>600674</td>
			<td style="width:203px;">Taq polymerase can be used as well</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Deoxynucleotide Mix, PCR-Grade&#160;</td>
			<td style="width:103px;">Agilent</td>
			<td>200415</td>
			<td style="width:203px;">Other brands will work here</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">10x Cloned Pfu DNA Polymerase Buffer</td>
			<td style="width:103px;">Agilent</td>
			<td height="42" style="height:42px;width:119px;">200532</td>
			<td height="42" style="height:42px;width:203px;">This buffer was optimized for PfuUltra II polymerase</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">GeneAmp PCR System</td>
			<td style="width:103px;">Applied Biosystems</td>
			<td style="width:119px;">9700</td>
			<td style="width:203px;">Any model that allows researcher to open lid for cycle optimization will work</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Agarose-LE</td>
			<td style="width:103px;">Ambion</td>
			<td style="width:119px;">AM9040</td>
			<td style="width:203px;">&#8805;99.9%</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Ethidium Bromide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">E-1510</td>
			<td style="width:203px;">Acute toxicity, inhalation; suspected carcinogen</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Empty Synthesis Columns, 1 &#181;m Expedite Style</td>
			<td style="width:103px;">Glen Research</td>
			<td style="width:119px;">20-0021-01</td>
			<td style="width:203px;">This model is ideal because of the Luer-Lok fitting to couple with syringe</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Replacement Filters Expedite</td>
			<td style="width:103px;">Glen Research</td>
			<td style="width:119px;">20-0021-0F</td>
			<td style="width:203px;">1 &#181;m size</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Illustra NAP-25 Columns</td>
			<td style="width:103px;">GE Healthcare</td>
			<td style="width:119px;">17-0852-01</td>
			<td style="width:203px;">Any brand with DNA grade resin gel filtration column will work</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Slide-A-Lyzer Dialysis Cassette</td>
			<td style="width:103px;">ThermoFisher Scientific</td>
			<td style="width:119px;">66205</td>
			<td style="width:203px;">2k MWCO used</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Gold(III) chloride hydrate</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">254169</td>
			<td style="width:203px;">99.999% purity is important</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">Sodium Citrate Dihydrate</td>
			<td style="width:103px;">SAFC</td>
			<td style="width:119px;">W302600</td>
			<td style="width:203px;">We have found that the compound produced from different manufacturers greatly affects AuNP assays</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">SpectraMax&#160;</td>
			<td style="width:103px;">Molecular Devices</td>
			<td style="width:119px;">M5</td>
			<td style="width:203px;">Results were similar to Bio-TEK system</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Synergy</td>
			<td style="width:103px;">Bio-TEK</td>
			<td style="width:119px;">HT</td>
			<td style="width:203px;">Results were similar to Molecular Devices system</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">HEPES Buffer</td>
			<td style="width:103px;">Amresco</td>
			<td style="width:119px;">J848</td>
			<td style="width:203px;">Any brand that makes a sterilized product will work</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">250 mL Filter System</td>
			<td style="width:103px;">Corning</td>
			<td style="width:119px;">430767</td>
			<td style="width:203px;">0.22 &#181;m cellulose acetate membrane</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">UV Spectrophophotometer</td>
			<td style="width:103px;">Varian</td>
			<td style="width:119px;">Cary 300&#160;</td>
			<td style="width:203px;">Other brands will work here</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5 mL Syringe</td>
			<td style="width:103px;">Becton-Dickinson</td>
			<td style="width:119px;">309646</td>
			<td style="width:203px;">This model is ideal because of the Luer-Lok fitting to couple with Expedite column</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">ThermoEC Minicell Primo</td>
			<td style="width:103px;">ThermoFisher Scientific</td>
			<td style="width:119px;">EC320</td>
			<td style="width:203px;">Compatible with Power Supply</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Power Supply</td>
			<td style="width:103px;">Fisher Scientific</td>
			<td style="width:119px;">FB300</td>
			<td style="width:203px;">Compatible with ThermoEC Minicell Primo</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Dimethyl Sulfoxide</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">D8418</td>
			<td style="width:203px;">Flammable liquid</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">2 Methoxynaphthalene</td>
			<td style="width:103px;">Sigma</td>
			<td style="width:119px;">148245</td>
			<td>99%</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Assay Plate</td>
			<td style="width:103px;">Corning</td>
			<td style="width:119px;">3370</td>
			<td>96-well Flat Bottom, Sterile</td>
		</tr>
	</tbody>
</table>

a method for selecting structure-switching aptamers applied to a colorimetric gold nanoparticle assay

작은 분자로 인해 인간의 건강과 성능의 다양한 측면의 바이오 마커 등의 생리 학적 의미에 바이오 센싱 애플리케이션을위한 다양한 목표를 제공합니다. 핵산 앱 타머은 점점 바이오 센서 플랫폼에 대한 인식 요소로 적용하지만, 작은 분자 표적을 향해 앱 타머를 선택하면 특별한 디자인 고려 사항을 필요로하고있다. 이 작품은 수정 및 작은 분자 타겟 구조 전환 앱 타머를 선택하기위한 방법의 중요한 단계를 설명합니다. 자석 구슬에 보완 DNA 캡처 프로브에 하이브리드 DNA 라이브러리에서 바인딩 시퀀스 형태의 목표에 의한 변화를 통해 nonbinders에서 분리된다. 지지 매트릭스 (비드)를 결합 서열을 추가로 증폭 될 수 없기 때문에이 방법은 유리이며, 표적 분자의 고정을 필요로하지 않는다. 그러나, 용융 포획 프로브의 온도 및 라이브러리에서 또는 약간 이상으로 유지된다 RT 이러한 시퀀스 t 그열역학에 기초 모자 dehybridize 또한 상등액 존재할 것이다. 이것은 효과적으로 (nonbinders 서열로부터 분리 된 결합 대상 능력) 분할의 효율성을 제한하며, 따라서 다수의 선택은 배경 발사 서열을 제거하기 위해 요구 될 것이다. 보고 된 방법에 의한 음성 선별 단계의 구현을 단순화 농축 모니터링 및 향상된 엄격함을 제공하도록 선택 농축 다음 포획 프로브의 길이 연장 이전 구조 스위칭 앱 타머 선택 다르다. 선택된 구조 스위칭 압타는 앱 타머의 구조적 변화에 의한 표적 분자의 존재를 파악하고 금 나노 입자 분석 플랫폼에서 유리하다. 이 임상 또는 배포 환경에서 유용 간단한 신속한 비색 판독을 제공하기 때문에 금 나노 입자 분석을 도포 하였다. 설계 및 최적화를 고려 증명 pr​​incipl으로 분석에 대해 제공되는버퍼에 전자 작업은 생리 학적 유체의 작은 분자 바이오 센서를 향해 작업의 추가 확장을위한 기반을 제공합니다.

조건의 엄격 처음 처음 몇 라운드에서 낮은 복사 숫자에 존재하는 바인더를 유지할 낮게 유지되었다. 첫 라운드는, 특히, 일반적으로 높은 코티솔과 DNA 농도, 및 음성 선별 단계의 결여에 의해 입증 고유 시퀀스로 제시 결합제를 보존하는 낮은 엄격 성을 구현 하였다. 이 앱 타머 선택의 성공은 라운드 (12 ~ 13) (표 1)에서 상대적으로 일정하게 유지 대상이 용출 더 높은 비율로 대상 (2 라운드)에 의해 용출 낮은 비율의 풀의 진화에 의해 증명된다. 대상이 용출 된 DNA의이 고원은 전통적으로 선택 ( &quot;농축&quot;)에서 엔드 포인트입니다. 그러나,이 방법은 캡쳐 된 cDNA 프로브의 길이를 (도 1)를 증가시켜 농축 한 후 선택의 엄격 성을 높였다. 이 프로브를 늘리면 CDN 사이의 혼성화 강도를 증가풀과, 복합체의 용융 온도 (Tm)가 증가하고, 용액에 바인딩 서열을 해제하고 타겟 서열 간의 강한 상호 작용을 필요. 선택의 초기 라운드 인해 라이브러리의 5 &#39;말단에 하나 이하 G베이스에 약한 cDNA의 상호 작용을 구현했습니다. 이는 첫 번째 라운드에서 일반적으로 낮은 엄격 성 조건을 유지하고 있으며, 크게 다음 선택 라운드에 전달할 가능성이 더 결합제뿐만 아니라 (dehybridize 열역학 기준) 배경 시퀀스를 허용함으로써 이외의 선택에 영향을 미칠 것으로 예상되지 않는다. 선택이 이후의 선택 라운드에서 더 엄격한 조건을 구현하여 농축을 향해 계속 이러한 배경 시퀀스는 최소화되었다. cDNA를이 라운드 14 8 메르 7 메르에서 연장되었을 때, 대상이 용출 된 DNA의 비율이 T m에서 11.1 %로 15.3 %에서 감소는 26.7 ° C 19.2 ° C로 증가. cDNA를 w등의 추가 3.3 %로 용출 총을 삭제, 31.3 ° C의 T의 m 라운드 15 9 메르 확장. 농축에 대한 추가 정보는 각 라운드에서 풀의 진행을 추적하기 위해, 몇몇 풀 모두 농축 및 비 - 농후 예를 시퀀싱함으로써 얻을 수있다. 차세대 시퀀싱 (NGS)이 높은 순서 생거 시퀀싱에 비해 (시퀀스의 총 수를보고) 획득 읽어 주로하기 때문에, 선택의 순서를위한 강력한 방법으로 떠오르고있다. 이러한 높은 시퀀스는 풀 시퀀스들의 총수의 더 큰 커버리지를 제공 서열의 다양성을 더 완벽한 그림을 제공 읽는다. NGS는 클로닝 바이어스 (32)를 제거하고, 바코드 24,33의 첨가 일괄 적 다중 풀 시퀀싱을 허용한다. NGS는이 샘플 선택에서 세 개의 분리 된 풀 (도 2)에서 농축의 진행을 분석하는데 사용 하였다. 풀6 라운드 13 (가장 높은 농축) 및 라운드 15 (가장 높은 엄격) (약간의 농축이 용출 %로 2 라운드에 비해)의 둘레에서는 선택의 대표 지점으로 선정 하였다. 시퀀스의 총 수의 비율이 각각의 풀에 대한 판독 각 고유 서열의 카피 수는 플롯 하였다. 위 상단 (가장 높은 사본 번호) 순서는 모든 라운드 6 시퀀스 (33,435 전체 시퀀스, 22,463 고유 한 시퀀스)의 0.1 %를 구성. 풀을 최대한 라운드 (13)가 풍부 해짐에 따라 순위가 높은 순서 증가는 UV에 의해 관찰 농축 만 ~ 5 배 증가에도 불구하고 6 라운드에서보다 150 배 높은 전체 풀의 15.4 % (17,681 전체 시퀀스, 2987 고유 한 시퀀스)를 포함하는 . 라운드 15 (28,919 총 시퀀스 2980, 판독 고유 시퀀스) UV 농축 모니터링 대상 용출 양 라운드 (13)의보다 ~ 5 배 낮았다 비록 단일 상부 순위 순서로 표시 모든 시퀀스들의 44.9 %로 점프 ( 표 1 </str옹&gt;). 심화 학습은 풀 대상이 될 가능성이 바인딩 여러 시퀀스로부터 많은 발전함에 따라 고유 한 시퀀스의 낮은 비율 (라운드 15에서 10 %에 라운드 6의 67 %)에 의해 증명된다. cDNA의 길이를 연장하고, 라운드 (13)에서 두 번째 순위 순서는 라운드 (15)에서 가장 높은 카피 수 시퀀스를 낳은 후에 또한, 원형도 13 (15-3)의 순위가 높은 순서는 라운드 (15)에서 세 번째로 높은 카피 수 서열이었다 (15 -1) : 15-1 GGAATGGATCCACATCCATGGATGGGCAATGCGGGGTGGAGAATGGTTGCCGCACTTCGGCTT CACTGCAGACTTGACGAAGCTT 15-3 GGAATGGATCCACATCCATGGGAGGGTTGGAAGGGAGGGGCCCGGGGTGGGCCATCGTTCGTT CACTGCAGACTTGACGAAGCTT 이전의 연구는 마이크로하여 열 평형 투석 (24)에 의해이 두 시퀀스의 바인딩을 조사했다. 결과는 6.9 ± 2.8 μM 평형 투석 = 순서 15-1 (K d를 바인딩 중요한 코티솔을 보여 주었다 16.177; 마이크로 열 영동 0.6 μM)는 최소한의 바인딩 동안 코티솔과 순서 15-3 사이에 관찰되었다. 이 둥근 15 포획 프로브의 길이가 증가 높은 친 화성 바인더를 파싱 높은 엄격 성 조건을 제공하는데 도움을 보여준다. 또한, 어느 시퀀스가​​ 음성 선별 단계의 부가를 나타내는, 음성 선별 분자, 프로게스테론 결합 관측 증명 절차에 유익 하였다. 높은 친 화성 결합 제가 상승 된 엄격 조건 선택의 추가적인 라운드에서 적용된 이후에 (표적 용출 DNA의 비율을 분석하는 기존의 방법에 의해 측정) 최대 농축 다음 출현한다는 사실은 cDNA를 캡처의 길이를 연장하는 방법을 유효화 후 농축 프로브. 대상에 대한 시퀀스 수영장과 친화력 번호를 복사이 결과 쇼는 사기꾼에, 특정 조건 (24, 34)에서 관련 될 수있다직접적인 상관 관계 (35)을 의미 이전 보고서와 대조적. 또한 오히려 전적으로 높은 엄격도 조건이 적용되는 바와 같이, 다음에 한 라운드에서 가장 자연적으로 변할 수있는 일반적인 선택 % 용출 전략보다는, NGS 의해 모니터링 농축의 장점을 강조하고있다. 유사한 조건이 몇 차례에 걸쳐 적용되는 경우에는, 용출 % 모니터링 농축 유용합니다. 예를 들어, 농축에 특별한 변화 (표 1)과, 6-10 관련된 모든 유사한 조건을 반올림합니다. 이것을 몇 차례에 걸쳐 관찰 될 때, 조건 가능성 농축을 촉진하기에 너무 엄격하고, 연구자들은 다음 라운드에서 엄격함을 감소한다. ,를 조절하기위한 가이드 역할을 할 수 용출 %를 예를 들어, 코르티솔 농도는 발사 11-13 100 μM 35 μM로 증가시키고, % 따라서 라운드 (12)에 14.5 %로 라운드 (10)에서 2.5 %로 증가 용리 선택의 과정 동안 엄격 similAR 조건 라운드 라운드에서 비교하고, 선택을 결정하기위한 엔드 포인트 NGS에 상보적인 정보를 제공 할 수있다. 시퀀스 15-1 방식으로 선택 시퀀스 구조 스위칭 앱타 응답을 생성하기 위해 다음의 표적 결합 구조 변화에 의존하는 분석에서 작동 할 경우 생산 AuNP 판별 분석법에 적용 하였다. 이전 초기 연구는 15-1로 AuNP 분석은 스트레스 바이오 마커 코티솔에 반응하지만, 스트레스, 에피네프린과 노르 에피네프린, 또는 콜산의하지에 두 개의 다른 마커, 구조적으로 유사한 간 질환의 마커 24 코르티손 것으로 나타났다. 응답은 코르티솔 바인딩시 구조적 변화 선정 앱타 AuNP 분석에서 응답을 생성하는 것이 검증 인간 혈청 (~ 150-600 ㎚) (6)에보고 된 자유 코티솔의 정상 범위에서 관찰되었다. 이 현재 작업, 시스템의 특성을 조정하여 한 단계를 찍은AuNP 표면에 15-1의 적용 범위 (밀도). 조건의 동일한 세트를 사용하여, DNA의 120에 따르면 D / D (200) 및 NP / NP (도 3)에, (73) D / NP (DNA 분자 / AuNP)로 증가 하였다. 콜산 200 D / NP 10 μM 제외한 최소 응답을 생성했다. 검출 한계 (LOD)를처럼 커버리지 감소 분석의 응답은 증가 하였다. LOD는 73 D / NP, 120 D / 순이익 145.2 nm의, 200 D / NP 27.3 μM에 대해 29.5 nm였다. 이 결과에 따르면 압 타머 (300)는 D / NP 36 60 D / NP로 증가되었을 때 코카인 앱 타머를 이용한 분석법 AuNP 응답이 감소한 도시 스미스 등. 작품의 동의. 이는 관심 대상의 검출 범위가 조정 AuNP 분석에서 DNA 흡착율을 기반으로 최적화 될 수 있다는 것을 의미한다. 예를 들어, 비교 할 때 도움이 될 수있는, 인간 혈청 인간의 침 대 (~ 150-600 nm의) (~ 25nm의) 무료 코티솔의 범위 &lt;SUP&gt; 6,37. 생리적 유체는이 버퍼 분석보다 훨씬 더 복잡하지만, 결과는 애플리케이션에 따라 AuNP 조건이 조절 될 수 있음을 보여주는 원리 증명 작업에 연장 및 생체 액에 매질을 확대하는 것 향해 그 추가 작업을 제공 바이오 센서 지역 사회의 관심. <img alt="그림 1" src="/files/ftp_upload/52545/52545fig1highres.jpg" /> 도 구조 전환의 선택 방법 1. 개관. 작은 비오틴 포획 된 cDNA 프로브는 스트렙 타비 딘 - 코팅 된 자성 비드에 고정화된다. cDNA를 비드 라이브러리를 혼성화, 라이브러리의 5&#39;- 영역에 상보 적이다. 타겟이 추가되는 경우, 구조적 변화는 자석을 적용하여 용이하게 분할 수 비드 바인딩 서열을 해제 유도된다. 상청액 (%의 DNA가 용출 번째 농축을 모니터링하도록 유지DNA에서 대상을 투석 후 UV에 의한 전자 대상). 표적 분자는 DNA와 같은 UV 범위에서 흡수하는 경우이 단계는 필수적이다. 그런 다음, 그 서열을 PCR 증폭 및 선택의 다음 라운드를위한 준비가되어 있습니다. 선택이 진행됨에 따라, 음성 선별은 음성 선별에 의해 용출 분자 서열은 폐기되는 경우, 도포하고, 잠재적 인 타겟 결합제 비드이어서 타겟 인큐베이션. cDNA를 프로브의 길이는 선택의 엄격 성을 증가시키기 최대 엔리치 (용출 %)에 이어 증가한다. 이 수치가 24에서 허가 재판되었습니다. <a href="https://www.jove.com/files/ftp_upload/52545/52545fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 둥근 </td><td> [코르티솔] (μM) </td><td> [프로게스테론 (μM) </td><td>바운드 DNA (pmol의) </td><td> % 대상으로 용출 </td><td> cDNA의 길이 </td></tr><tr><td> (1) </td><td> (100) </td><td> 0 </td><td> 357.57 </td><td> N / A </td><td> 7 머 </td></tr><tr><td> 이 </td><td> (50) </td><td> 0 </td><td> 145.49 </td><td> 1.4 </td><td> 7 머 </td></tr><tr><td> 3 </td><td> (50) </td><td> (1) </td><td> 188.74 </td><td> N / A </td><td> 7 머 </td></tr><tr><td> 4 </td><td> (50) </td><td> (5) </td><td> 336.4 </td><td> 2.3 </td><td> 7 머 </td></tr><tr><td> (5) </td><td> (35) </td><td> (5) </td><td> 88.05 </td><td> N / A </td><td> 7 머 </td></tr><tr><td> (6) </td><td> (35) </td><td> (10) </td><td> 303.89 </td><td> 3.1 </td><td> 7 머 </td></tr><tr><td> 7 </td><td> (35) </td><td> (10) </td><td> 255.01 </td><td> N / A </td><td> 7 머 </td></tr><tr><td> 8 </td><td> (35) </td><td> (10) </td><td> 236.81 </td> &lt;TD&gt; 2.1 </td><td> 7 머 </td></tr><tr><td> 9 </td><td> (35) </td><td> (10) </td><td> 318.95 </td><td> 2.6 </td><td> 7 머 </td></tr><tr><td> (10) </td><td> (35) </td><td> (10) </td><td> 297.18 </td><td> 2.5 </td><td> 7 머 </td></tr><tr><td> (11) </td><td> (100) </td><td> (10) </td><td> 147.61 </td><td> N / A </td><td> 7 머 </td></tr><tr><td> (12) </td><td> (100) </td><td> (10) </td><td> 154.36 </td><td> 14.5 </td><td> 7 머 </td></tr><tr><td> (13) </td><td> (100) </td><td> (10) </td><td> 150.39 </td><td> 15.3 </td><td> 7 머 </td></tr><tr><td> (14) </td><td> (75) </td><td> (20) </td><td> 247.71 </td><td> 11.1 </td><td> 8 머 </td></tr><tr><td> (15) </td><td> (50) </td><td> (40) </td><td> 409.63 </td><td> 3.3 </td><td> 9 머 </td></tr></tbody></table> % 용출 (24) &lt;으로 표 1. 선택의 진행 및 농축<html> (해당 사항 없음) 강한&gt;. N / A는 투석 / UV 농축 모니터링 copy 수가 적은 시퀀스의 손실을 완화하기 위해 초기 선택 라운드에서 수행되지 않았습니다 라운드보고됩니다. 이 테이블은 24에서 허가 재판되었습니다. <img alt="그림 2" src="/files/ftp_upload/52545/52545fig2highres.jpg" /> 차세대 시퀀싱에 의해 결정도 2 선택 엔리치 (A) 6 라운드.; (B) 원형 (13); (C) 원형 (15) 시퀀스는 번호를 복사에 따라 순위가 결정되었다. 가장 높은 사본 번호 순서는 풀 코티솔 바인딩 시퀀스 강화되면서 라운드 15 (44.9 %)에서 높은 비율로 라운드 6 (0.1 %)의 전체 염기 서열을 풀의 낮은 비율을 구성하는 증가. 이 수치는 24에서 허가 재판되었습니다.등 = &quot;_ 빈&quot;&gt;이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오. <img alt="그림 3" src="/files/ftp_upload/52545/52545fig3highres.jpg" /> 앱 타머 15-1 범위를 다양한에서 그림 3. AuNP 분석 응답. AuNPs 배양 앱 타머의 밀도는 120 D / NP (녹색 사각형) 200 D / NP (에, 73 D / NP (빨간색 삼각형)에서 증가 하였다 파란색 원). 코르티솔 응답이 대담한 색상이며, 콜산 응답은 밝은 색상입니다. 분석 그래서 응답 LOD와 타겟 내에서 검출 될 수 범위를 저하 저밀도에서 코티솔 향상된다. 높은 코티솔 응답 (73 D / NP)과 5-25 nM의 조건 (인간 혈청 (~ 150~500 ㎚) 및 타액에보고 자유 코티솔 예상 정상 범위 이상의 지점을 제공하기 위해 선형 영역에서 더 특징 지어 ) 6,37. 동일한 73 D / NP 조건을 적용 콜산의 최소 응답 될 갖는다실내는 이전의 연구 (24)에 자세히 설명합니다. 모든 플롯 중복 또는 세중의 측정을위한 SEM ± 평균을 나타냅니다. <img alt="그림 4" src="/files/ftp_upload/52545/52545fig4highres.jpg" /> . PCR 사이클 최적화에서 그림 4. 대표 결과에서 우물을 왼쪽에서 오른쪽 대표 : 4 회, 6 회, 8 회, 10 회, 12 회, 부정적 (아니오 DNA 템플릿), 25 bp의 DNA 사다리 표준을. 최적의 조건은 하나의 제품 대역이 더 높은 사이클에 존재하는 이상 증폭 제품없이 높은 강도로 8주기에서 관찰된다. <img alt="그림 5" src="/files/ftp_upload/52545/52545fig5highres.jpg" /> 도 5 AuNP 분석 배양 시간 최적화. (73)에서 D AuNP / DNA 단계의 배양 시간 / O로부터 NP가 감소 / N (도 3) 30 분, 및 목표 incubation 즉시 소금을 첨가하지 않고 20 분 (그림 3) 이후 하였다. (A) 응답은 코티솔 (블루 다이아몬드) 관찰되지만,하지 콜산 (녹색 원) 또는 2MNP (2- 메 톡시 나프탈렌, 빨간색 사각형)를 참조하십시오. 모든 플롯 중복 또는 세중의 측정을위한 SEM ± 평균을 나타냅니다. 왼쪽에서 오른쪽 (B) : 빈, 10 μM 코티솔, 10 μM 콜산, 10 μM 2MNP. 시각적 인 변화가 코티솔의 육안으로 관찰 할 수있다. <a href="https://www.jove.com/files/ftp_upload/52545/52545fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

Watch this Scientific Journal Video about A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay at JoVE.com

A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

A protocol is provided to select structure-switching aptamers for small molecule targets based on a tunable stringency magnetic bead selection method. Aptamers selected with structure-switching properties are beneficial for assays that require a conformational change to signal the presence of a target, such as the described gold nanoparticle assay.

색채 금 나노 입자 분석에 적용 구조 전환 앱 타머를 선택하는 방법

Small molecules provide rich targets for biosensing applications due to their physiological implications as biomarkers of various aspects of human health ...

a-method-for-selecting-structure-switching-aptamers-applied-to

Research

JoVE Journal

Biology

15.0K 조회수.  Wright-Patterson Air Force Base. A protocol is provided to select structure-switching aptamers for small molecule targets based on a tunable stringency magnetic bead selection method. Aptamers selected with structure-switching properties are beneficial for assays that require a conformational change to signal the presence of a target, such as the described gold nanoparticle assay.

비디오: A Method for Selecting Structure-switching Aptamers Applied to a Colorimetric Gold Nanoparticle Assay

Hi-C: A Method to Study the Three-dimensional Architecture of Genomes.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, into close spatial proximity 2-6. Deciphering the relationship between chromosome organization and genome activity will aid in understanding genomic processes, like transcription and replication. However, little is known about how chromosomes fold. Microscopy is unable to distinguish large numbers of loci simultaneously or at high resolution. To date, the detection of chromosomal interactions using chromosome conformation capture (3C) and its subsequent adaptations required the choice of a set of target loci, making genome-wide studies impossible 7-10.
We developed Hi-C, an extension of 3C that is capable of identifying long range interactions in an unbiased, genome-wide fashion. In Hi-C, cells are fixed with formaldehyde, causing interacting loci to be bound to one another by means of covalent DNA-protein cross-links. When the DNA is subsequently fragmented with a restriction enzyme, these loci remain linked. A biotinylated residue is incorporated as the 5' overhangs are filled in. Next, blunt-end ligation is performed under dilute conditions that favor ligation events between cross-linked DNA fragments. This results in a genome-wide library of ligation products, corresponding to pairs of fragments that were originally in close proximity to each other in the nucleus. Each ligation product is marked with biotin at the site of the junction. The library is sheared, and the junctions are pulled-down with streptavidin beads. The purified junctions can subsequently be analyzed using a high-throughput sequencer, resulting in a catalog of interacting fragments.
Direct analysis of the resulting contact matrix reveals numerous features of genomic organization, such as the presence of chromosome territories and the preferential association of small gene-rich chromosomes. Correlation analysis can be applied to the contact matrix, demonstrating that the human genome is segregated into two compartments: a less densely packed compartment containing open, accessible, and active chromatin and a more dense compartment containing closed, inaccessible, and inactive chromatin regions. Finally, ensemble analysis of the contact matrix, coupled with theoretical derivations and computational simulations, revealed that at the megabase scale Hi-C reveals features consistent with a fractal globule conformation.

The Hi-C method allows unbiased, genome-wide identification of chromatin interactions (1). Hi-C couples proximity ligation and massively parallel sequencing. The resulting data can be used to study genomic architecture at multiple scales: initial results identified features such as chromosome territories, segregation of open and closed chromatin, and chromatin structure at the megabase scale.

안녕하세요 - C : Genomes의 3 차원 구조를 공부하는 방법.

The three-dimensional folding of chromosomes compartmentalizes the genome and and can bring distant functional elements, such as promoters and enhancers, ...

연구

생물학

Conversion of a Capture ELISA to a Luminex xMAP Assay using a Multiplex Antibody Screening Method

The enzyme-linked immunosorbent assay (ELISA) has long been the primary tool for detection of analytes of interest in biological samples for both life science research and clinical diagnostics. However, ELISA has limitations. It is typically performed in a 96-well microplate, and the wells are coated with capture antibody, requiring a relatively large amount of sample to capture an antigen of interest . The large surface area of the wells and the hydrophobic binding of capture antibody can also lead to non-specific binding and increased background. Additionally, most ELISAs rely upon enzyme-mediated amplification of signal in order to achieve reasonable sensitivity. Such amplification is not always linear and can thus skew results.
In the past 15 years, a new technology has emerged that offers the benefits of the ELISA, but also enables higher throughput, increased flexibility, reduced sample volume, and lower cost, with a similar workflow 1, 2. Luminex xMAP Technology is a microsphere (bead) array platform enabling both monoplex and multiplex assays that can be applied to both protein and nucleic acid applications 3-5. The beads have the capture antibody covalently immobilized on a smaller surface area, requiring less capture antibody and smaller sample volumes, compared to ELISA, and non-specific binding is significantly reduced. Smaller sample volumes are important when working with limiting samples such as cerebrospinal fluid, synovial fluid, etc. 6. Multiplexing the assay further reduces sample volume requirements, enabling multiple results from a single sample.
Recent improvements by Luminex include: the new MAGPIX system, a smaller, less expensive, easier-to-use analyzer; Low-Concentration Magnetic MagPlex Microspheres which eliminate the need for expensive filter plates and come in a working concentration better suited for assay development and low-throughput applications; and the xMAP Antibody Coupling (AbC) Kit, which includes a protocol, reagents, and consumables necessary for coupling beads to the capture antibody of interest. (See Materials section for a detailed list of kit contents.)
In this experiment, we convert a pre-optimized ELISA assay for TNF-alpha cytokine to the xMAP platform and compare the performance of the two methods 7-11. TNF-alpha is a biomarker used in the measurement of inflammatory responses in patients with autoimmune disorders.
We begin by coupling four candidate capture antibodies to four different microsphere sets or regions. When mixed together, these four sets allow for the simultaneous testing of all four candidates with four separate detection antibodies to determine the best antibody pair, saving reagents, sample and time. Two xMAP assays are then constructed with the two most optimal antibody pairs and their performance is compared to that of the original ELISA assay in regards to signal strength, dynamic range, and sensitivity.

An ELISA can be easily converted to a Luminex xMAP assay and, through the benefits of multiplexing, several antibodies can be screened simultaneously to identify an optimum antibody pair, resulting in increased sensitivity and dynamic range, while reducing assay cost.

멀티 플렉스 항체 검사 방법을 사용하여 Luminex xMAP 분석에 캡처 엘리사의 전환

The enzyme-linked immunosorbent assay (ELISA) has long been the primary tool for detection of analytes of interest in biological samples for both life ...

Whole-Body Nanoparticle Aerosol Inhalation Exposures

Inhalation is the most likely exposure route for individuals working with aerosolizable engineered nano-materials (ENM). To properly perform nanoparticle inhalation toxicology studies, the aerosols in a chamber housing the experimental animals must have: 1) a steady concentration maintained at a desired level for the entire exposure period; 2) a homogenous composition free of contaminants; and 3) a stable size distribution with a geometric mean diameter &lt; 200 nm and a geometric standard deviation &sigma;g &lt; 2.5 5. The generation of aerosols containing nanoparticles is quite challenging because nanoparticles easily agglomerate. This is largely due to very strong inter-particle forces and the formation of large fractal structures in tens or hundreds of microns in size 6, which are difficult to be broken up. Several common aerosol generators, including nebulizers, fluidized beds, Venturi aspirators and the Wright dust feed, were tested; however, none were able to produce nanoparticle aerosols which satisfy all criteria 5.
A whole-body nanoparticle aerosol inhalation exposure system was fabricated, validated and utilized for nano-TiO2 inhalation toxicology studies. Critical components: 1) novel nano-TiO2 aerosol generator; 2) 0.5 m3 whole-body inhalation exposure chamber; and 3) monitor and control system. Nano-TiO2 aerosols generated from bulk dry nano-TiO2 powders (primary diameter of 21 nm, bulk density of 3.8 g/cm3) were delivered into the exposure chamber at a flow rate of 90 LPM (10.8 air changes/hr). Particle size distribution and mass concentration profiles were measured continuously with a scanning mobility particle sizer (SMPS), and an electric low pressure impactor (ELPI). The aerosol mass concentration (C) was verified gravimetrically (mg/m3). The mass (M) of the collected particles was determined as M = (Mpost-Mpre), where Mpre and Mpost are masses of the filter before and after sampling (mg). The mass concentration was calculated as C = M/(Q*t), where Q is sampling flowrate (m3/min), and t is the sampling time (minute). The chamber pressure, temperature, relative humidity (RH), O2 and CO2 concentrations were monitored and controlled continuously. Nano-TiO2 aerosols collected on Nuclepore filters were analyzed with a scanning electron microscope (SEM) and energy dispersive X-ray (EDX) analysis.
In summary, we report that the nano-particle aerosols generated and delivered to our exposure chamber have: 1) steady mass concentration; 2) homogenous composition free of contaminants; 3) stable particle size distributions with a count-median aerodynamic diameter of 157 nm during aerosol generation. This system reliably and repeatedly creates test atmospheres that simulate occupational, environmental or domestic ENM aerosol exposures.

A whole-body nanoparticle aerosol inhalation exposure facility was constructed for nano-sized titanium dioxide (TiO2) inhalation toxicology studies. This system provides nano-TiO2 aerosol test atmospheres that have: 1) a steady mass concentration; 2) a homogenous composition free of contaminants; and 3) a stable particle size distribution during aerosol generation.

전신 나노 입자 에어로졸 흡입 노출

Inhalation is the most likely exposure route for individuals working with aerosolizable engineered nano-materials (ENM). To properly perform nanoparticle ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

라이브의 검출<em&gt; 대장균</em&gt; O157 : PMA-qPCR에 의한 H7 셀

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

qPCRTag 분석 - 높은 처리량, Sc2.0 유전형에 대한 실시간 PCR 분석

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Design and Development of Aptamer&#8211;Gold Nanoparticle Based Colorimetric Assays for In-the-field Applications

The design and development of an aptamer&#8211;gold nanoparticle (AuNP) colorimetric assay for the detection of small molecules for in-the-field applications was examined. Target selective AuNP based color assays have been developed in controlled proof-of-concept laboratory settings. However, these schemes have not been exerted to a point of failure to determine their practical use beyond laboratory settings. This work describes a generic approach to design, develop, and troubleshoot an aptamer-AuNP colorimetric assay for small molecule analytes and using the assay for in-the-field settings. The assay is advantageous because adsorbed aptamers passivate the nanoparticle surfaces and provide a means to reduce and eliminate false positive responses to non-target analytes. Transitioning this system to practical uses required defining not only the shelf-life of the aptamer-AuNP assay, but establishing methods and procedures for extending the long-term storage capabilities. Also, one of the recognized concerns with colorimetric readout is the burden placed on analysts to accurately identify often subtle changes in color. To lessen the responsibility on analysts in the field, a color analysis protocol was designed to perform the color identification duties without the need for performing this task on laboratory grade equipment. The method for creating and testing the data analysis protocol is described. However to understand and influence the design of adsorbed aptamer assays, the interactions associated with the aptamer, target, and AuNPs require further study. The knowledge gained could lead to tailoring aptamers for improved functionality.

The design and development of an aptamer&#8211;gold nanoparticle colorimetric assay for the detection of small molecules for in-the-field applications was examined. Additionally, a smart-device colorimetric application (app) was validated and long-term storage of the assay was established for use in the field.

인 - 더 - 필드 응용 프로그램에 대한 설계 및 앱 타머 - 금 나노 입자 기반 비색 분석법 개발

The design and development of an aptamer&#8211;gold nanoparticle (AuNP) colorimetric assay for the detection of small molecules for in-the-field ...

The Lactate Dehydrogenase Sequestration Assay &#8212; A Simple and Reliable Method to Determine Bulk Autophagic Sequestration Activity in Mammalian Cells

Bulk autophagy is characterized by the sequestration of large portions of cytoplasm into double/multi-membrane structures termed autophagosomes. Here a simple protocol to monitor this process is described. Moreover, typical results and experimental validation of the method under autophagy-inducing conditions in various types of cultured mammalian cells are provided. During bulk autophagy, autophagosomes sequester cytosol, and thereby also soluble cytosolic proteins, alongside other autophagic cargo. LDH is a stable and highly abundant, soluble cytosolic enzyme that is non-selectively sequestered into autophagosomes. The amount of LDH sequestration therefore reflects the amount of bulk autophagic sequestration. To efficiently and accurately determine LDH sequestration in cells, we employ an electrodisruption-based fractionation protocol that effectively separates sedimentable from cytosolic LDH, followed by measurement of enzymatic activity in sedimentable fractions versus whole-cell samples. Autophagic sequestration is determined by subtracting the proportion of sedimentable LDH in untreated cells from that in treated cells. The advantage of the LDH sequestration assay is that it gives a quantitative measure of the autophagic sequestration of endogenous cargo, as opposed to other methods that either involve ectopic expression of sequestration probes or semi-quantitative protease protection analyses of autophagy markers or receptors.

The Lactate Dehydrogenase Sequestration Assay &amp;#8212; A Simple and Reliable Method to Determine Bulk Autophagic Sequestration Activity in Mammalian Cells

Here a simple and well-validated protocol for measuring bulk autophagic sequestration activity in mammalian cells is described. The method is based on quantifying the proportion of lactate dehydrogenase (LDH) in sedimentable cell fractions compared to total cellular LDH levels.

젖 산 효소 격리 분석 결과-간단 하 고 신뢰할 수 있는 결정 하는 방법을 포유류 세포에서 대량 Autophagic 격리 활동

Bulk autophagy is characterized by the sequestration of large portions of cytoplasm into double/multi-membrane structures termed autophagosomes. Here a ...

Tethered Bilayer Lipid Membranes to Monitor Heat Transfer between Gold Nanoparticles and Lipid Membranes

Here we report a protocol to investigate the heat transfer between irradiated gold nanoparticles (GNPs) and bilayer lipid membranes by electrochemistry using tethered bilayer lipid membranes (tBLMs) assembled on gold electrodes. Irradiated modified GNPs, such as streptavidin-conjugated GNPs, are embedded in tBLMs containing target molecules, such as biotin. By using this approach, the heat transfer processes between irradiated GNPs and model bilayer lipid membrane with entities of interest are mediated by a horizontally focused laser beam. The thermal predictive computational model is used to confirm the electrochemically induced conductance changes in the tBLMs. Under the specific conditions used, detecting heat pulses required specific attachment of the gold nanoparticles to the membrane surface, while unbound gold nanoparticles failed to elicit a measurable response. This technique serves as a powerful detection biosensor which can be directly utilized for the design and development of strategies for thermal therapies that permits optimization of the laser parameters, particle size, particle coatings and composition.

This work outlines a protocol to achieve dynamic, non-invasive monitoring of heat transfer from laser-irradiated gold nanoparticles to tBLMs. The system combines impedance spectroscopy for the real-time measurement of conductance changes across the tBLMs, with a horizontally focused laser beam that drives gold nanoparticle illumination, for heat production.

금 나노 입자와 지질 막 사이의 열 전달을 모니터링하는 테더링 된 바이 레이어 지질 멤브레인

Here we report a protocol to investigate the heat transfer between irradiated gold nanoparticles (GNPs) and bilayer lipid membranes by electrochemistry ...

Nanoparticle Tracking Analysis for the Quantification and Size Determination of Extracellular Vesicles

The physiological and pathophysiological roles of extracellular vesicles (EVs) have become increasingly recognized, making the EV field a quickly evolving area of research. There are many different methods for EV isolation, each with distinct advantages and disadvantages that affect the downstream yield and purity of EVs. Thus, characterizing the EV prep isolated from a given source by a chosen method is important for interpretation of downstream results and comparison of results across laboratories. Various methods exist for determining the size and quantity of EVs, which can be altered by disease states or in response to external conditions. Nanoparticle tracking analysis (NTA) is one of the prominent technologies used for high-throughput analysis of individual EVs. Here, we present a detailed protocol for quantification and size determination of EVs isolated from mouse perigonadal adipose tissue and human plasma using a breakthrough technology for NTA representing major advances in the field. The results demonstrate that this method can deliver reproducible and valid total particle concentration and size distribution data for EVs isolated from different sources using different methods, as confirmed by transmission electron microscopy. The adaptation of this instrument for NTA will address the need for standardization in NTA methods to increase rigor and reproducibility in EV research.

We demonstrate how to use a novel nanoparticle tracking analysis instrument to estimate the size distribution and total particle concentration of extracellular vesicles isolated from mouse perigonadal adipose tissue and human plasma.

세포외 소포의 정량화 및 크기 측정을 위한 나노 입자 추적 분석

The physiological and pathophysiological roles of extracellular vesicles (EVs) have become increasingly recognized, making the EV field a quickly evolving ...

A Step-By-Step Method to Detect Neutralizing Antibodies Against AAV using a Colorimetric Cell-Based Assay

Recombinant adeno-associated viruses (rAAV) have proven to be a safe and successful vector for transferring genetic material to treat various health conditions in both the laboratory and the clinic. However, pre-existing neutralizing antibodies (NAbs) against AAV capsids pose an ongoing challenge for the successful administration of gene therapies in both large animal experimental models and human populations. Preliminary screening for host immunity against AAV is necessary to ensure the efficacy of AAV-based gene therapies as both a research tool and as a clinically viable therapeutic agent. This protocol describes a colorimetric in vitro assay to detect neutralizing factors against AAV serotype 6 (AAV6). The assay utilizes the reaction between an AAV encoding an alkaline phosphatase (AP) reporter gene and its substrate NBT/BCIP, which generates an insoluble quantifiable purple stain upon combination. 
In this protocol, serum samples are combined with an AAV expressing AP and incubated to permit potential neutralizing activity to occur. Virus serum mixture is subsequently added to cells to allow for viral transduction of any AAVs that have not been neutralized. The NBT/BCIP substrate is added and undergoes a chromogenic reaction, corresponding to viral transduction and neutralizing activity. The proportion of area colored is quantitated using a free software tool to generate neutralizing titers. This assay displays a strong positive correlation between coloration and viral concentration. Assessment of serum samples from sheep before and after administration of a recombinant AAV6 led to a dramatic increase in neutralizing activity (125 to &gt;10,000-fold increase). The assay displayed adequate sensitivity to detect neutralizing activity in &gt;1:32,000 serum dilutions. This assay provides a simple, rapid, and cost-effective method to detect NAbs against AAVs.

A comprehensive laboratory protocol and analysis workflow are described for a rapid, cost-effective, and straightforward colorimetric cell-based assay to detect neutralizing elements against AAV6.

색색세포 기반 분석법을 사용하여 AAV에 대한 항체 중화를 검출하는 단계별 방법

Recombinant adeno-associated viruses (rAAV) have proven to be a safe and successful vector for transferring genetic material to treat various health ...