Name: determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example
Uploaded: 2016-10-26T14:00:00
Description: Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

The authors thank Izon Science Ltd for their support. The work was supported by the European Commission for Research (PCIG11-GA-2012-321836 Nano4Bio).&#160;

1. Making the Phosphate Buffered Saline with Tween-20 (PBST) Buffer
<ol>
	<li>Dissolve one PBS tablet (0.01 M phosphate buffer, 0.0027 M Potassium Chloride, 0.137 M Sodium Chloride, pH 7.4) in 200 ml deionized water (18.2 M&#8486; cm).</li>
	<li>Add 100 &#181;l (0.05 (v/v)%) Tween-20 to the 200 ml buffer solution as a surfactant.</li>
</ol>
2. Preparing the Carboxyl Polystyrene Particle Standards
<ol>
	<li>Vortex the calibration particles for 30 sec before sonication for 2 min at 80 watts to c...

<ol>
	<li>Alexander, C. M., Maye, M. M., Dabrowiak, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-capped+nanoparticles+designed+for+doxorubicin+drug+delivery.">DNA-capped nanoparticles designed for doxorubicin drug delivery.</a> Chem Commun. 47 (12), 3418-3420 (2011).</li><li>Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer+based+dispersion+assay+using+tunable+resistive+pulse+sensing+(TRPS).">Aptamer based dispersion assay using tunable resistive pulse sensing (TRPS).</a> Anal Methods. 7 (20), 8534-8538 (2015).</li><li>Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Binding+Microarrays+for+the+Characterization+of+Protein-DNA+Interactions.">Protein Binding Microarrays for the Characterization of Protein-DNA Interactions.</a> Adv Biochem Eng Biotechnol. 104, 65-85 (2007).</li><li>Platt, M., Rowe, W., Knowles, J., Day, P. J., Kell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+sequence+activity+relationships.">Analysis of aptamer sequence activity relationships.</a> Integr Biol. 1 (1), 116-122 (2009).</li><li>Ruiz-Hern&#225;ndez, E., Baeza, A., Vallet-Reg&#237;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+through+DNA/Magnetic+Nanoparticle+Gates.">Smart Drug Delivery through DNA/Magnetic Nanoparticle Gates.</a> ACS Nano. 5 (2), 1259-1266 (2011).</li><li>Murdock, R. C., Braydich-stolle, L., Schrand, A. M., Schlager, J. J., Hussain, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Nanomaterial+Dispersion+in+Solution+Prior+to+In+Vitro+Exposure+Using+Dynamic+Light+Scattering+Technique.">Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique.</a> Toxicol Sci. 101 (2), 239-253 (2008).</li><li>Hupfield, S., Holsaeter, A. M., Skar, M., Frantzen, C. B., Brandl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposome+size+analysis+by+dynamic/static+light+scattering+upon+size+exclusion-/field+flow+fractionation.">Liposome size analysis by dynamic/static light scattering upon size exclusion-/field flow fractionation.</a> J Nanosci Nanotechnol. 6 (7), 3025-3031 (2006).</li><li>Roberts, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+pores+for+measuring+concentrations+of+synthetic+and+biological+nanoparticle+dispersions.">Tunable pores for measuring concentrations of synthetic and biological nanoparticle dispersions.</a> Biosens Bioelectron. 31 (1), 17-25 (2012).</li><li>Roberts, G. S., Kozak, D., Anderson, W., Broom, M. F., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+nano/micropores+for+particle+detection+and+discrimination:+scanning+ion+occlusion+spectroscopy.">Tunable nano/micropores for particle detection and discrimination: scanning ion occlusion spectroscopy.</a> Small. 6 (23), 2653-2658 (2010).</li><li>Vogel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+sizing+of+nano/microparticles+with+a+tunable+elastomeric+pore+sensor.">Quantitative sizing of nano/microparticles with a tunable elastomeric pore sensor.</a> Anal Chem. 83 (9), 3499-3506 (2011).</li><li>Booth, M. A., Vogel, R., Curran, J. M., Harbison, S., Travas-Sejdic, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+target-probe+oligonucleotide+hybridization+using+synthetic+nanopore+resistive+pulse+sensing.">Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.</a> Biosens Bioelectron. 45, 136-140 (2013).</li><li>Kozak, D., Anderson, W., Vogel, R., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+size+and+&#950;-potential+measurements+of+individual+nanoparticles+in+dispersion+using+size-tunable+pore+sensors.">Simultaneous size and &#950;-potential measurements of individual nanoparticles in dispersion using size-tunable pore sensors.</a> ACS Nano. 6 (8), 6990-6997 (2012).</li><li>Kozak, D., Anderson, W., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Resistive+Pulse+Sensors:+Devices+bridging+the+void+between+molecular+and+microscopic+detection.">Advances in Resistive Pulse Sensors: Devices bridging the void between molecular and microscopic detection.</a> Nano Today. 6 (5), 531-545 (2011).</li><li>Weatherall, E., Willmott, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+tunable+resistive+pulse+sensing.">Applications of tunable resistive pulse sensing.</a> Analyst. 140, 3318-3334 (2015).</li><li>Willmott, G. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+tunable+nanopore+blockade+rates+to+investigate+colloidal+dispersions.">Use of tunable nanopore blockade rates to investigate colloidal dispersions.</a> J Phys Condens Matter. 22 (45), 454116 (2010).</li><li>Blundell, E. L. C. J., Mayne, L. J., Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+of+tunable+resistive+pulse+sensing+as+a+biosensor.">Emergence of tunable resistive pulse sensing as a biosensor.</a> Anal Methods. 7, 7055-7066 (2015).</li><li>Platt, M., Willmott, G. R., Lee, G. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistive+Pulse+Sensing+of+Analyte-Induced+Multicomponent+Rod+Aggregation+Using+Tunable+Pores.">Resistive Pulse Sensing of Analyte-Induced Multicomponent Rod Aggregation Using Tunable Pores.</a> Small. 8 (15), 2436-2444 (2012).</li><li>Vogel, R., Anderson, W., Eldridge, J., Glossop, B., Willmott, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variable+pressure+method+for+characterizing+nanoparticle+surface+charge+using+pore+sensors.">A variable pressure method for characterizing nanoparticle surface charge using pore sensors.</a> Anal Chem. 84 (7), 3125-3131 (2012).</li><li>Blundell, E. L. C. J., Vogel, R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle-by-Particle+Charge+Analysis+of+DNA-Modified+Nanoparticles+Using+Tunable+Resistive+Pulse+Sensing.">Particle-by-Particle Charge Analysis of DNA-Modified Nanoparticles Using Tunable Resistive Pulse Sensing.</a> Langmuir. 32 (4), (2016).</li><li>Hunter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zeta Potential in Colloid Science: Principles and Applications. , (1981).</li><li>Arjmandi, N., Van Roy, W., Lagae, L., Borghs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+electric+charge+and+zeta+potential+of+nanometer-sized+objects+using+pyramidal-shaped+nanopores.">Measuring the electric charge and zeta potential of nanometer-sized objects using pyramidal-shaped nanopores.</a> Anal Chem. 84 (20), 8490-8496 (2012).</li><li>Bacri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+colloids+in+single+solid-state+nanopores.">Dynamics of colloids in single solid-state nanopores.</a> J Phys Chem B. 115 (12), 2890-2898 (2011).</li><li>Cabello-Aguilar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+polymer+nanoparticles+through+a+single+artificial+nanopore+with+a+high-aspect-ratio.">Dynamics of polymer nanoparticles through a single artificial nanopore with a high-aspect-ratio.</a> Soft Matter. 10 (42), 8413-8419 (2014).</li><li>Billinge, E. R., Muzard, J., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+resistive+pulse+sensing+as+a+tool+to+monitor+analyte+induced+particle+aggregation.">Tunable resistive pulse sensing as a tool to monitor analyte induced particle aggregation.</a> Nanomater Nanosci. 1 (1), 11 (2013).</li><li>Li, J., Fan, C., Pei, H., Shi, J., Huang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+Nanocarriers+with+Self-Assembled+DNA+Nanostructures.">Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures.</a> Adv Mater. 25 (32), 4386-4396 (2013).</li><li>Billinge, E. R., Broom, M., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+aptamer-protein+interactions+using+tunable+resistive+pulse+sensing.">Monitoring aptamer-protein interactions using tunable resistive pulse sensing.</a> Anal Chem. 86 (2), 1030-1037 (2014).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> PLoS One. 5 (12), e15004 (2010).</li><li>Park, S. -. J., Taton, T. A., Mirkin, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Electrical+Detection+of+DNA+with+Nanoparticle+Probes.">Array-Based Electrical Detection of DNA with Nanoparticle Probes.</a> Science. 295 (5559), 1503-1506 (2002).</li></ol>

The calculation for the zeta potential used a calibration based method related to work by Arjmandi et al.21. The duration of the translocation of particles as they traverse a nanopore is measured as a function of applied voltage, using an average electric field and particle velocities over the entirety of a regular conical pore. &#160;The electrophoretic mobility is the derivative of 1/T (where T is the blockade duration) with respect to voltage, multiplied&#160;by the square of the sensing zone lengt...

Functionalized nanoparticles are becoming increasingly popular as biosensors in both medical and environmental fields. The ability to alter a nanoparticle&#39;s surface chemistry, with DNA, for example, is proving useful for targeted drug delivery systems1 and monitoring DNA-protein interactions2-4. An increasingly common nanoparticle property being utilized in bioassays and in the delivery of therapeutics is superparamagnetism5. Superparamagnetic particles (SPPs) are extremely useful in identifying and removing specific analytes from complex mixtures and can do so with the simple use of a single magnet. Once removed, the analyte-bound particles can be characterized and analyzed fit for purpose.
Previous methods used for the detection and characterization of nanoparticles include optical techniques such as dynamic light scattering (DLS), otherwise known as photon correlation spectroscopy. Although a high throughput technique, DLS is limited to being an averaging based technique and when analyzing multimodal samples without the addition of specialist software, the larger particles will produce a much more dominant signal, leaving some of the smaller particles completely unnoticed6,7. Particle-by-particle characterization techniques are therefore much more favorable to analyze nanoparticle and functionalized nanoparticle systems.
RPS based technologies are based around applying an electric field to a sample and monitoring the transportation mechanism of the particles through a synthetic or biological nanopore. A relatively recent nanoparticle detection and characterization technique based on RPS is tunable resistive pulse sensing (TRPS)8-16. TRPS is a two-electrode system separated by an elastomeric, tunable pore membrane. A tunable pore method allows for analytes of a range of shape17 and size to be measured via their transport mechanisms through the pore. Tunable pores have previously been used for the detection of small particles (70-95 nm diameter) producing comparable results to other techniques such as transmission electron spectroscopy (TEM)10. When an electric field is applied, an ionic current is observed and as particles/molecules pass through the pore, they temporarily block the pore, causing a reduction in the current that can be defined as a &#39;blockade event&#39;. Each blockade event is representative of a single particle so that each particle within a sample can be characterized individually based on the blockade magnitude, &#916;<img alt="Equation 1" src="/files/ftp_upload/54577/54577eq1.jpg" />, and full width half-maximum, FWHM, as well as other blockade properties. Analyzing individual particles as they pass through a nanopore is advantageous for multimodal samples as TRPS can successfully and effectively distinguish a range of particle sizes amongst a single sample. Tunable resistive pulse sensing completes size10, zeta potential12,18 and concentration15 measurements simultaneously in a single run and can therefore still differentiate samples of similar, if not the same&#160;size by their surface charge19; an advantage over alternative sizing techniques.
Zeta potential is defined as the electrostatic potential at the plane of shear20, and is calculated from particle velocities as they traverse a pore19. Zeta potential measurements of individual particles thus gives insight into the translocation mechanisms and behavior of nanoparticle systems in solution, valuable information for the future of nanoparticle assay designs for a range of applications. Particle-by-particle analysis of such nature also allows for the spread and distribution of zeta potential values amongst a sample population to be explored, allowing for more information on reaction kinetics (single-stranded to double-stranded DNA, for example) and particle stabilities in solution to be attained.
Here, we describe a technique that detects and characterizes both unmodified and DNA-modified SPP surfaces. The protocol described herein is applicable to a range of inorganic and biological nanoparticles, but we demonstrate the procedure using DNA-modified surfaces due to their wide range of applications. The technique allows the user to distinguish between single-stranded and double-stranded DNA targets on a nanoparticle surface, based on particle translocation velocities through a pore system and thus their zeta potentials.

<table border="0" cellpadding="0" cellspacing="0" width="602">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate buffered Saline (PBS)</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P4417</td>
			<td style="width:167px;">1 tablet dissolved in 200 mL deionised water to make buffer solution.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tween-20</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P1379</td>
			<td>0.05% (v/v) in PBS buffer as a surfactant</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Carboxyl polystyrene nanoparticles</td>
			<td style="width:100px;">Bangs Laboratories, US</td>
			<td style="width:119px;">CPC200</td>
			<td>Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 &#181;eq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Streptavidin coated nanoparticles</td>
			<td style="width:100px;">Ademtech, France</td>
			<td style="width:119px;">3121</td>
			<td>Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated oligonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3&#39; end; Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences: CP 5&#39;ATGGTTAAACCTCAC 
			TACGCGTGGC[Btn]3&#39;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Standard olignonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5&#39;GCCACGCGTAGTGAGGTTTAACCAT3&#39;, Middle binding - 5&#39;GTAGTGAGGT3&#39;, End binding - 5&#39;GTTTAACCAT3&#39;, Partially complementary overhanging - 5&#39;GTGAGGTTTAACCAT 
			TTTTTTTTTTTTTTT3&#39;.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon qNano</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Inherent pressure on system of 47 Pa,</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon Variable Pressure Module (VPM)</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Each &#39;cm&#39; of pressure is equivalent to approximately 1000 Pa.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Polyurethane nanopore membranes</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;">NP150</td>
			<td>Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.&#160;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Magrack 6</td>
			<td style="width:100px;">GE Healthcare, UK</td>
			<td style="width:119px;">28-9489-64</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Sonic Bath</td>
			<td style="width:100px;">Fisher Scientific, UK</td>
			<td style="width:119px;">10692353</td>
			<td>80 Watts</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Vortexer</td>
			<td style="width:100px;">IKA, Germany</td>
			<td>0003365000</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Rotary Wheel&#160;</td>
			<td style="width:100px;">Labnet International, US</td>
			<td style="width:119px;">H5500-230 V</td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and nanoparticles. Tunable resistive pulse sensing (TRPS) is a relatively recent adaptation to RPS that incorporates a tunable pore that can be altered in real time. Here, we use TRPS to monitor the translocation times of DNA-modified nanoparticles as they traverse the tunable pore membrane as a function of DNA concentration and structure (i.e., single-stranded to double-stranded DNA).
TRPS is based on two Ag/AgCl electrodes, separated by an elastomeric pore membrane that establishes a stable ionic current upon an applied electric field. Unlike various optical-based particle characterization technologies, TRPS can characterize individual particles amongst a sample population, allowing for multimodal samples to be analyzed with ease. Here, we demonstrate zeta potential measurements via particle translocation velocities of known standards and apply these to sample analyte translocation times, thus resulting in measuring the zeta potential of those analytes.
As well as acquiring mean zeta potential values, the samples are all measured using a particle-by-particle perspective exhibiting more information on a given sample through sample population distributions, for example. Of such, this method demonstrates potential within sensing applications for both medical and environmental fields.

<img alt="Figure 1" src="/files/ftp_upload/54577/54577fig1.jpg" /> 
Figure 1. Schematic representation of the processes of magnetic purification and a TRPS measurement. A) Example of magnetic purification of sample starting with a sample containing excess, unbound capture probe DNA. B) TRPS measurement example i) Particle passing through the nanopore and ii) Blockade event produced from particle temporarily occluding ions in the pore...

Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

Here we use a polyurethane tunable nanopore integrated into a resistive pulse sensing technique to characterize nanoparticles surface chemistry via the measurement of particle translocation velocities, which can be used to determine the zeta potential of individual nanoparticles.

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and ...

The overall goal of this procedure is to characterize the surface chemistry of nano particles using tunable resistant post sensing, or TRPS, and determine the zeta potential of the material. This is demonstrating by characterizing DNA modified nano particles. This method can help answer key questions in the characterization of nanomaterials and the development of bioassay.The main advantage of this technique is that you can complete particle by particle analysis. Each DNA particle signal is translated into a zeta potential measurement, providing a complete picture of the sample being analyzed. The oldest method could provide insight into the characterization of materials.It can also be applied to other applications, such as the development of bioassay for the detection of cells, viruses, DNA, and proteins. Generally, individual new to this method will struggle because it's not a simple inject the samp and then wait for the answer. There is some input from the scientist needed.To begin this procedure, vortex streptavidin coated particles for 30 seconds before sonication for two minutes at 80 watts to assure mono dispersity. Dilute the streptavidin coated particles one in one hundred in PBST buffer to achieve a resulting concentration of one times ten to the nine particles per milliliter. Then vortex the particles for 30 seconds.Based on a binding capacity of 4, 352 picomols per milligram at the appropriate concentration of DNA to the particles for resulting concentrations of 10, 20, 30, 40, 47, 95, 140, and 210 nanomolar. After vortexing the samples for 10 seconds, place them on a rotary wheel at room temperature for 30 minutes to allow the DNA to bind to the particle surfaces via a streptavidin biotin interaction. Once the captured DNA has been added and incubated with the particles, remove the excess DNA and solution via magnetic separation by placing the samples onto a magnetic rack for 30 minutes.Following this, remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. Now add the required amount of target DNA to each sample to ensure the maximum possible target binding was reached.Vortex the samples for 10 seconds. And place them on the rotary wheel at room temperature for 30 minutes. Once the hybridization is complete, remove the excess target DNA via magnetic separation by placing the samples onto the magnetic rack for 30 minutes.Next remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. After repeating the previous steps for duplicate samples, place the samples on the rotary wheel at room temperature for 16 hours to investigate DNA hybridization times.At this point, plug in a TRPS instrument into a computer system with software in place. Using calipers, measure the distance between the outside of two parallel jaws. Type the distance in the stretch field in the instrument settings tab and click on calibrate stretch underneath the tab.Following this, laterally fit a polyurethane nanopore membrane of appropriate sizing for analysis onto the jaws with the nanopore ID number facing upward. Then stretch the jaws to the stretch required for analysis using the stretch adjustment handle on the side of the instrument. Place 80 microliters of PBST buffer in the lower fluid cell beneath the nanopore, ensuring there are no bubbles present that may affect the measurement.Now click the upper fluid cell into place and add 40 microliters of buffer, ensuring there are no bubbles present. Then place a faraday cage over the system and apply an external pressure as described in the text protocol. After placing 40 microliters of the calibration particles into the upper fluid cell, complete a TRPS measurement at three applied voltages.Alter the voltage by clicking on the plus and minus buttons on the voltage scale in the instrument settings tab in the software. Check that the three voltages return the appropriate background currents. And ensure that at the medium voltage, the calibration particles produce an average blockade magnitude of at least 0.3 nanoamperes.Once the conditions outlined in the text protocol have been achieved, start the run by clicking start in the software in the data acquisition tab. To complete the measurement, click stop in the data acquisition tab and save the data file. Wash the system by replacing the calibration particles with 40 microliters with PBST buffer into the upper fluid cells several times.And applying various pressures until no more blockade events are present, ensuring there are no residual particles and no cross contamination. After the appropriate baseline current is achieved, replace the electrolyte in the upper fluid cell with 40 microliters of sample. Start the sample run by clicking start in the data acquisition tab.Record a minimum of 500 particles and ensure the run time is a minimum of 30 seconds. To complete the measurement, click stop in the data acquisition tab and save the data file. An example of size and zeta potential analysis of streptavidin coated particles with no modifications and streptavidin coated particles saturated with single stranded DNA on the surface is shown here.Although both samples were of a similar size, the zeta potential was significantly different and much larger when DNA was functionalized onto the particle surface. The size and zeta potential data exhibited for samples with the lowest an highest concentrations of DNA hybridized to the streptavidin coated particles is displayed here. A larger zeta potential value is recorded for particles hybridized with a higher concentration of DNA.The change in zeta potential measured for capture probed DNA only, a fully complementary DNA target, a middle binding DNA target, an end binding DNA target, and an overhanging DNA target is shown here. Once mastered, this technique can be done in 20 minutes if it is performed properly. While attempting this procedure it's important to remember to thoroughly wash a nanopole between each calibration and sample to ensure there is no cross contamination between samples and prevent any nanopole blocking.After its development, this technique paved the way for researchers in the field of biosenses to explore protein-protein and protein-DNA interactions in multiplex assays. After watching this video you should have a good understanding of how to obtain zeta potential using TRPS and prepare DNA modified particles for bioassays.

determination-zeta-potential-via-nanoparticle-translocation

Research

JoVE Journal

Bioengineering

Contrast Ultrasound Targeted Treatment of Gliomas in Mice via Drug-Bearing Nanoparticle Delivery and Microvascular Ablation

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the microvasculature are controlled by varying ultrasound pulsing parameters.  Specifically, we are testing whether such approaches may be used to treat malignant brain tumors through drug delivery and microvascular ablation.  Preliminary studies have been performed to determine whether targeted drug-bearing nanoparticle delivery can be facilitated by the ultrasound mediated destruction of "composite" delivery agents comprised of 100nm poly(lactide-co-glycolide) (PLAGA) nanoparticles that are adhered to albumin shelled microbubbles. We denote these agents as microbubble-nanoparticle composite agents (MNCAs). When targeted to subcutaneous C6 gliomas with ultrasound, we observed an immediate 4.6-fold increase in nanoparticle delivery in MNCA treated tumors over tumors treated with microbubbles co-administered with nanoparticles and a 8.5 fold increase over non-treated tumors. Furthermore, in many cancer applications, we believe it may be desirable to perform targeted drug delivery in conjunction with ablation of the tumor microcirculation, which will lead to tumor hypoxia and apoptosis. To this end, we have tested the efficacy of non-theramal cavitation-induced microvascular ablation, showing that this approach elicits tumor perfusion reduction, apoptosis, significant growth inhibition, and necrosis. Taken together, these results indicate that our ultrasound-targeted approach has the potential to increase therapeutic efficiency by creating tumor necrosis through microvascular ablation and/or simultaneously enhancing the drug payload in gliomas.

Insonation of microbubbles is a promising strategy for tumor ablation at reduced time-averaged acoustic powers, as well as for the targeted delivery of therapeutics. The purpose of the present study is to develop low duty cycle ultrasound pulsing strategies and nanocarriers to maximize non-thermal microvascular ablation and payload delivery to subcutaneous C6 gliomas.

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the ...

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science. Methods for particle trapping based on optical, magnetic, electrokinetic, and acoustic techniques have led to major advancements in physics and biology ranging from the molecular to cellular level. In this article, we introduce a new microfluidic-based technique for particle trapping and manipulation based solely on hydrodynamic fluid flow. Using this method, we demonstrate trapping of micro- and nano-scale particles in aqueous solutions for long time scales. The hydrodynamic trap consists of an integrated microfluidic device with a cross-slot channel geometry where two opposing laminar streams converge, thereby generating a planar extensional flow with a fluid stagnation point (zero-velocity point). In this device, particles are confined at the trap center by active control of the flow field to maintain particle position at the fluid stagnation point. In this manner, particles are effectively trapped in free solution using a feedback control algorithm implemented with a custom-built LabVIEW code. The control algorithm consists of image acquisition for a particle in the microfluidic device, followed by particle tracking, determination of particle centroid position, and active adjustment of fluid flow by regulating the pressure applied to an on-chip pneumatic valve using a pressure regulator. In this way, the on-chip dynamic metering valve functions to regulate the relative flow rates in the outlet channels, thereby enabling fine-scale control of stagnation point position and particle trapping. The microfluidic-based hydrodynamic trap exhibits several advantages as a method for particle trapping. Hydrodynamic trapping is possible for any arbitrary particle without specific requirements on the physical or chemical properties of the trapped object. In addition, hydrodynamic trapping enables confinement of a "single" target object in concentrated or crowded particle suspensions, which is difficult using alternative force field-based trapping methods. The hydrodynamic trap is user-friendly, straightforward to implement and may be added to existing microfluidic devices to facilitate trapping and long-time analysis of particles. Overall, the hydrodynamic trap is a new platform for confinement, micromanipulation, and observation of particles without surface immobilization and eliminates the need for potentially perturbative optical, magnetic, and electric fields in the free-solution trapping of small particles.

In this article, we present a microfluidic-based method for particle confinement based on hydrodynamic flow. We demonstrate stable particle trapping at a fluid stagnation point using a feedback control mechanism, thereby enabling confinement and micromanipulation of arbitrary particles in an integrated microdevice.

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have witnessed a tremendous increase in interest in EVs. EVs have been shown to play important roles in various physiological and pathological processes, including coagulation, immune responses, and cancer. In addition, EVs have potential as therapeutic agents, for instance as drug delivery vehicles or as regenerative medicine. Because of their small size (50 to 1,000 nm) accurate quantification and size profiling of EVs is technically challenging.
This protocol describes how tunable resistive pulse sensing (tRPS) technology, using the qNano system, can be used to determine the concentration and size of EVs. The method, which relies on the detection of EVs upon their transfer through a nano sized pore, is relatively fast, suffices the use of small sample volumes and does not require the purification and concentration of EVs. Next to the regular operation protocol an alternative approach is described using samples spiked with polystyrene beads of known size and concentration. This real-time calibration technique can be used to overcome technical hurdles encountered when measuring EVs directly in biological fluids.

Extracellular vesicles play important roles in physiological and pathological processes, including coagulation, immune responses, and cancer or as potential therapeutic agents in drug delivery or regenerative medicine. This protocol presents methods for the quantification and size characterization of isolated and non-isolated extracellular vesicles in various fluids using tunable resistive pulse sensing.

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

A Microfluidic Platform for Precision Small-volume Sample Processing and Its Use to Size Separate Biological Particles with an Acoustic Microdevice

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. However, to achieve robust sample manipulation it is necessary to address device integration with the macroscale environment. To realize repeatable, sensitive particle separation with microfluidic devices, this protocol presents a complete automated and integrated microfluidic platform that enables precise processing of 0.15&#8211;1.5 ml samples using microfluidic devices. Important aspects of this system include modular device layout and robust fixtures resulting in reliable and flexible world to chip connections, and fully-automated fluid handling which accomplishes closed-loop sample collection, system cleaning and priming steps to ensure repeatable operation. Different microfluidic devices can be used interchangeably with this architecture. Here we incorporate an acoustofluidic device, detail its characterization, performance optimization, and demonstrate its use for size-separation of biological samples. By using real-time feedback during separation experiments, sample collection is optimized to conserve and concentrate sample. Although requiring the integration of multiple pieces of equipment, advantages of this architecture include the ability to process unknown samples with no additional system optimization, ease of device replacement, and precise, robust sample processing.

This protocol describes a system architecture for performing automated small volume (0.15&#8211;1.5 ml) particle separations using a microfluidic device, and discusses methods to optimize acoustofluidic device performance and operation.

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. ...

Fabrication of Mechanically Tunable and Bioactive Metal Scaffolds for Biomedical Applications

Biometal systems have been widely used for biomedical applications, in particular, as load-bearing materials. However, major challenges are high stiffness and low bioactivity of metals. In this study, we have developed a new method towards fabricating a new type of bioactive and mechanically reliable porous metal scaffolds-densified porous Ti scaffolds. The method consists of two fabrication processes, 1) the fabrication of porous Ti scaffolds by dynamic freeze casting, and 2) coating and densification of the porous scaffolds. The dynamic freeze casting method to fabricate porous Ti scaffolds allowed the densification of porous scaffolds by minimizing the chemical contamination and structural defects. The densification process is distinctive for three reasons. First, the densification process is simple, because it requires a control of only one parameter (degree of densification). Second, it is effective, as it achieves mechanical enhancement and sustainable release of biomolecules from porous scaffolds. Third, it has broad applications, as it is also applicable to the fabrication of functionally graded porous scaffolds by spatially varied strain during densification.

Bioactive and mechanically reliable metal scaffolds have been fabricated through a method which consists of two processes, dynamic freeze casting for the fabrication of porous Ti, and coating and densification of the Ti scaffolds. The densification process is simple, effective and applicable to the fabrication of functionally graded scaffolds.

Biometal systems have been widely used for biomedical applications, in particular, as load-bearing materials. However, major challenges are high stiffness ...

Imaging Cell Viability on Non-transparent Scaffolds &#8212; Using the Example of a Novel Knitted Titanium Implant

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in nucleus pulposus (NP) extrusion leads to intervertebral disc destruction. Currently available surgical treatments reduce the pain but do not restore the mechanical functionality of the spine. In order to preserve mechanical features of the spine, total disc or nucleus replacement thus became a wide interest. However, this arthroplasty era is still in an immature state, since none of the existing products have been clinically evaluated.
This study intends to test the biocompatibility of a novel nucleus implant made of knitted titanium wires. Despite all mechanical advantages, the material has its limits for conventional optical analysis as the resulting implant is non-transparent. Here we present a strategy that describes in vitro visualization, tracking and viability testing of osteochondro-progenitor cells on the scaffold. This protocol can be used to visualize the efficiency of the cleaning protocol as well as to investigate the biocompatibility of these and other non-transparent scaffolds. Furthermore, this protocol can be used to show adherence pattern of cells as well as cell viability and proliferation rates on/in the scaffold. This in vitro biocompatibility testing assay provides a propitious tool to analyze cell-material interaction in non-transparent and opaque scaffolds.

Here we present a fluorophore based imaging technique to detect cell viability on a non-transparent titanium scaffold as well as to detect glimpses of the scaffold impurities. This protocol troubleshoots the drawback of imaging cell-cell or cell-metal interactions on non-transparent scaffolds.

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in ...

Tunable Hydrogels from Pulmonary Extracellular Matrix for 3D Cell Culture

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung tissue from porcine, rat, or mouse, the tissue is perfused and submerged in subsequent chemical detergents to remove the cellular debris. Histological comparison of the tissue before and after processing confirms removal of over 95% of double stranded DNA and alpha galactosidase staining suggests the majority of cellular debris is removed. After decellularization, the tissue is lyophilized and then cryomilled into a powder. The matrix powder is digested for 48 hr in an acidic pepsin digestion solution and then neutralized to form the pregel solution. Gelation of the pregel solution can be induced by incubation at 37 &#176;C and can be used immediately following neutralization or stored at 4 &#176;C for up to two weeks. Coatings can be formed using the pregel solution on a non-treated plate for cell attachment. Cells can be suspended in the pregel prior to self-assembly to achieve a 3D culture, plated on the surface of a formed gel from which the cells can migrate through the scaffold, or plated on the coatings. Alterations to the strategy presented can impact gelation temperature, strength, or protein fragment sizes. Beyond hydrogel formation, the hydrogel stiffness may be increased using genipin.

This is a method to create a 3-dimensional cell culture scaffold from pulmonary extracellular matrix. Intact lung is processed into hydrogels that can support the growth of cells in three-dimensions.

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to spatially fractionate the sample based on a biological property of interest. For the resultant spatial distribution to be used as the assay readout, microfluidic devices are often subjected to microscopic analysis requiring complex instrumentation with higher cost and reduced portability. To address this limitation, we have developed an integrated electronic sensing technology for multiplexed detection of particles at different locations on a microfluidic chip. Our technology, called Microfluidic CODES, combines Resistive Pulse Sensing with Code Division Multiple Access to compress 2D spatial information into a 1D electrical signal. In this paper, we present a practical demonstration of the Microfluidic CODES technology to detect and size cultured cancer cells distributed over multiple microfluidic channels. As validated by the high-speed microscopy, our technology can accurately analyze dense cell populations all electronically without the need for an external instrument. As such, the Microfluidic CODES can potentially enable low-cost integrated lab-on-a-chip devices that are well suited for the point-of-care testing of biological samples.

We demonstrate a microfluidic platform with an integrated surface electrode network that combines resistive pulse sensing (RPS) with code division multiple access (CDMA), to multiplex detection and sizing of particles in multiple microfluidic channels.

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Transmission of Multiple Signals through an Optical Fiber Using Wavefront Shaping

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the light distortion during the propagation within the fiber. Our methodology is based on digital optical phase conjugation employing only a single spatial light modulator, where the optical wavefront is individually modulated at different regions of the modulator, one region per light signal. Digital optical phase conjugation approaches are considered to be faster than other wavefront shaping approaches, where (for example) a complete determination of the wave propagation behavior of the fiber is performed. In contrast, the presented approach is time-efficient since it only requires one calibration per light signal. The proposed method is potentially appropriate for spatial division multiplexing in communications engineering. Further application fields are endoscopic light delivery in biophotonics, especially in optogenetics, where single cells in biological tissue have to be selectively illuminated with high spatial and temporal resolution.

We demonstrate the transmission of multiple independent signals through a multimode fiber using wavefront shaping employing a single spatial light modulator. By modulating the wavefront for each signal individually, spatially separated foci are transmitted. Potential applications are multiplexed data transfer in communications engineering and endoscopic light delivery in biophotonics.

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the ...

A Novel Surgical Technique As a Foundation for In Vivo Partial Liver Engineering in Rat

Organ engineering is a novel strategy to generate liver organ substitutes that can potentially be used in transplantation. Recently, in vivo liver engineering, including in vivo organ decellularization followed by repopulation, has emerged as a promising approach over ex vivo liver engineering. However, postoperative survival was not achieved. The aim of this study is to develop a novel surgical technique of in vivo selective liver lobe perfusion in rats as a prerequisite for in vivo liver engineering. We generate a circuit bypass only through the left lateral lobe. Then, the left lateral lobe is perfused with heparinized saline. The experiment is performed with 4 groups (n = 3 rats per group) based on different perfusion times of 20 min, 2 h, 3 h, and 4 h. Survival, as well as the macroscopically visible change of color and the histologically determined absence of blood cells in the portal triad and the sinusoids, is taken as an indicator for a successful model establishment. After selective perfusion of the left lateral lobe, we observe that the left lateral lobe, indeed, turned from red to faint yellow. In a histological assessment, no blood cells are visible in the branch of the portal vein, the central vein, and the sinusoids. The left lateral lobe turns red after reopening the blocked vessels. 12/12 rats survived the procedure for more than one week. We are the first to report a surgical model for in vivo single liver lobe perfusion with a long survival period of more than one week. In contrast to the previously published report, the most important advantage of the technique presented here is that perfusion of 70% of the liver is maintained throughout the whole procedure. The establishment of this technique provides a foundation for in vivo partial liver engineering in rats, including decellularization and recellularization.

A Novel Surgical Technique As a Foundation for In Vivo Partial Liver Engineering in Rat

We establish a novel surgical technique for an in vivo single liver lobe perfusion model in rat as a prerequisite for further studying in vivo partial liver engineering in the future.