Name: determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example
Uploaded: 2016-10-26T14:00:00
Description: Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

The authors thank Izon Science Ltd for their support. The work was supported by the European Commission for Research (PCIG11-GA-2012-321836 Nano4Bio).&#160;

1. Making the Phosphate Buffered Saline with Tween-20 (PBST) Buffer
<ol>
	<li>Dissolve one PBS tablet (0.01 M phosphate buffer, 0.0027 M Potassium Chloride, 0.137 M Sodium Chloride, pH 7.4) in 200 ml deionized water (18.2 M&#8486; cm).</li>
	<li>Add 100 &#181;l (0.05 (v/v)%) Tween-20 to the 200 ml buffer solution as a surfactant.</li>
</ol>
2. Preparing the Carboxyl Polystyrene Particle Standards
<ol>
	<li>Vortex the calibration particles for 30 sec before sonication for 2 min at 80 watts to c...

<ol>
	<li>Alexander, C. M., Maye, M. M., Dabrowiak, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA-capped+nanoparticles+designed+for+doxorubicin+drug+delivery.">DNA-capped nanoparticles designed for doxorubicin drug delivery.</a> Chem Commun. 47 (12), 3418-3420 (2011).</li><li>Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer+based+dispersion+assay+using+tunable+resistive+pulse+sensing+(TRPS).">Aptamer based dispersion assay using tunable resistive pulse sensing (TRPS).</a> Anal Methods. 7 (20), 8534-8538 (2015).</li><li>Bulyk, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+Binding+Microarrays+for+the+Characterization+of+Protein-DNA+Interactions.">Protein Binding Microarrays for the Characterization of Protein-DNA Interactions.</a> Adv Biochem Eng Biotechnol. 104, 65-85 (2007).</li><li>Platt, M., Rowe, W., Knowles, J., Day, P. J., Kell, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+aptamer+sequence+activity+relationships.">Analysis of aptamer sequence activity relationships.</a> Integr Biol. 1 (1), 116-122 (2009).</li><li>Ruiz-Hern&#225;ndez, E., Baeza, A., Vallet-Reg&#237;, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+through+DNA/Magnetic+Nanoparticle+Gates.">Smart Drug Delivery through DNA/Magnetic Nanoparticle Gates.</a> ACS Nano. 5 (2), 1259-1266 (2011).</li><li>Murdock, R. C., Braydich-stolle, L., Schrand, A. M., Schlager, J. J., Hussain, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+Nanomaterial+Dispersion+in+Solution+Prior+to+In+Vitro+Exposure+Using+Dynamic+Light+Scattering+Technique.">Characterization of Nanomaterial Dispersion in Solution Prior to In Vitro Exposure Using Dynamic Light Scattering Technique.</a> Toxicol Sci. 101 (2), 239-253 (2008).</li><li>Hupfield, S., Holsaeter, A. M., Skar, M., Frantzen, C. B., Brandl, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Liposome+size+analysis+by+dynamic/static+light+scattering+upon+size+exclusion-/field+flow+fractionation.">Liposome size analysis by dynamic/static light scattering upon size exclusion-/field flow fractionation.</a> J Nanosci Nanotechnol. 6 (7), 3025-3031 (2006).</li><li>Roberts, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+pores+for+measuring+concentrations+of+synthetic+and+biological+nanoparticle+dispersions.">Tunable pores for measuring concentrations of synthetic and biological nanoparticle dispersions.</a> Biosens Bioelectron. 31 (1), 17-25 (2012).</li><li>Roberts, G. S., Kozak, D., Anderson, W., Broom, M. F., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+nano/micropores+for+particle+detection+and+discrimination:+scanning+ion+occlusion+spectroscopy.">Tunable nano/micropores for particle detection and discrimination: scanning ion occlusion spectroscopy.</a> Small. 6 (23), 2653-2658 (2010).</li><li>Vogel, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+sizing+of+nano/microparticles+with+a+tunable+elastomeric+pore+sensor.">Quantitative sizing of nano/microparticles with a tunable elastomeric pore sensor.</a> Anal Chem. 83 (9), 3499-3506 (2011).</li><li>Booth, M. A., Vogel, R., Curran, J. M., Harbison, S., Travas-Sejdic, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+target-probe+oligonucleotide+hybridization+using+synthetic+nanopore+resistive+pulse+sensing.">Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.</a> Biosens Bioelectron. 45, 136-140 (2013).</li><li>Kozak, D., Anderson, W., Vogel, R., Chen, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Simultaneous+size+and+&#950;-potential+measurements+of+individual+nanoparticles+in+dispersion+using+size-tunable+pore+sensors.">Simultaneous size and &#950;-potential measurements of individual nanoparticles in dispersion using size-tunable pore sensors.</a> ACS Nano. 6 (8), 6990-6997 (2012).</li><li>Kozak, D., Anderson, W., Vogel, R., Trau, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Resistive+Pulse+Sensors:+Devices+bridging+the+void+between+molecular+and+microscopic+detection.">Advances in Resistive Pulse Sensors: Devices bridging the void between molecular and microscopic detection.</a> Nano Today. 6 (5), 531-545 (2011).</li><li>Weatherall, E., Willmott, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+of+tunable+resistive+pulse+sensing.">Applications of tunable resistive pulse sensing.</a> Analyst. 140, 3318-3334 (2015).</li><li>Willmott, G. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+tunable+nanopore+blockade+rates+to+investigate+colloidal+dispersions.">Use of tunable nanopore blockade rates to investigate colloidal dispersions.</a> J Phys Condens Matter. 22 (45), 454116 (2010).</li><li>Blundell, E. L. C. J., Mayne, L. J., Billinge, E. R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emergence+of+tunable+resistive+pulse+sensing+as+a+biosensor.">Emergence of tunable resistive pulse sensing as a biosensor.</a> Anal Methods. 7, 7055-7066 (2015).</li><li>Platt, M., Willmott, G. R., Lee, G. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resistive+Pulse+Sensing+of+Analyte-Induced+Multicomponent+Rod+Aggregation+Using+Tunable+Pores.">Resistive Pulse Sensing of Analyte-Induced Multicomponent Rod Aggregation Using Tunable Pores.</a> Small. 8 (15), 2436-2444 (2012).</li><li>Vogel, R., Anderson, W., Eldridge, J., Glossop, B., Willmott, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+variable+pressure+method+for+characterizing+nanoparticle+surface+charge+using+pore+sensors.">A variable pressure method for characterizing nanoparticle surface charge using pore sensors.</a> Anal Chem. 84 (7), 3125-3131 (2012).</li><li>Blundell, E. L. C. J., Vogel, R., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle-by-Particle+Charge+Analysis+of+DNA-Modified+Nanoparticles+Using+Tunable+Resistive+Pulse+Sensing.">Particle-by-Particle Charge Analysis of DNA-Modified Nanoparticles Using Tunable Resistive Pulse Sensing.</a> Langmuir. 32 (4), (2016).</li><li>Hunter, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Zeta Potential in Colloid Science: Principles and Applications. , (1981).</li><li>Arjmandi, N., Van Roy, W., Lagae, L., Borghs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+the+electric+charge+and+zeta+potential+of+nanometer-sized+objects+using+pyramidal-shaped+nanopores.">Measuring the electric charge and zeta potential of nanometer-sized objects using pyramidal-shaped nanopores.</a> Anal Chem. 84 (20), 8490-8496 (2012).</li><li>Bacri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+colloids+in+single+solid-state+nanopores.">Dynamics of colloids in single solid-state nanopores.</a> J Phys Chem B. 115 (12), 2890-2898 (2011).</li><li>Cabello-Aguilar, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+polymer+nanoparticles+through+a+single+artificial+nanopore+with+a+high-aspect-ratio.">Dynamics of polymer nanoparticles through a single artificial nanopore with a high-aspect-ratio.</a> Soft Matter. 10 (42), 8413-8419 (2014).</li><li>Billinge, E. R., Muzard, J., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tunable+resistive+pulse+sensing+as+a+tool+to+monitor+analyte+induced+particle+aggregation.">Tunable resistive pulse sensing as a tool to monitor analyte induced particle aggregation.</a> Nanomater Nanosci. 1 (1), 11 (2013).</li><li>Li, J., Fan, C., Pei, H., Shi, J., Huang, Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart+Drug+Delivery+Nanocarriers+with+Self-Assembled+DNA+Nanostructures.">Smart Drug Delivery Nanocarriers with Self-Assembled DNA Nanostructures.</a> Adv Mater. 25 (32), 4386-4396 (2013).</li><li>Billinge, E. R., Broom, M., Platt, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+aptamer-protein+interactions+using+tunable+resistive+pulse+sensing.">Monitoring aptamer-protein interactions using tunable resistive pulse sensing.</a> Anal Chem. 86 (2), 1030-1037 (2014).</li><li>Gold, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aptamer-Based+Multiplexed+Proteomic+Technology+for+Biomarker+Discovery.">Aptamer-Based Multiplexed Proteomic Technology for Biomarker Discovery.</a> PLoS One. 5 (12), e15004 (2010).</li><li>Park, S. -. J., Taton, T. A., Mirkin, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Array-Based+Electrical+Detection+of+DNA+with+Nanoparticle+Probes.">Array-Based Electrical Detection of DNA with Nanoparticle Probes.</a> Science. 295 (5559), 1503-1506 (2002).</li></ol>

The calculation for the zeta potential used a calibration based method related to work by Arjmandi et al.21. The duration of the translocation of particles as they traverse a nanopore is measured as a function of applied voltage, using an average electric field and particle velocities over the entirety of a regular conical pore. &#160;The electrophoretic mobility is the derivative of 1/T (where T is the blockade duration) with respect to voltage, multiplied&#160;by the square of the sensing zone lengt...

Functionalized nanoparticles are becoming increasingly popular as biosensors in both medical and environmental fields. The ability to alter a nanoparticle&#39;s surface chemistry, with DNA, for example, is proving useful for targeted drug delivery systems1 and monitoring DNA-protein interactions2-4. An increasingly common nanoparticle property being utilized in bioassays and in the delivery of therapeutics is superparamagnetism5. Superparamagnetic particles (SPPs) are extremely useful in identifying and removing specific analytes from complex mixtures and can do so with the simple use of a single magnet. Once removed, the analyte-bound particles can be characterized and analyzed fit for purpose.
Previous methods used for the detection and characterization of nanoparticles include optical techniques such as dynamic light scattering (DLS), otherwise known as photon correlation spectroscopy. Although a high throughput technique, DLS is limited to being an averaging based technique and when analyzing multimodal samples without the addition of specialist software, the larger particles will produce a much more dominant signal, leaving some of the smaller particles completely unnoticed6,7. Particle-by-particle characterization techniques are therefore much more favorable to analyze nanoparticle and functionalized nanoparticle systems.
RPS based technologies are based around applying an electric field to a sample and monitoring the transportation mechanism of the particles through a synthetic or biological nanopore. A relatively recent nanoparticle detection and characterization technique based on RPS is tunable resistive pulse sensing (TRPS)8-16. TRPS is a two-electrode system separated by an elastomeric, tunable pore membrane. A tunable pore method allows for analytes of a range of shape17 and size to be measured via their transport mechanisms through the pore. Tunable pores have previously been used for the detection of small particles (70-95 nm diameter) producing comparable results to other techniques such as transmission electron spectroscopy (TEM)10. When an electric field is applied, an ionic current is observed and as particles/molecules pass through the pore, they temporarily block the pore, causing a reduction in the current that can be defined as a &#39;blockade event&#39;. Each blockade event is representative of a single particle so that each particle within a sample can be characterized individually based on the blockade magnitude, &#916;<img alt="Equation 1" src="/files/ftp_upload/54577/54577eq1.jpg" />, and full width half-maximum, FWHM, as well as other blockade properties. Analyzing individual particles as they pass through a nanopore is advantageous for multimodal samples as TRPS can successfully and effectively distinguish a range of particle sizes amongst a single sample. Tunable resistive pulse sensing completes size10, zeta potential12,18 and concentration15 measurements simultaneously in a single run and can therefore still differentiate samples of similar, if not the same&#160;size by their surface charge19; an advantage over alternative sizing techniques.
Zeta potential is defined as the electrostatic potential at the plane of shear20, and is calculated from particle velocities as they traverse a pore19. Zeta potential measurements of individual particles thus gives insight into the translocation mechanisms and behavior of nanoparticle systems in solution, valuable information for the future of nanoparticle assay designs for a range of applications. Particle-by-particle analysis of such nature also allows for the spread and distribution of zeta potential values amongst a sample population to be explored, allowing for more information on reaction kinetics (single-stranded to double-stranded DNA, for example) and particle stabilities in solution to be attained.
Here, we describe a technique that detects and characterizes both unmodified and DNA-modified SPP surfaces. The protocol described herein is applicable to a range of inorganic and biological nanoparticles, but we demonstrate the procedure using DNA-modified surfaces due to their wide range of applications. The technique allows the user to distinguish between single-stranded and double-stranded DNA targets on a nanoparticle surface, based on particle translocation velocities through a pore system and thus their zeta potentials.

<table border="0" cellpadding="0" cellspacing="0" width="602">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Phosphate buffered Saline (PBS)</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P4417</td>
			<td style="width:167px;">1 tablet dissolved in 200 mL deionised water to make buffer solution.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Tween-20</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">P1379</td>
			<td>0.05% (v/v) in PBS buffer as a surfactant</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Carboxyl polystyrene nanoparticles</td>
			<td style="width:100px;">Bangs Laboratories, US</td>
			<td style="width:119px;">CPC200</td>
			<td>Nominal diamter of 220 nm, raw concentration of 1E12 particles/mL, specific surface charge of 86 &#181;eq/g (equivalent to a surface charge density of 3.2E19 C/nm^2.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Streptavidin coated nanoparticles</td>
			<td style="width:100px;">Ademtech, France</td>
			<td style="width:119px;">3121</td>
			<td>Batch had binding capacity of 4352 pmol/mg (188 nM theoretical DNA binding capacity) at a raw concentration of 1.1E11 particles/mL.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Biotinylated oligonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Biotin modification at 3&#39; end; Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences: CP 5&#39;ATGGTTAAACCTCAC 
			TACGCGTGGC[Btn]3&#39;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Standard olignonucleotides</td>
			<td style="width:100px;">Sigma Aldrich, UK</td>
			<td style="width:119px;">VC00001</td>
			<td>Supplier spec: Reverse Phase 1 purification (0.05 Scale); Lyophilised powders reconstituted to 100 &#181;M using deionised water, and diluted as required. Sequences of DNA targets: Fully complementary - 5&#39;GCCACGCGTAGTGAGGTTTAACCAT3&#39;, Middle binding - 5&#39;GTAGTGAGGT3&#39;, End binding - 5&#39;GTTTAACCAT3&#39;, Partially complementary overhanging - 5&#39;GTGAGGTTTAACCAT 
			TTTTTTTTTTTTTTT3&#39;.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon qNano</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Inherent pressure on system of 47 Pa,</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Izon Variable Pressure Module (VPM)</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;"></td>
			<td>Each &#39;cm&#39; of pressure is equivalent to approximately 1000 Pa.&#160;</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Polyurethane nanopore membranes</td>
			<td style="width:100px;">Izon Science, NZ</td>
			<td style="width:119px;">NP150</td>
			<td>Analyte size range 60-480 nm, pore diameter of calculated to be 799 nm at a 45 mm stretch.&#160;</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Magrack 6</td>
			<td style="width:100px;">GE Healthcare, UK</td>
			<td style="width:119px;">28-9489-64</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Sonic Bath</td>
			<td style="width:100px;">Fisher Scientific, UK</td>
			<td style="width:119px;">10692353</td>
			<td>80 Watts</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Vortexer</td>
			<td style="width:100px;">IKA, Germany</td>
			<td>0003365000</td>
			<td></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Rotary Wheel&#160;</td>
			<td style="width:100px;">Labnet International, US</td>
			<td style="width:119px;">H5500-230 V</td>
			<td></td>
		</tr>
	</tbody>
</table>

determination of zeta potential via nanoparticle translocation velocities through a tunable nanopore: using dna-modified particles as an example

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and nanoparticles. Tunable resistive pulse sensing (TRPS) is a relatively recent adaptation to RPS that incorporates a tunable pore that can be altered in real time. Here, we use TRPS to monitor the translocation times of DNA-modified nanoparticles as they traverse the tunable pore membrane as a function of DNA concentration and structure (i.e., single-stranded to double-stranded DNA).
TRPS is based on two Ag/AgCl electrodes, separated by an elastomeric pore membrane that establishes a stable ionic current upon an applied electric field. Unlike various optical-based particle characterization technologies, TRPS can characterize individual particles amongst a sample population, allowing for multimodal samples to be analyzed with ease. Here, we demonstrate zeta potential measurements via particle translocation velocities of known standards and apply these to sample analyte translocation times, thus resulting in measuring the zeta potential of those analytes.
As well as acquiring mean zeta potential values, the samples are all measured using a particle-by-particle perspective exhibiting more information on a given sample through sample population distributions, for example. Of such, this method demonstrates potential within sensing applications for both medical and environmental fields.

<img alt="Figure 1" src="/files/ftp_upload/54577/54577fig1.jpg" /> 
Figure 1. Schematic representation of the processes of magnetic purification and a TRPS measurement. A) Example of magnetic purification of sample starting with a sample containing excess, unbound capture probe DNA. B) TRPS measurement example i) Particle passing through the nanopore and ii) Blockade event produced from particle temporarily occluding ions in the pore...

Watch this Scientific Journal Video about Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example at JoVE.com

Determination of Zeta Potential via Nanoparticle Translocation Velocities through a Tunable Nanopore: Using DNA-modified Particles as an Example

Here we use a polyurethane tunable nanopore integrated into a resistive pulse sensing technique to characterize nanoparticles surface chemistry via the measurement of particle translocation velocities, which can be used to determine the zeta potential of individual nanoparticles.

Nanopore technologies, known collectively as Resistive Pulse Sensors (RPS), are being used to detect, quantify and characterize proteins, molecules and ...

The overall goal of this procedure is to characterize the surface chemistry of nano particles using tunable resistant post sensing, or TRPS, and determine the zeta potential of the material. This is demonstrating by characterizing DNA modified nano particles. This method can help answer key questions in the characterization of nanomaterials and the development of bioassay.The main advantage of this technique is that you can complete particle by particle analysis. Each DNA particle signal is translated into a zeta potential measurement, providing a complete picture of the sample being analyzed. The oldest method could provide insight into the characterization of materials.It can also be applied to other applications, such as the development of bioassay for the detection of cells, viruses, DNA, and proteins. Generally, individual new to this method will struggle because it's not a simple inject the samp and then wait for the answer. There is some input from the scientist needed.To begin this procedure, vortex streptavidin coated particles for 30 seconds before sonication for two minutes at 80 watts to assure mono dispersity. Dilute the streptavidin coated particles one in one hundred in PBST buffer to achieve a resulting concentration of one times ten to the nine particles per milliliter. Then vortex the particles for 30 seconds.Based on a binding capacity of 4, 352 picomols per milligram at the appropriate concentration of DNA to the particles for resulting concentrations of 10, 20, 30, 40, 47, 95, 140, and 210 nanomolar. After vortexing the samples for 10 seconds, place them on a rotary wheel at room temperature for 30 minutes to allow the DNA to bind to the particle surfaces via a streptavidin biotin interaction. Once the captured DNA has been added and incubated with the particles, remove the excess DNA and solution via magnetic separation by placing the samples onto a magnetic rack for 30 minutes.Following this, remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. Now add the required amount of target DNA to each sample to ensure the maximum possible target binding was reached.Vortex the samples for 10 seconds. And place them on the rotary wheel at room temperature for 30 minutes. Once the hybridization is complete, remove the excess target DNA via magnetic separation by placing the samples onto the magnetic rack for 30 minutes.Next remove the supernatant, taking care not to disturb the newly formed cluster of particles, closest to the magnet. Then replace the supernatant with the same volume of fresh PBST buffer. After repeating the previous steps for duplicate samples, place the samples on the rotary wheel at room temperature for 16 hours to investigate DNA hybridization times.At this point, plug in a TRPS instrument into a computer system with software in place. Using calipers, measure the distance between the outside of two parallel jaws. Type the distance in the stretch field in the instrument settings tab and click on calibrate stretch underneath the tab.Following this, laterally fit a polyurethane nanopore membrane of appropriate sizing for analysis onto the jaws with the nanopore ID number facing upward. Then stretch the jaws to the stretch required for analysis using the stretch adjustment handle on the side of the instrument. Place 80 microliters of PBST buffer in the lower fluid cell beneath the nanopore, ensuring there are no bubbles present that may affect the measurement.Now click the upper fluid cell into place and add 40 microliters of buffer, ensuring there are no bubbles present. Then place a faraday cage over the system and apply an external pressure as described in the text protocol. After placing 40 microliters of the calibration particles into the upper fluid cell, complete a TRPS measurement at three applied voltages.Alter the voltage by clicking on the plus and minus buttons on the voltage scale in the instrument settings tab in the software. Check that the three voltages return the appropriate background currents. And ensure that at the medium voltage, the calibration particles produce an average blockade magnitude of at least 0.3 nanoamperes.Once the conditions outlined in the text protocol have been achieved, start the run by clicking start in the software in the data acquisition tab. To complete the measurement, click stop in the data acquisition tab and save the data file. Wash the system by replacing the calibration particles with 40 microliters with PBST buffer into the upper fluid cells several times.And applying various pressures until no more blockade events are present, ensuring there are no residual particles and no cross contamination. After the appropriate baseline current is achieved, replace the electrolyte in the upper fluid cell with 40 microliters of sample. Start the sample run by clicking start in the data acquisition tab.Record a minimum of 500 particles and ensure the run time is a minimum of 30 seconds. To complete the measurement, click stop in the data acquisition tab and save the data file. An example of size and zeta potential analysis of streptavidin coated particles with no modifications and streptavidin coated particles saturated with single stranded DNA on the surface is shown here.Although both samples were of a similar size, the zeta potential was significantly different and much larger when DNA was functionalized onto the particle surface. The size and zeta potential data exhibited for samples with the lowest an highest concentrations of DNA hybridized to the streptavidin coated particles is displayed here. A larger zeta potential value is recorded for particles hybridized with a higher concentration of DNA.The change in zeta potential measured for capture probed DNA only, a fully complementary DNA target, a middle binding DNA target, an end binding DNA target, and an overhanging DNA target is shown here. Once mastered, this technique can be done in 20 minutes if it is performed properly. While attempting this procedure it's important to remember to thoroughly wash a nanopole between each calibration and sample to ensure there is no cross contamination between samples and prevent any nanopole blocking.After its development, this technique paved the way for researchers in the field of biosenses to explore protein-protein and protein-DNA interactions in multiplex assays. After watching this video you should have a good understanding of how to obtain zeta potential using TRPS and prepare DNA modified particles for bioassays.

Research

JoVE Journal

Bioengineering

Contrast Ultrasound Targeted Treatment of Gliomas in Mice via Drug-Bearing Nanoparticle Delivery and Microvascular Ablation

We are developing minimally-invasive contrast agent microbubble based therapeutic approaches in which the permeabilization and/or ablation of the ...

A Microfluidic-based Hydrodynamic Trap for Single Particles

The ability to confine and manipulate single particles in free solution is a key enabling technology for fundamental and applied science.  Methods for ...

Quantification and Size-profiling of Extracellular Vesicles Using Tunable Resistive Pulse Sensing

Extracellular vesicles (EVs), including &#8216;microvesicles&#8217; and &#8216;exosomes&#8217;, are highly abundant in bodily fluids. Recent years have ...

A Microfluidic Platform for Precision Small-volume Sample Processing and Its Use to Size Separate Biological Particles with an Acoustic Microdevice

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. ...

Imaging Cell Viability on Non-transparent Scaffolds &#8212; Using the Example of a Novel Knitted Titanium Implant

Intervertebral disc degeneration and disc herniation is one of the major causes of lower back pain. Depletion of extracellular matrix, culminating in ...

Tunable Hydrogels from Pulmonary Extracellular Matrix for 3D Cell Culture

Here we present a method for establishing multiple component cell culture hydrogels for in vitro lung cell culture. Beginning with healthy en bloc lung ...

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Transmission of Multiple Signals through an Optical Fiber Using Wavefront Shaping

The transmission of multiple independent optical signals through a multimode fiber is accomplished using wavefront shaping in order to compensate for the ...

An Integrated System to Remotely Trigger Intracellular Signal Transduction by Upconversion Nanoparticle-mediated Kinase Photoactivation

Upconversion nanoparticle (UCNP)-mediated photoactivation is a new approach to remotely control bioeffectors with much less phototoxicity and with deeper ...