이 작품은 상 파울로 연구 재단 (FAPESP;에 의해 지원 되었다 12/19561-0 부여) 및 막스 플랑크 협회. 엘리아스 F. Araújo (FAPEMIG 14/30594), 캐롤라이나 C. 몬테 벨로 (FAPESP; 14/10407-3 그랜트) Valéria Mafra (FAPESP; 부여 14/07918-6), 그리고 비비 안 C. H. 다 실바 (망 토/CNPEM 24/2013)는 장학금에 대 한 감사. 저자 아낌없이 RPS6에 대하여 항 체를 제공 하는 기독교 메이어 인 장 피에르 Bourgin (INRA, 베 르 사 이유, 프랑스)에서 감사 합니다. 저자 감사 RTV UNICAMP와에 드 파울로 Aparecido de Souza Manoel 오디오 동안 그들의 기술 지원에 대 한 기록.

1. 액체와 고체 배양의 준비
<ol><li>비타민 [코발트 염화 물 pentahydrate의 0.0125 mg/L, copper(II) 황산 pentahydrate의 0.0125 mg/L, ethylenediaminetetraacetate 제 2 철 나트륨, 3.10 mg/L의 18.35 mg/L와 반 강도 Skoog (MS)와 村 重 매체를 사용 하 여 액체 매체 준비 붕 소의 산 성, 0.415 mg/L 요오드 화 칼륨, 망간의 8.45 mg/L의 황산 토스, 0.125 mg/L 나트륨 몰 리브 덴이 수화물, 4.30 mg/L 아연 황산 염 heptahydrate, 166.01 mg/L 칼슘 염화 물, 칼륨 디 인산, 950 mg/L의 85 mg/L의의 질 산 칼륨, 황산 마그네슘의 90.27 mg/L, 825 mg/L 질 산 암모늄의, 글리신의 1 mg/L, myo-이노 시 톨의 50mg/L, 니코틴산 산의 0.25 mg/L, 피리 독신 염 산 염의 0.25 mg/L 및 티 아민 염 산 염의 0.05 mg/L] 0.25 g/l의 보완 MES, 10 m 코 5.8에 pH를 조정 하 고.</li>
	<li>한 천의 반 강도 MS-고체 매체를 만들기 위해 10 g/L를 추가 합니다. 압력솥 사용 하기 20 분 전에 121 ° C에서 매체.</li>
</ol>2. 수경 시스템 조립
참고:이 단계를 따라야 한다 꼼꼼하게 수경 시스템을 구축.
<ol><li>
소재 살 균
	<ol>
<li>팩 압력솥 가방에 피 펫 팁 랙 (커버) 없이 minitanks로 사용 될 것 이다. 오토 클레이 브 랙 20 분, 15 psi에 대 한 121 ° C에서. 참고: 우리가 사용 하는 폴 리 프로필 렌 피 펫 팁 랙 했다 다음 치수: 120 mm (길이) x 89 mm (폭) x 55 mm (높이). 피 펫 팁 평평한 표면 문화 매체의 추가 대 한 영역을가지고 있어야 합니다. 다른 팁 랙 사용 될 수 있다 ( 재료의 표참조). 참고: 수경 시스템의 조립 절차, 그것은 청소 되어야 하며 사용 하기 전에 70% 에탄올으로 소독 하는 층 류 후드, 사용 하는 데 필요한. 실험 실험실 외 투를 착용 해야 합니다, 그들의 손을 씻고 하 고 노출 된 피부, 70% 에탄올으로 소독. 장갑은 약물 응용 프로그램 제외 옵션입니다.</li>
		<li>층 류 두건에 들어가기 전에 70% 에탄올 (일회용 플라스틱 상자, 접착 테이프, 펫가 위, 및 핀셋) 위에서 설명한 모든 액세서리를 청소. 후드 허용 하는 경우 소독 작업 영역을 유지 하기 위해서는 수경 시스템을 조립 하기 전에 10 분 동안 UV 빛을 켜십시오.</li>
	</ol>
</li>
	<li>
Minitank 조립
	<ol>
<li>피 펫 팁 평평 접착 테이프로 (그림 1B)의 상부 표면 인감. 가능 하면 두고 자외선 아래 빛 10 분.</li>
		<li>잘 사용 하 여 각 멀티 채널 피 펫 (그림 1C)에 녹은 고체에 MS 문화 매체 (약간 따뜻한)의 180 µ L를 추가 합니다. 참고: 많은 탱크를 준비할 때 응고에서 MS 중간을 열판을 사용 합니다.</li>
		<li>완전히 (약 30 분) 동안 강화 하기 위해 매체를 허용 합니다. 참고: 응고 기간 동안 UV 빛 설정할 수 있습니다.</li>
		<li>피 펫 팁 랙 액체 MS 문화 매체 (그림 1D)와 완전히 위로 고체와 액체 미디어 간의 긴밀 한 접촉 보장.</li>
		<li>피 펫 팁 플랫의 상부 표면의 접착제 테이프를 제거 하 고 신중 하 게 선반에 맞는. 수경 시스템 이제 소독된 씨앗을 받을 준비가 되어 있습니다.</li>
	</ol>
</li>
</ol>3. 종자 살 균
<ol><li>1.5 mL microtube에 장소 500 애기 씨앗. 많은 microtubes를 사용 하 여 실험에 필요한 식물의 수에 따라 필요에 따라.</li>
	<li>부드러운 동요와 함께 2 분 동안 70% 에탄올과 씨앗을 씻어. 씨앗 정착, 다음 에탄올을 신중 하 게 제거 하자.</li>
	<li>폴 20 세제의 2 µ L을 포함 하는 10% 염소 솔루션의 1 mL를 추가 합니다. 교 반 하십시오 5 분 제거를 위한 솔루션 솔루션 신중 하 게.</li>
	<li>모든 표 백제 잔류물은 완전히 제거 (약 5 배) 될 때까지 살 균 증류수와 함께 씨 린스. 참고: 표면 살 균 후 씨앗 살 균 증류수에 몰입 되었고 5 d는 발 아를 동기화를 위해 어둠 속에서 4 ° C에서 층 화. 참고: 강아지 풀 (증가 A10.1)의 씨앗 15 분 (휴식 물리적 휴면) 집중된 한 황산에 preincubated, 멸 균 증류수에 철저 하 게 세척 되었고 5% 염소 솔루션 disinfested 포함 하는 부드러운 동요215 분 0.1% 폴 20. 나머지 살 균 단계 애기 씨앗에 대 한 설명에 동일 했다.</li>
</ol>4. 씨앗 응용 프로그램
<ol><li>약간 메 마른 메스의 도움으로 200 µ L 팁의 말단 절단.</li>
	<li>애기 씨 플랫 피 펫 팁의 상부 표면에 고체 배양으로 플라스틱. 매체는 평면;에서 느슨하게 하지 않습니다 돌 봐 그렇지 않으면, 씨앗 음영 처리 되며 묘 제대로 성장 하지 것입니다 (그림 1E). 참고: (와 함께 위쪽으로 위치 배아) 강아지 씨에 대 한 살 균 족집게를 사용 합니다.</li>
	<li>환경 미생물 (1 층 그림)에서 무료로 유지 하 고 높은 습도 유지 하는 일회용 플라스틱 상자 안에 가능한 많은 minitanks를 저장 합니다.</li>
	<li>철저 하 게 오염을 피하기 위하여 접착 테이프를 사용 하 여 일회용 플라스틱 상자를 봉인 합니다.</li>
	<li>수경 시스템의를 공장에 대 한 적절 한 성장 조건 성장 챔버에 넣으십시오. 참고:이 작품에서 다음 조건 사용 되었다: 75%의 습도, 및 150 µmol m-2의 -1 의 irradiance 무더운 12 h 빛 (21 ° C) / 12 h 어두운 (19 ° C)에 대 한 조건을 애기, 또는 300 µmol m-2의 -1 의 irradiance와 12 h 빛 (28 ° C) / 12 h 어두운 (25 ° C) 강아지 (그림 1G 및 1 시간).</li>
</ol>5. 검증 대상 Rapamycin 키 니 아 제를 억제 하기 위해이 수경 시스템의 사용
참고:이 수경 시스템 처음 식물을, 일반적으로 매우 비싼 대규모 실험에 적용 되는 화학 물질의 관리를 촉진 하기 위하여 개발 되었다. 개념의 증거로 서 ATP 경쟁 억제 물 AZD-8055, 특히 토르 단백질 키 니 아 제22의 ATP 바인딩 사이트를 대상으로 알려져, A. thaliana 컬럼비아-0 (모 종에서 토르 활동의 억압에 따라 고용 했다 노팅엄 애기 사진 센터, NASC ID: N22681). 여기, 사용 하는 프로토콜은 간단히 설명 합니다.
<ol><li>성장 씨앗 수경 무대 1.04는 BBCH 따라 규모23 (약 11 d) 때까지 위에서 설명한 기후 조건. 신선한 중간 포함 0.05 %DMSO (제어), 2 µ M로 영양소 솔루션 교체 AZD-8055 (토르 억제제) 밤 (EN)의 끝에 치료 (모의) 없이 DMSO, 또는 희석.</li>
	<li>치료 후 다른 시간 지점에서 일부 묘 목 수확 하 고 뿌리와 새싹으로 그들을 분리. 액체 질소에서 샘플을 동결, 로봇 분쇄기에 정밀한 분말에 갈기 ( 재료의 표참조), 사용까지-80 ° C에서 분말을 저장.</li>
	<li>Phosphorylated 및 비 phosphorylated 형태의 로부터 40 ribosomal 단백질 S6 (RPS6) Dobrenel 그 외 여러분 에 따르면 Immunoblot 24.</li>
	<li>샘플 depigmentation에 대 한 그대로 묘 표 백제, 증류수에 세척, 5 분25, 요오드 용액에 담가 그리고 stereomicroscope (목표, 20 x 근사, 및 7.5 x 크기 X 0.63)에 묘 목에 대 한 사진 한 녹말 함유량의 질적 평가입니다.</li>
	<li>NADPH26,27NADP+ 의 감소에 결합 하 여 효소 저하 및 출시 된 혈당 측정을 spectrophotometrically 다음 전 분을 계량.</li>
	<li>총 RNA 추출, cDNA 합성, 그리고 Caldana 그 외 여러분 에 의해 설명된대로 양적 RT-PCR 분석 실험을 수행 긴장의 다른 종류와 관련 된 유전자의 식 수준을 평가에 28 .</li>
	<li>필요한 경우, 유사한 기후 조건 [습도 60%, 150 µmol m-2의 -1 의 방사, 및 무더운 조건 12 h 빛 (21 ° C) / 12 h 어두운 (19 ° C에서 0.1 L 용량 플라스틱 화분에서 원 예 기판에 묘 목 성장 )] 모 종 수경 재배와 그들을 비교 하기 위해 참고: 대상 유전자 유전자 표정 분석 실험에 사용 했다 ABF3 (At4g34000), ASN1 (At3g47340), 및 TPS5 (At4g17770), 및 그들의 식 수준 를 사용 하 여 델타 Ct 방법29 고용 정상화 했다 ACT2 (At3g18780) 또는 PDF2 (At4g04890) 내부 기준 유전자로 모든 샘플에서 PCR 증폭 효율의 100%를 가정. 양이 많은 PCR에 사용 하는 oligonucleotide 쌍 했다: ABF3 (GTTCTCAACCTGCAACACAGTGC; TCCAGGAGATACTGCTGCAACC), ASN1 (AGGTGCGGACGAGATCTTTG; GTGAAGAGCCTTGATCTTGC), TPS5 (CTGCTCTGATGCTCCTTCTTCC; AAGCTGGTTTCCAACGATGATG), ACT2 (CGTACAACCGGTATTGTGCTGG; CTCTCTCTGTAAGGATCTTCATG), 및 PDF2 (TAACGTGGCCAAAATGATGC; GTTCTCCACAACCGCTTGGT)입니다.</li>
</ol>

저자는 공개 없다.

이 최적화 된 수경 구조 식물의 성공적인 생체 외에서 문화를 수 있습니다. 씨앗은 잘 피 펫 팁 평평한 표면에 고체 매체, 씨앗 영양 솔루션 젖된 시스템에 비해 상당한 이득에 출 아 할. 이 시스템의 큰 장점은 그 종묘 개발 하는 동안 뿌리 연락해 직접 전이의 필요 없이 액체 매체 이다. 또한, 화학 치료 감소 볼륨에 액체 매체에 쉽게 적용할 수 있습니다. 습도 높은 영양소 솔루션 및 그것의 ...

수경 법을 사용 하 여 성장 하는 식물의 장점은 재현 실험1,2,3을 사용 하는 크고 균일 한 공장의 생산에 널리 인정 되었습니다. 이 시스템에서 영양 솔루션의 구성 제대로 통제 되 고 식물 성장 및 개발의 모든 단계에 따라 재활용. 또한, 토양 재배, 식물 영양 기아 및 물 부족4등에서 발생할 수 있습니다으로 뿌리 abiotic 스트레스를 받게 하지 됩니다. 식물 성장 수경 존재 형태 및 생리 적 특성 토양에서 경작 하는 사람에 게 상당히 유사한로이 시스템은 광범위 하 게 고용 연구에서 루트/촬영 성장과 없이 그들의 수확의 모니터링을 허용 하기 때문에 부상2,5.
구성과 영양 용액의 농도 변경의 가능성으로 인해 수경 조건을 사용 하 여 연구의 대부분의 마이크로-macronutrients1,3 기능을 특성화 하 수행 되었습니다. 6,,78. 그러나,이 시스템은 다양 한 식물 생물학, 호르몬과 식물 화학 물질의 기능을 명료 하 게와 같은 응용 프로그램에 매우 유용을 입증 했다. 예를 들어, 호르몬9 및 brassinosteroid 응용 프로그램10 에 의해 실행 가속된 성장 표현 형의 새로운 클래스 strigolactones의 발견 수경 조건 하에서 수행 했다. 또한,이 시스템은 레이블이 동위 원소 실험을 수 있습니다 (예를 들어, 14N /15N 및 13CO2)11,단백질 및 대사 산물에 그들의 합동 평가12 의해 질량 분석.
식물 연구에이 시스템의 중요성을 고려 하면 높은 수경 문화 수 수경 컨테이너3, 묘 판에서 전이 (i)을 사용 하는 시스템을 포함 하 여 지난 몇 년 동안에서 설계 되었습니다 13; (ii) rockwool 루트 개발2,,1415;의 초기 단계에 대 한 액세스를 제한 하 (3) 폴 리 에틸렌 알갱이 작은 분자/치료 어려운16;의 유형이 같은 응용 프로그램을 만드는 부동 본문으로 또는 (iv)는 감소 된 수의 식물9,17. 이러한 프로토콜의 대부분에서 설명 하는 수경 탱크의 볼륨은 일반적으로 대형 (최대 32 L 1-5 L에서 배열 하는 작은 볼륨)18, 화학 물질의 응용 프로그램을 매우 비싼 게. 몇 가지 연구는 무 균 조건8,에서 수경 재배를 설명 할19, 시스템의 어셈블리는 일반적으로 매우 힘 드는, 플라스틱이 나 유리에 나일론 메시의 완벽 한 조정의 구성 컨테이너5,8,,1720.
모델 식물으로 애기 thaliana 의 중요성 때문 수경 법 시스템의 대부분은이 종1,2,8,,1418, 을 위해 설계 되었습니다. 19 , 20. 그럼에도 불구 하 고, 그들의 발 아를 개선 하기 위해 씨앗의 전처리와 다른 식물 종의 수경 성장 기능을 보고 몇 가지 연구와 동기화 요금 체 외에서8,16 . 대규모 작업, 우리는 간단 하 고 저렴 한 비용 유지 보수 수경 시스템입니다 성장 하는 식물, A. thaliana 등 잔디 강아지 같은 다른 종족에 대 한 살 균 조건을 설정 하기 위한 프로토콜 개발 풀. 묘 종 성장을 최대화 수 있습니다 동기화, 그리고 쉽게 모니터링 방법을 여기에 설명 된 다른 실험을 위해 적당 하다. 또한,이 시스템은 많은 이점이 있다: (i) 해당 어셈블리는 간단 하 고 구성 요소를 다시 사용할 수 있습니다; (2) 액체 매체;에 다른 화학 물질의 쉬운 응용 프로그램 수 (iii) 묘 목 발 아 성장과 전이 필요 없이 문화 매체에서 직접 수경 법 시스템; (iv) 촬영 및 루트 개발/성장 밀접 하 게 감독 하 고 묘는 손해; 없이 수확 하 고 있다 (v) 그것은 가능 하 게 큰 규모로 일 생리 상태를 유지.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Ethanol</td>
			<td>Merck</td>
			<td>100983</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium hypochlorite solution</td>
			<td>Sigma-Aldrich</td>
			<td>425044</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20&#160;&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>P2287</td>
			<td></td>
		</tr>
		<tr>
			<td>Murashige and Skoog (MS) medium including vitamins&#160;</td>
			<td>Duchefa Biochemie</td>
			<td>M0222</td>
			<td></td>
		</tr>
		<tr>
			<td>2-(N-morpholino)ethanesulfonic acid (MES) monohydrate</td>
			<td>Duchefa Biochemie</td>
			<td>M1503</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>A7921</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium hydroxide</td>
			<td>Sigma-Aldrich</td>
			<td>484016</td>
			<td></td>
		</tr>
		<tr>
			<td>Laminar flow hood</td>
			<td>Telstar</td>
			<td>BH-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Hotplate</td>
			<td>AREC</td>
			<td>F20510011</td>
			<td></td>
		</tr>
		<tr>
			<td>Growth chamber</td>
			<td>Weiss Technik</td>
			<td>HGC 1514</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass Petri dish (150 mm x 25 mm)</td>
			<td>Uniglass</td>
			<td>189.006</td>
			<td></td>
		</tr>
		<tr>
			<td>200 &#956;L pipette tip racks&#160;</td>
			<td>Kasvi</td>
			<td>K8-200-5 *</td>
			<td></td>
		</tr>
		<tr>
			<td>300 &#956;L multichannel pipette</td>
			<td>Eppendorf</td>
			<td>3122000060</td>
			<td></td>
		</tr>
		<tr>
			<td>300 &#956;L pipette tips</td>
			<td>Eppendorf</td>
			<td>30073088</td>
			<td></td>
		</tr>
		<tr>
			<td>200 &#956;L pipette&#160;</td>
			<td>Eppendorf</td>
			<td>3120000054</td>
			<td></td>
		</tr>
		<tr>
			<td>200 &#956;L pipette tips</td>
			<td>Eppendorf</td>
			<td>30000870</td>
			<td></td>
		</tr>
		<tr>
			<td>Scissors</td>
			<td>Tramontina</td>
			<td>25912/108</td>
			<td></td>
		</tr>
		<tr>
			<td>Tweezer</td>
			<td>ABC Instrumentos</td>
			<td>702915</td>
			<td></td>
		</tr>
		<tr>
			<td>Scalpel blade</td>
			<td>Sigma-Aldrich</td>
			<td>S2771</td>
			<td></td>
		</tr>
		<tr>
			<td>Adhesive transparent tape (45mm x 50m)</td>
			<td>Scotch 3M</td>
			<td>5803</td>
			<td></td>
		</tr>
		<tr>
			<td>Disposable plastic boxes, external dimensions: 353 mm (L)x 178 mm (W) x 121mm (H)</td>
			<td>Maxipac</td>
			<td>32771</td>
			<td></td>
		</tr>
	</tbody>
</table>

a flexible low cost hydroponic system for assessing plant responses to small molecules in sterile conditions

식물 생물학에 있는 연구의 넓은 범위는 수경 문화를 사용 하 여 수행 됩니다. 이 작품에는 체 외에서 수경 성장 시스템 식물 화학 물질 및 기타 물질의 응답을 평가 하기 위해 설계 된 제공 됩니다. 이 시스템은 각각의 C3 와 C4 모델 종 애기 thaliana 와 강아지 풀, 균질 하 고 건강 한 묘를 얻기에 매우 효율적입니다. 무 균 재배 식물 정상적인 성장과 개발 수경 법에 대 한 제한 요인으로 알려져 있다 조류 및 미생물 오염 방지 합니다. 또한,이 시스템은 확장성, 필요한 경우 작은 기계적 손상, 대규모 공장 설비 재료의 수확 뿐만 아니라 식물의 개별 부품의 수확을 사용. 자세한 프로토콜을 사용 하 여 피 펫 선반 주요 플랫폼으로 성장 하는 식물,이 시스템은 간편 하 고 저렴 한 비용 어셈블리, 있다 보여주는 제공 됩니다. 이 시스템의 타당성은 마약 AZD-8055, rapamycin (TOR) 키의 대상의 화학 억제제의 효과 평가 하기 위해 애기 묘를 사용 하 여 유효성이 검사 됩니다. TOR 금지 효율적으로 뿌리와 새싹에 AZD-8055 치료 후 30 분으로 일찍 발견 되었다. 또한, AZD 8055 치료 식물 표시 예상된 전 분 초과 표현 형. 우리 식물 연구원 식물 inducers 또는 억제제도의 동작을 모니터링 하는 것을 목표로 평가 일반적으로 비싼의 사용을 요구 하는 동위 원소 라벨 화합물을 사용 하 여 신진 대사 용으로 이상적인 방법으로이 수경 시스템 제안 시 약입니다.

토르 니 영양소와 세포 증식 및 성장 모든 진핵생물에서 신호 에너지를 통합 하는 주요 레 귤 레이 터 이다. 애기 유전자 변형 줄 RNA 간섭 또는 인공 예측에 관한28,,3031, 토르 조건부 억압의 생성을 포함 하는 식물에서 TOR 기능을 명료 하 게 하는 노력 토르 녹아웃 식물32,...

Watch this Scientific Journal Video about A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions at JoVE.com

A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions

간단 하 고, 다재 다능 한, 고 저가 생체 외에서 수경 시스템 성공적으로, 메 마른 조건 하에서 대규모 실험을 수 있도록 최적화 되었다. 이 시스템 솔루션 및 분자, 생화학, 생리 적 연구에 대 한 뿌리에 의해 그들의 효율적인 흡수 화학 물질의 응용 프로그램을 지원합니다.

유연한 저비용 수경 시스템 살 균 조건에서 작은 분자에 식물 응답을 평가 하기 위한

A wide range of studies in plant biology are performed using hydroponic cultures. In this work, an in vitro hydroponic growth system designed for ...

a-flexible-low-cost-hydroponic-system-for-assessing-plant-responses

Research

JoVE Journal

Environment

10.4K 조회수.  Brazilian Center for Research in energy and materials (CNPEM). 간단 하 고, 다재 다능 한, 고 저가 생체 외에서 수경 시스템 성공적으로, 메 마른 조건 하에서 대규모 실험을 수 있도록 최적화 되었다. 이 시스템 솔루션 및 분자, 생화학, 생리 적 연구에 대 한 뿌리에 의해 그들의 효율적인 흡수 화학 물질의 응용 프로그램을 지원합니다.

비디오: A Flexible Low Cost Hydroponic System for Assessing Plant Responses to Small Molecules in Sterile Conditions

Methods for Performing Crosses in Setaria viridis, a New Model System for the Grasses

Setaria viridis is an emerging model system for C4 grasses. It is closely related to the bioenergy feed stock switchgrass and the grain crop foxtail millet. Recently, the 510 Mb genome of foxtail millet, S. italica, has been sequenced 1,2 and a 25x coverage genome sequence of the weedy relative S. viridis is in progress. S. viridis has a number of characteristics that make it a potentially excellent model genetic system including a rapid generation time, small stature, simple growth requirements, prolific seed production 3 and developed systems for both transient and stable transformation 4. However, the genetics of S. viridis is largely unexplored, in part, due to the lack of detailed methods for performing crosses. To date, no standard protocol has been adopted that will permit rapid production of seeds from controlled crosses.
The protocol presented here is optimized for performing genetic crosses in S. viridis, accession A10.1. We have employed a simple heat treatment with warm water for emasculation after pruning the panicle to retain 20-30 florets and labeling of flowers to eliminate seeds resulting from newly developed flowers after emasculation. After testing a series of heat treatments at permissive temperatures and varying the duration of dipping, we have established an optimum temperature and time range of 48 &deg;C for 3-6 min. By using this method, a minimum of 15 crosses can be performed by a single worker per day and an average of 3-5 outcross progeny per panicle can be recovered. Therefore, an average of 45-75 outcross progeny can be produced by one person in a single day. Broad implementation of this technique will facilitate the development of recombinant inbred line populations of S. viridis X S. viridis or S. viridis X S. italica, mapping mutations through bulk segregant analysis and creating higher order mutants for genetic analysis.

Methods for Performing Crosses in Setaria viridis, a New Model System for the Grasses

We have developed a methodology for performing crosses in Setaria viridis (S. viridis). The method involves pruning the panicle prior to a hot water treatment to kill viable pollen. Crosses are performed following a well-controlled growth regime and typically result in the recovery of 1 to 7 cross-pollinated seed/s per panicle.

에 십자가를 수행하는 방법<em&gt; 강아지풀</em목초에 대한&gt;, 새로운 모델 시스템

Setaria viridis is an emerging model system for C4 grasses. It is closely related to the bioenergy feed stock switchgrass and the grain crop foxtail ...

연구

환경과학

A Rapid and Efficient Method for Assessing Pathogenicity of Ustilago maydis on Maize and Teosinte Lines

Maize is a major cereal crop worldwide. However, susceptibility to biotrophic pathogens is the primary constraint to increasing productivity. U. maydis is a biotrophic fungal pathogen and the causal agent of corn smut on maize. This disease is responsible for significant yield losses of approximately $1.0 billion annually in the U.S.1 Several methods including crop rotation, fungicide application and seed treatments are currently used to control corn smut2. However, host resistance is the only practical method for managing corn smut. Identification of crop plants including maize, wheat, and rice that are resistant to various biotrophic pathogens has significantly decreased yield losses annually3-5. Therefore, the use of a pathogen inoculation method that efficiently and reproducibly delivers the pathogen in between the plant leaves, would facilitate the rapid identification of maize lines that are resistant to U. maydis. As, a first step toward indentifying maize lines that are resistant to U. maydis, a needle injection inoculation method and a resistance reaction screening method was utilized to inoculate maize, teosinte, and maize x teosinte introgression lines with a U. maydis strain and to select resistant plants.
Maize, teosinte and maize x teosinte introgression lines, consisting of about 700 plants, were planted, inoculated with a strain of U. maydis, and screened for resistance. The inoculation and screening methods successfully identified three teosinte lines resistant to U. maydis. Here a detailed needle injection inoculation and resistance reaction screening protocol for maize, teosinte, and maize x teosinte introgression lines is presented. This study demonstrates that needle injection inoculation is an invaluable tool in agriculture that can efficiently deliver U. maydis in between the plant leaves and has provided plant lines that are resistant to U. maydis that can now be combined and tested in breeding programs for improved disease resistance.

A Rapid and Efficient Method for Assessing Pathogenicity of Ustilago maydis on Maize and Teosinte Lines

The use of a needle injection method to inoculate maize and teosinte plants with the biotrophic pathogen Ustilago maydis is described. The needle injection inoculation method facilitates the controlled delivery of the fungal pathogen in between the plant leaves where the pathogen enters the plant through the formation of appresoria. This method is highly efficient, enabling reproducible inoculations with U. maydis.

옥수수와 테오신테 라인에 우스틸라고 성 실증의 병원성을 평가하기위한 신속하고 효율적인 방법

Maize is a major cereal crop worldwide. However, susceptibility to biotrophic pathogens is the primary constraint to increasing productivity. U. maydis is ...

Single-plant, Sterile Microcosms for Nodulation and Growth of the Legume Plant Medicago truncatula with the Rhizobial Symbiont Sinorhizobium meliloti

Rhizobial bacteria form symbiotic, nitrogen-fixing nodules on the roots of compatible host legume plants. One of the most well-developed model systems for studying these interactions is the plant Medicago truncatula cv. Jemalong A17 and the rhizobial bacterium Sinorhizobium meliloti 1021. Repeated imaging of plant roots and scoring of symbiotic phenotypes requires methods that are non-destructive to either plants or bacteria. The symbiotic phenotypes of some plant and bacterial mutants become apparent after relatively short periods of growth, and do not require long-term observation of the host/symbiont interaction. However, subtle differences in symbiotic efficiency and nodule senescence phenotypes that are not apparent in the early stages of the nodulation process require relatively long growth periods before they can be scored. Several methods have been developed for long-term growth and observation of this host/symbiont pair. However, many of these methods require repeated watering, which increases the possibility of contamination by other microbes. Other methods require a relatively large space for growth of large numbers of plants. The method described here, symbiotic growth of M. truncatula/S. meliloti in sterile, single-plant microcosms, has several advantages. Plants in these microcosms have sufficient moisture and nutrients to ensure that watering is not required for up to 9 weeks, preventing cross-contamination during watering. This allows phenotypes to be quantified that might be missed in short-term growth systems, such as subtle delays in nodule development and early nodule senescence. Also, the roots and nodules in the microcosm are easily viewed through the plate lid, so up-rooting of the plants for observation is not required.

Single-plant, Sterile Microcosms for Nodulation and Growth of the Legume Plant Medicago truncatula with the Rhizobial Symbiont Sinorhizobium meliloti

Growth of Medicago truncatula plants in symbiosis with the nitrogen-fixing bacteria Sinorhizobium meliloti in individual, sterile microcosms made from standard laboratory plates permits frequent examination of root systems and nodules without compromising sterility. Plants can be maintained in these growth chambers for up to 9 weeks.

유괴와 콩과 식물의 성장을위한 단일 공장, 무균 소우주<em&gt; 개자리 truncatula</em&gt; Rhizobi​​al 공생과<em&gt; Sinorhizobi​​um meliloti</em

Rhizobial  bacteria form symbiotic, nitrogen-fixing nodules on the roots of compatible host  legume plants.  One  of the most well-developed model systems ...

Pretreatment of Lignocellulosic Biomass with Low-cost Ionic Liquids

A number of ionic liquids (ILs) with economically attractive production costs have recently received growing interest as media for the delignification of a variety of lignocellulosic feedstocks. Here we demonstrate the use of these low-cost protic ILs in the deconstruction of lignocellulosic biomass (Ionosolv pretreatment), yielding cellulose and a purified lignin. In the most generic process, the protic ionic liquid is synthesized by accurate combination of aqueous acid and amine base. The water content is adjusted subsequently. For the delignification, the biomass is placed into a vessel with IL solution at elevated temperatures to dissolve the lignin and hemicellulose, leaving a cellulose-rich pulp ready for saccharification (hydrolysis to fermentable sugars). The lignin is later precipitated from the IL by the addition of water and recovered as a solid. The removal of the added water regenerates the ionic liquid, which can be reused multiple times. This protocol is useful to investigate the significant potential of protic ILs for use in commercial biomass pretreatment/lignin fractionation for producing biofuels or renewable chemicals and materials.

The pretreatment of lignocellulosic biomass with protic low-cost ionic liquids is shown, resulting in a delignified cellulose-rich pulp and a purified lignin. The pulp gives rise to high glucose yields after enzymatic saccharification.

저가 이온 성 액체와 리그 노 셀룰로오스 바이오 매스의 전처리

A number of ionic liquids (ILs) with economically attractive production costs have recently received growing interest as media for the delignification of ...

Reliable Method for Assessing Seed Germination, Dormancy, and Mortality under Field Conditions

We describe techniques for approximating seed bank dynamics over time using Helianthus annuus as an example study species. Strips of permeable polyester fabric and glue can be folded and glued to construct a strip of compartments that house seeds and identifying information, while allowing contact with soil leachate, water, microorganisms, and ambient temperature. Strips may be constructed with a wide range of compartment numbers and sizes and allow the researcher to house a variety of genotypes within a single species, different species, or seeds that have experienced different treatments. As opposed to individual seed packets, strips are more easily retrieved as a unit. While replicate packets can be included within a strip, different strips can act as blocks or can be retrieved at different times for observation of seed behavior over time. We used a high temperature glue gun to delineate compartments and sealed the strips once the seed and tags identifying block and removal times were inserted. The seed strips were then buried in the field at the desired depth, with the location marked for later removal. Burrowing animal predators were effectively excluded by use of a covering of metal mesh hardware cloth on the soil surface. After the selected time interval for burial, strips were dug up and seeds were assessed for germination, dormancy and mortality. While clearly dead seeds can often be distinguished from ungerminated living ones by eye, dormant seeds were conclusively identified using a standard Tetrazolium chloride colorimetric test for seed viability.

Here we present a protocol for assessing seed survivorship, germination and dormancy under field conditions using buried, labeled seed strips and tetrazolium chloride (TZ) viability testing.

이 필드 조건에서 종자 발아, 휴면 및 사망률을 평가하기위한 신뢰할 수있는 방법

We describe techniques for approximating seed bank dynamics over time using Helianthus annuus as an example study species. Strips of permeable polyester ...

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus (Murayama), Using a Low-Cost, Small, and Easily Constructed Flight Mill

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). Therefore, knowing the dispersal capacity may help inform trapping/tree removal efforts to prevent this disease more effectively. In this study, we measured the flight velocity and duration and estimated the flight distance of the beetle using a newly developed flight mill. The flight mill is low cost, small, and constructed using commonly available items. Both the flight mill arm and its vertical axis comprise a thin needle. A beetle specimen is glued to one tip of the arm using instant glue. The other tip is thick due to being covered with plastic, thus it facilitates the detection of rotations of the arm. The revolution of the arm is detected by a photo sensor mounted on an infrared LED, and is indicated by a change in the output voltage when the arm passed above the LED. The photo sensor is connected to a personal computer and the output voltage data are stored at a sampling rate of 1 kHz. By conducting experiments using this flight mill, we found that P. quercivorus can fly at least 27 km. Because our flight mill comprises cheap and small ordinary items, many flight mills can be prepared and used simultaneously in a small laboratory space. This enables experimenters to obtain a sufficient amount of data within a short period.

Measuring the Flight Ability of the Ambrosia Beetle, Platypus Quercivorus Murayama, Using a Low-Cost, Small, and Easily Constructed Flight Mill

We developed a low cost and small flight mill, constructed with commonly available items and easily used in experimentation. Using this apparatus, we measured the flight ability of an ambrosia beetle, Platypus quercivorus.

저가, 소형, 그리고 쉽게 생성 된 비행 밀을 사용 하 여 신들의 딱정벌레, 오리너구리 Quercivorus (무라야마)의 비행 능력을 측정

The ambrosia beetle, Platypus quercivorus (Murayama), is the vector of a fungal pathogen that causes mass mortality of Fagaceae trees (Japanese oak wilt). ...

Construction of a Compact Low-Cost Radiation Shield for Air-Temperature Sensors in Ecological Field Studies

Low cost temperature sensors are increasingly used by ecologists to assess climatic variation and change on ecologically relevant scales. Although cost-effective, if not deployed with proper solar radiation shielding, the observations recorded from these sensors will be biased and inaccurate. Manufactured radiation shields are effective at minimizing this bias, but are expensive compared to the cost of these sensors. Here, we provide a detailed methodology for constructing a compact version of a previously described custom fabricated radiation shield, which is more accurate than other published shielding methods that attempt to minimize shield size or construction costs. The method requires very little material: corrugated plastic sheets, aluminum foil duct tape, and cable ties. One 15 cm and two 10 cm squares of corrugated plastic are used for each shield. After cutting, scoring, taping and stapling of the sheets, the 10 cm squares form the bottom two layers of the solar radiation shield, while the 15 cm square forms the top layer. The three sheets are held together with cable ties. This compact solar radiation shield can be suspended, or placed against any flat surface. Care must be taken to ensure that the shield is completely parallel to the ground to prevent direct solar radiation from reaching the sensor, possibly causing increased warm biases in sun-exposed sites in the morning and afternoon relative to the original, larger design. Even so, differences in recorded temperatures between the smaller, compact shield design and the original design were small (mean daytime bias = 0.06 &#176;C). Construction costs are less than half of the original shield design, and the new design results in a less conspicuous instrument that may be advantageous in many field ecology settings.

With the advent of small, low-cost environmental sensors, it is now possible to deploy high-density networks of sensors to measure hyper localized temperature variation. Here, we provide a detailed methodology for constructing a compact version of a previously described custom-fabricated radiation shield for use with inexpensive thermochrons.

생태 분야 연구에서 공기 온도 센서는 소형 저가 방사선 방패의 건설

Low cost temperature sensors are increasingly used by ecologists to assess climatic variation and change on ecologically relevant scales. Although ...

Construction of a Low-cost Mobile Incubator for Field and Laboratory Use

Incubators are essential for a range of culture-based microbial methods, such as membrane filtration followed by cultivation for assessing drinking water quality. However, commercially available incubators are often costly, difficult to transport, not flexible in terms of volume, and/or poorly adapted to local field conditions where access to electricity is unreliable. The purpose of this study was to develop an adaptable, low-cost and transportable incubator that can be constructed using readily available components. The electronic core of the incubator was first developed. These components were then tested under a range of ambient temperature conditions (3.5 &#176;C - 39 &#176;C) using three types of incubator shells (polystyrene foam box, hard cooler box, and cardboard box covered with a survival blanket). The electronic core showed comparable performance to a standard laboratory incubator in terms of the time required to reach the set temperature, inner temperature stability and spatial dispersion, power consumption, and microbial growth. The incubator set-ups were also effective at moderate and low ambient temperatures (between 3.5 &#176;C and 27 &#176;C), and at high temperatures (39 &#176;C) when the incubator set temperature was higher. This incubator prototype is low-cost (&lt; 300 USD) and adaptable to a variety of materials and volumes. Its demountable structure makes it easy to transport. It can be used in both established laboratories with grid power or in remote settings powered by solar energy or a car battery. It is particularly useful as an equipment option for field laboratories in areas with limited access to resources for water quality monitoring.

This paper describes a method for building an adaptable, low-cost and transportable incubator for microbial testing of drinking water. Our design is based on widely available materials and can operate under a range of field conditions, while still offering the advantages of higher-end laboratory-based models.

분야와 실험실 사용을 위한 저비용 모바일 인큐베이터의 건설

Incubators are essential for a range of culture-based microbial methods, such as membrane filtration followed by cultivation for assessing drinking water ...

BtM, a Low-cost Open-source Datalogger to Estimate the Water Content of Nonvascular Cryptogams

Communities of nonvascular cryptogams, such as mosses or lichens, are an important part of the Earth's biodiversity, contributing to the regulation of the carbon and nitrogen cycles in many ecosystems. Being poikilohydric organisms, they do not actively control their internal water content and need a humid environment to activate their metabolism. Therefore, studying water relationships of nonvascular cryptogams is crucial to understand both their diversity patterns and their functions in the ecosystems. We present the BtM datalogger, a low-cost open-source platform for the study of the water content of nonvascular cryptogams. The datalogger is designed to measure ambient temperature, humidity, and conductance from up to eight samples simultaneously. We provide a design for a printed circuit board (PCB), a detailed protocol to assemble the components, and the required source code. All this makes the assembly of the BtM datalogger accessible to any research group, even to those without previous specialized knowledge. Therefore, the design presented here has the potential to help popularize the use of this type of device among ecologists and field biologists.

We present a simple and cost-effective method to build an open-source datalogger that measures the conductance of nonvascular cryptogams together with the environmental temperature and humidity. We describe the hardware design of the datalogger and provide step-by-step assembly instructions, the list of required open-source logging software, the code to run the datalogger, and a calibration protocol.

BtM, 저가 오픈 소스 Datalogger Nonvascular 남겨둔의 함량을 추정 하

Communities of nonvascular cryptogams, such as mosses or lichens, are an important part of the Earth's biodiversity, contributing to the regulation of the ...

Composition and Distribution Analysis of Bioaerosols Under Different Environmental Conditions

Variable microorganisms in particulate matter (PM) under different environmental conditions may have significant impacts on human health. In this study, we described a protocol for multiple analyses of the biological compositions in environmental PM. Five experiments are presented: (1) PM number monitoring by using a laser particle counter; (2) PM collection by using a cyclonic aerosol sampler; (3) PM collection by using a high-volume air sampler with filters; (4) culturable microbes collection by the Andersen six-stage sampler; and (5) detection of biological composition of environmental PM by bacterial 16SrDNA and fungal ITS region sequencing. We selected hazy days and a livestock farm as two typical examples of the application in this protocol. In this study, these two sampling methods, cyclonic aerosol sampler and filter sampler, showed different sampling efficiency. The cyclonic aerosol sampler performed much better in terms of collecting bacteria, while these two methods showed the same efficiency in collecting fungi. Filter samplers can work under low temperature conditions while cyclonic aerosol samplers have a sampling limitation for temperature. A solid impacting sampler, such as an Andersen six-stage sampler, can be used to sample bioaerosols directly into the culture medium, which increases the survival rate of culturable microorganisms. However, this method mainly relies on culture while more than 99% of microbes cannot be cultured. DNA extracted from the culturable bacteria collected by the Andersen six-stage sampler and samples collected by cyclonic aerosol sampler and filter sampler were detected by bacterial 16S rDNA and fungal ITS region sequencing.All the methods above may have wide application in many fields of study, such as environmental monitoring and airborne pathogen detection. From these results, we can conclude that these methods can be used under different conditions and may help other researchers further explore the health impacts of environmental bioaerosols.

Understanding the biological composition of environmental particulate matter is important for the study of its significant impacts on human health and disease spread. Here, we used three types of bioaerosol sampling methods and a biological analysis of airborne microbes to better explore airborne microbial communities under different environmental conditions.

구성 및 다른 환경 조건에서 Bioaerosols의 유통 분석

Variable microorganisms in particulate matter (PM) under different environmental conditions may have significant impacts on human health. In this study, ...