We thank T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre, and D. Coleman for the kind gift of some reference strains used in this study. This work was in part supported financially by the Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

These procedures should be conducted in a certified biosafety level 2 laboratory. Appropriate personal protective equipment such as gloves and lab coats should be used at all times.
1. Sample Preparation
<ol>
	<li>Fresh overnight plate cultures of MRSA are required. On the day before PCR is to be done, select a single colony of MRSA with a sterile culture stick and prepare a heavy streak of the bacteria on a Tryptic Soy Agar (TSA) plate. Multiple samples can be streaked onto a single plate. Incubate overnight at 37 &#176;C.</li>
	<li>Add 75 &#956;l of sterile distilled water to a 1.5 ml microcentrifuge tube. Using a sterile culture stick pick up a small amount of bacteria from the heavy overnight streak. Swirl the bacteria in the sterile water to prepare a turbid solution (Figure 2). Repeat for all samples.</li>
	<li>Incubate the tubes in a dry heat block set at 95 &#176;C for 10 min to lyse the bacteria and release the DNA.</li>
</ol>
Note: If the bacterial solution is too weak or too concentrated PCR efficiency is reduced. Likewise, if the temperature is above 95 &#176;C or the incubation is longer than 10 min the PCR efficiency is reduced.
<ol start="4">
	<li>Remove the samples from the heat block and let stand at room temperature for 5 min.</li>
	<li>Centrifuge the samples at 13,000 rpm for 1 min, creating a cellular debris pellet and clear supernatant containing the DNA. Samples can be stored at -20 &#176;C for future use.</li>
</ol>
Note: If using a previously prepared and frozen sample, remove the microcentrifuge tube from the freezer and let stand at room temperature to fully thaw. If the pellet has been disturbed re-centrifuge the sample.
Note: gDNA prepared by any other method, including chelex extraction10, or column extraction (QIAmp DNA Mini Kit, Qiagen) is also acceptable.
2. PCR Preparation
Note: Control samples should be included in each PCR run and contain a minimum of types I, II, IIA, III, IVa, IVb, IVc, IVd, IVE and V. Ten extra samples should, therefore, be added to the count when preparing the master mix. DNA for the controls can be prepared ahead of time and stored for extended periods of time in the freezer.
<ol>
	<li>Remove PCR reagents, including 10x PCR buffer (without MgCl2), 50 mM MgCl2, dNTPs and primers, from the -20 &#176;C freezer and allow to thaw on the clean PCR bench (no bacteria or DNA permitted) at room temperature. 0.2 ml PCR tubes can be prepared and labeled at this time. 
	If new stocks of primers or dNTPs are required they can be prepared as follows:
	<ol>
		<li>Prepare primers by diluting concentrated stocks to 10 &#956;M working solutions with sterile distilled water. The primer stocks and working solutions can be kept frozen at -20 &#176;C for use at future dates.</li>
		<li>Prepare dNTPs by diluting commercial stocks to a working solution containing 2 &#956;M of each dNTP. In order to minimize the number of freeze/thaw cycles that the dNTPs are subjected to, stocks of 10 &#956;M of each dNTP can be prepared ahead of time, 50 &#956;l aliquots placed in 0.5 ml microcentrifuge tubes and stored at -20 &#176;C. As needed, a tube of the 10 &#956;M is removed and diluted to 2 &#956;M of each dNTP by adding 200 &#956;l of sterile distilled water.</li>
	</ol>
	</li>
	<li>Once thawed, vortex briefly to mix all reagents, then combine as per Table 1. It is important to use platinum taq DNA polymerase (as opposed to regular taq) because this has been found to influence the success of the reaction. Generally a master mix is prepared, vortexed briefly to mix and aliquoted into the individual PCR tubes.</li>
	<li>Close all PCR tubes and move to the general work bench. Add the template to the PCR tubes by pipetting 2 &#956;l of the clear supernatant from the previously prepared bacterial samples.</li>
	<li>Move to the dedicated amplification location and place the tubes into the thermal cycler under the following protocol: 94 &#176;C for 5 min, followed by 10 cycles of 94 &#176;C 45 sec, 65 &#176;C 45 sec, 72 &#176;C 1.5 min. A further 25 cycles of 94 &#176;C 45 sec, 52 &#176;C 45 sec, 72 &#176;C 2 min were followed by a 10 min incubation at 72 &#176;C and a hold at 4 &#176;C.</li>
</ol>
3. Agarose Gel Electrophoresis
(see Lee, P.Y. et al., J. Vis. Exp. (62), e3923, doi:10.3791/3923 (2012) for more details) 11.
A dedicated gel electrophoresis location is preferred. PCR products are run on a 2.5% agarose gel in 0.5x TBE buffer (110 mM Tris; 90 mM Borate; 2.5 mM EDTA; pH 8.3).
<ol>
	<li>Weigh 2.5 g of agarose and add to 100 ml of 0.5x TBE buffer in a glass Erlenmeyer flask. Cover the flask with plastic wrap and boil the solution in a microwave until fully dissolved. A 2.5% gel will boil over quickly, therefore stop the microwave and swirl the solution regularly.</li>
	<li>Cool the agarose until comfortable to touch by swirling under cold water, or by resting on the bench for 5 min. Pour the agarose into the casting tray.</li>
	<li>Remove tubes from the PCR thermal cycler and prepare the samples by add 2 &#956;l of 6x DNA loading dye (40% glycerol/0.25% bromophenol blue) to each sample. Load 5-10 &#956;l of sample per well on the gel. A 1 Kb+ or 100 bp DNA ladder is appropriate for the expected band sizes.</li>
	<li>Ethidium bromide (EtBr) can be added to the gel prior to pouring it, or alternatively the gel can be stained in an EtBr bath prior to being visualized. Place the finished gel in a solution of 0.5 &#956;g/ml EtBr in distilled water and mix gently on shaker for 10 min. Transfer the gel to a clean container and destain in distilled water for a further 10 min.</li>
</ol>

<ol><li>IWG-SCC. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Classification+of+staphylococcal+cassette+chromosome+mec+%28SCCmec%29%3A+guidelines+for+reporting+novel+SCCmec+elements%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.</a> Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).</li>
<li>Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Guidelines+for+Reporting+Novel+mecA+Gene+Homologues%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Guidelines for Reporting Novel mecA Gene Homologues.</a> Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).</li>
<li>Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissemination+of+new+methicillin-resistant+Staphylococcus+aureus+clones+in+the+community%5BTitle%5D)+AND+%22Journal+of+Clinical+Microbiology%22%5BJournal%5D)">Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community.</a> Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).</li>
<li>Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Combination+of+multiplex+PCRs+for+staphylococcal+cassette+chromosome+mec+type+assignment%3A+rapid+identification+system+for+mec%2C+ccr%2C+and+major+differences+in+junkyard+regions%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.</a> Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).</li>
<li>Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+PCR+strategy+for+rapid+identification+of+structural+types+and+variants+of+the+mec+element+in+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).</li>
<li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Update+to+the+multiplex+PCR+strategy+for+assignment+of+mec+element+types+in+Staphylococcus+aureus%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).</li>
<li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+PCR+strategy+for+subtyping+the+staphylococcal+cassette+chromosome+mec+type+IV+in+methicillin-resistant+Staphylococcus+aureus%3A+%27SCCmec+IV+multiplex%27%5BTitle%5D)+AND+%22Journal+of+Antimicrobial+Chemotherapy%22%5BJournal%5D)">Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'.</a> Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).</li>
<li>Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+multiplex+PCR+assay+for+characterization+and+concomitant+subtyping+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Journal+of+Clinical+Microbiology%22%5BJournal%5D)">Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).</li>
<li>Zhang, K., McClure, J. A., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enhanced+multiplex+PCR+assay+for+typing+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Molecular+and+Cellular+Probes%22%5BJournal%5D)">Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Molecular and Cellular Probes. 26 (5), 218-221 (2012).</li>
<li>de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+one-step+microbial+DNA+extraction+method+using+%22Chelex+100%22+suitable+for+gene+amplification%5BTitle%5D)+AND+%22Research+in+Microbiology%22%5BJournal%5D)">A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification.</a> Research in Microbiology. 143 (8), 785-790 (1992).</li>
<li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments%5BTitle%5D)+AND+%22J.+Vis.+Exp%22%5BJournal%5D)">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923(2012).</li>
<li>McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiplex+PCR+assay+to+facilitate+identification+of+the+recently+described+Staphylococcal+cassette+chromosome+mec+type+VIII%5BTitle%5D)+AND+%22Molecular+and+Cellular+Probes%22%5BJournal%5D)">Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII.</a> Molecular and Cellular Probes. 24 (4), 229-232 (2010).</li>
<li>Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Novel+staphylococcal+cassette+chromosome+mec+type%2C+tentatively+designated+type+VIII%2C+harboring+class+A+mec+and+type+4+ccr+gene+complexes+in+a+Canadian+epidemic+strain+of+methicillin-resistant+Staphylococcus+aureus%5BTitle%5D)+AND+%22Antimicrobial+Agents+and+Chemotherapy%22%5BJournal%5D)">Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).</li>
</ol>

No conflicts of interest declared.

The multiplex PCR assay described here provides a simple, reliable method for classifying types and major subtypes of SCCmec I-V in Staphylococci, with simultaneous discrimination of MRSA from MSSA. The assay is robust, conveniently done in a single PCR reaction and results are easy to interpret. The assay does have limitations in that it targets individual loci within each SCCmec type, but does not offer comprehensive ccr and mec complex typing, and therefore cannot be considered a go...

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Methicillin-resistant Staphylococcus aureus (MRSA) has acquired and integrated into its genome a 21-67-kb mobile genetic element, termed the staphylococcal cassette chromosome mec (SCCmec) that harbors the methicillin resistance (mecA) gene and other antibiotic resistance determinants 1. SCCmec is characterized by the presence of terminal direct and inverted repeats, two essential genetic components (the mec gene complex and the ccr gene complex), and the J-regions (Figure 1). The mec gene complex is composed of IS431mec, mecA, and intact or truncated sets of regulatory genes, mecR1 and mecI, while the ccr gene complex encodes the recombinases (ccr/ccrAB) that mediate integration of SCCmec into and its excision from the recipient chromosome 1. Recently two novel mec resistance genes (mecB and mecC) were described, which show significant sequence divergence from the mecA gene 2. The rest of the SCCmec element is comprised of J regions (J1, J2, and J3) that are located between and around the mec and ccr complexes and contain various genes or pseudogenes. There are several classes of mec complex (such as A, B, C, D and E) and allotypes of ccr complex (such as 1-8) described. Different combinations of these complex classes and allotypes generate various SCCmec types. According to the guidelines of SCCmec nomenclature and classification by the International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (IWG-SCC), SCCmec elements are classified into types based on the nature of the mec and ccr gene complexes, and are further classified into subtypes according to differences in their J region DNA 1. MRSA clones are commonly defined by incorporation of SCCmec typing information in conjunction with that provided by (gene/genomic) sequence-based typing methods, such as multilocus sequence typing (ST) and/or staphylococcal protein A gene (spa) typing (e.g. ST8-t008-MRSA-IVa). Therefore, SCCmec typing is a very important molecular tool for understanding the epidemiology and clonal strain relatedness of MRSA, particularly with the emerging outbreaks of community-associated MRSA (CA-MRSA) occurring on a worldwide basis.
Traditional PCR typing schemes classify SCCmec by targeting and identifying the individual mec and ccr gene complex types, but require the use of many (20 to 30) primer sets and multiple individual PCR experiments. Okuma et al., for example, employed 21 primers and many single target PCR reactions in detecting SCCmec I-IVb 3. Kondo et al. subsequently developed a more complete assay for identification of ccr, mec, and major differences in the J-regions, but it also required a large number of primers and multiple PCR reactions 4. To simplify SCCmec typing, multiplex PCR (M-PCR) assays were developed allowing samples to be processed in a single PCR reaction. De Lencastre and colleagues developed an M-PCR for quick screening of SCCmec I-IV, and later updated for SCCmec I-V, with a separate M-PCR for identifying SCCmec IV subtypes 5,6,7. However, these assays are more difficult to interpret, require 2 reactions in order to classify SCCmec IV subtypes, and result in several non-typeable subtypes. In an attempt to improve SCCmec typing, we designed and published a simple multiplex PCR assay for quick-screening of major SCCmec types and subtypes I to V 8, and later updated it as new sequence information became available 9. This simple assay targets individual SCCmec types in a single reaction, is easy to interpret and has been extensively used worldwide (337 from SCOPUS; updated Jan. 30, 2013). Since the original publication, we have received many requests for assistance from groups setting up this assay as part of their in-house MRSA SCCmec typing. Due to the sophisticated nature of the assay and the large number of primers present in the reaction, there is the potential for difficulties while adapting this assay to individual laboratories. To facilitate the process of establishing a MRSA SCCmec assay, we are going to demonstrate how to set up our M-PCR for SCCmec typing, as well as discuss some of the vital steps and procedural nuances that make it successful.

<table><tbody><tr><td>Tryptic Soy Agar</td><td>Fisher (BD)</td><td>CA90002-700 (236920)</td><td></td></tr><tr><td>Sterile distilled water</td><td>Life Technologies</td><td>10977-015</td><td></td></tr><tr><td>Platinum Taq: including 10x PCR buffer and 50 mM MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Life Technologies</td><td>10966-034</td><td></td></tr><tr><td>100 mM dNTP</td><td>Life Technologies</td><td>10297-018</td><td></td></tr><tr><td>Tris base</td><td>Sigma-Aldrich</td><td>T6066</td><td></td></tr><tr><td>Boric acid</td><td>Sigma-Aldrich</td><td>B7901</td><td></td></tr><tr><td>EDTA</td><td>Life Technologies</td><td>15576-028</td><td></td></tr><tr><td>Agarose</td><td>Life Technologies</td><td>16500-500</td><td></td></tr><tr><td>Glycerol</td><td>Life Technologies</td><td>15514-011</td><td></td></tr><tr><td>Bromophenol blue</td><td>Sigma-Aldrich</td><td>B8026</td><td></td></tr><tr><td>1Kb+ DNA ladder</td><td>Life Technologies</td><td>10787-026</td><td></td></tr><tr><td>Ethidium bromide</td><td>Sigma-Aldrich</td><td>E7637</td><td></td></tr><tr><td>1.5ml Microcentrifuge tubes </td><td>VWR (Axygen Scientific)</td><td>10011-700</td><td></td></tr><tr><td>Culture sticks</td><td>VWR</td><td>CA10805-018</td><td></td></tr><tr><td>PCR tubes</td><td>Diamed</td><td>AD0210-FCN (new #: DIATEC420-1250)</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5417c</td><td></td></tr><tr><td>Heat block</td><td>VWR</td><td>13259-030 / 13259-286</td><td></td></tr><tr><td>Thermalcycler</td><td>Applied Biosystems (2720)</td><td>4359659</td><td></td></tr><tr><td>Horizontal, submersible gel electrophoresis chamber with gel mold</td><td>BioRad</td><td>170-4469</td><td></td></tr><tr><td>Power supply</td><td>BioRad</td><td>164-5050</td><td></td></tr><tr><td>Rocker shaker</td><td>VWR</td><td>40000-300</td><td></td></tr><tr><td>Molecular Imager Gel Doc System</td><td>BioRad</td><td>1708170</td><td></td></tr></tbody></table>

multiplex pcr assay for typing of staphylococcal cassette chromosome mec types i to v in methicillin-resistant staphylococcus aureus

Staphylococcal Cassette Chromosome mec (SCCmec) typing is a very important molecular tool for understanding the epidemiology and clonal strain relatedness of methicillin-resistant Staphylococcus aureus (MRSA), particularly with the emerging outbreaks of community-associated MRSA (CA-MRSA) occurring on a worldwide basis. Traditional PCR typing schemes classify SCCmec by targeting and identifying the individual mec and ccr gene complex types, but require the use of many primer sets and multiple individual PCR experiments. We designed and published a simple multiplex PCR assay for quick-screening of major SCCmec types and subtypes I to V, and later updated it as new sequence information became available. This simple assay targets individual SCCmec types in a single reaction, is easy to interpret and has been extensively used worldwide. However, due to the sophisticated nature of the assay and the large number of primers present in the reaction, there is the potential for difficulties while adapting this assay to individual laboratories. To facilitate the process of establishing a MRSA SCCmec assay, here we demonstrate how to set up our multiplex PCR assay, and discuss some of the vital steps and procedural nuances that make it successful.

This updated M-PCR is able to determine (classify) SCCmec types I-V, as well major subtypes of SCCmec IV. The assay targets unique and specific loci of SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE and V, with concomitant mecA gene detection. Tentative identification of SCCmec VI and VIII is also possible, but would require further testing to confirm. Figure 3 illustrates representative SCCmec I-VI and VIII and the locations of each target within the ele...

Watch this Scientific Journal Video about Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus at JoVE.com

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec

Research

JoVE Journal

Immunology and Infection

11.8K Views.  Alberta Health Services / Calgary Laboratory Services / University of Calgary. We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Video: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Screening Foodstuffs for Class 1 Integrons and Gene Cassettes

Antibiotic resistance is one of the greatest threats to health in the 21st century. Acquisition of resistance genes via lateral gene transfer is a major factor in the spread of diverse resistance mechanisms. Amongst the DNA elements facilitating lateral transfer, the class 1 integrons have largely been responsible for spreading antibiotic resistance determinants amongst Gram negative pathogens. In total, these integrons have acquired and disseminated over 130 different antibiotic resistance genes. With continued antibiotic use, class 1 integrons have become ubiquitous in commensals and pathogens of humans and their domesticated animals. As a consequence, they can now be found in all human waste streams, where they continue to acquire new genes, and have the potential to cycle back into humans via the food chain. This protocol details a streamlined approach for detecting class 1 integrons and their associated resistance gene cassettes in foodstuffs, using culturing and PCR. Using this protocol, researchers should be able to: collect and prepare samples to make enriched cultures and screen for class 1 integrons; isolate single bacterial colonies to identify integron-positive isolates; identify bacterial species that contain class 1 integrons; and characterize these integrons and their associated gene cassettes.

This protocol describes the detection of class 1 integrons and their associated gene cassettes in foodstuffs.

Antibiotic resistance is one of the greatest threats to health in the 21st century. Acquisition of resistance genes via lateral gene transfer is a major ...

Environment

One-day Workflow Scheme for Bacterial Pathogen Detection and Antimicrobial Resistance Testing from Blood Cultures

Bloodstream infections are associated with high mortality rates because of the probable manifestation of sepsis, severe sepsis and septic shock1. Therefore, rapid administration of adequate antibiotic therapy is of foremost importance in the treatment of bloodstream infections. The critical element in this process is timing, heavily dependent on the results of bacterial identification and antibiotic susceptibility testing. Both of these parameters are routinely obtained by culture-based testing, which is time-consuming and takes on average 24-48 hours2, 4. The aim of the study was to develop DNA-based assays for rapid identification of bloodstream infections, as well as rapid antimicrobial susceptibility testing. The first assay is a eubacterial 16S rDNA-based real-time PCR assay complemented with species- or genus-specific probes5. Using these probes, Gram-negative bacteria including Pseudomonas spp., Pseudomonas aeruginosa and Escherichia coli as well as Gram-positive bacteria including Staphylococcus spp., Staphylococcus aureus, Enterococcus spp., Streptococcus spp., and Streptococcus pneumoniae could be distinguished. Using this multiprobe assay, a first identification of the causative micro-organism was given after 2 h.
Secondly, we developed a semi-molecular assay for antibiotic susceptibility testing of S. aureus, Enterococcus spp. and (facultative) aerobe Gram-negative rods6. This assay was based on a study in which PCR was used to measure the growth of bacteria7. Bacteria harvested directly from blood cultures are incubated for 6 h with a selection of antibiotics, and following a Sybr Green-based real-time PCR assay determines inhibition of growth. The combination of these two methods could direct the choice of a suitable antibiotic therapy on the same day (Figure 1). In conclusion, molecular analysis of both identification and antibiotic susceptibility offers a faster alternative for pathogen detection and could improve the diagnosis of bloodstream infections.

The design of a straightforward one-day workflow scheme for bacterial pathogen diagnostics enables the rapid recognition of bloodstream infections. The inclusion of eight clinically relevant bacterial targets and their antibiotic resistance profiles offers the clinician an initial insight on the same day, which can lead to more adequate therapy.

Bloodstream infections are associated with high mortality rates because of the probable manifestation of sepsis, severe sepsis and septic shock1. ...

Multiplex Detection of Bacteria in Complex Clinical and Environmental Samples using Oligonucleotide-coupled Fluorescent Microspheres

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated to a microbiota dominated by a number of bacterial species, including Gardnerella vaginalis, Atopobium vaginae, and others1-3. This condition is associated with a range of negative health outcomes, including HIV acquisition4, and it can be difficult to manage clinically5. Furthermore, diagnosis of BV has relied on the use of Gram stains of vaginal swab smears that are scored on various numerical criteria6,7. While this diagnostic is simple, inexpensive, and well suited to resource-limited settings, it can suffer from problems related to subjective interpretations and it does not give a detailed profile of the composition of the vaginal microbiota8. Recent deep sequencing efforts have revealed a rich, diverse vaginal microbiota with clear differences between samples taken from individuals that are diagnosed with BV compared to those individuals that are considered normal9,10, which has resulted in the identification of a number of potential targets for molecular diagnosis of BV11,12. These studies have provided a wealth of useful information, but deep sequencing is not yet practical as a diagnostic method in a clinical setting. We have recently described a method for rapidly profiling the vaginal microbiota in a multiplex format using oligonucleotide-coupled fluorescent beads with detection on a Luminex platform13. This method, like current Gram stain-based methods, is rapid and simple but adds the additional advantage of exploiting molecular knowledge arising from sequencing studies in probe design. This method therefore provides a way to profile the major microorganisms that are present in a vaginal swab that can be used to diagnose BV with high specificity and sensitivity compared to Gram stain while providing additional information on species presence and abundance in a semi-quantitative and rapid manner. This multiplex method is expandable well beyond the range of current quantitative PCR assays for particular organisms, which is currently limited to 5 or 6 different assays in a single sample14. Importantly, the method is not limited to the detection of bacteria in vaginal swabs and can be easily adapted to rapidly profile nearly any microbial community of interest. For example, we have recently begun to apply this methodology to the development of diagnostic tools for use in wastewater treatment plants.

We describe a multiplex method for the detection of microorganisms within a sample using oligonucleotide-coupled fluorescent beads. Amplicon from all organisms within a sample is hybridized to a panel of probe-coupled beads. A Luminex or Bio-Plex instrument is used to query each bead for bead type and hybridization signal.

Bacterial vaginosis (BV) is a recurring polymicrobial syndrome that is characterized by a change in the "normal" microbiota from Lactobacillus-dominated ...

Biosensor for Detection of Antibiotic Resistant Staphylococcus Bacteria

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) antibody conjugated latex beads have been utilized to create a biosensor designed for discrimination of methicillin resistant (MRSA) and sensitive (MSSA) S. aureus species 1,2. The lytic phages have been converted into phage spheroids by contact with water-chloroform interface. Phage spheroid monolayers have been moved onto a biosensor surface by Langmuir-Blodgett (LB) technique 3. The created biosensors have been examined by a quartz crystal microbalance with dissipation tracking (QCM-D) to evaluate bacteria-phage interactions. Bacteria-spheroid interactions led to reduced resonance frequency and a rise in dissipation energy for both MRSA and MSSA strains. After the bacterial binding, these sensors have been further exposed to the penicillin-binding protein antibody latex beads. Sensors analyzed with MRSA responded to PBP 2a antibody beads; although sensors inspected with MSSA gave no response. This experimental distinction determines an unambiguous discrimination between methicillin resistant and sensitive S. aureus strains. Equally bound and unbound bacteriophages suppress bacterial growth on surfaces and in water suspensions. Once lytic phages are changed into spheroids, they retain their strong lytic activity and show high bacterial capture capability. The phage and phage spheroids can be utilized for testing and sterilization of antibiotic resistant microorganisms. Other applications may include use in bacteriophage therapy and antimicrobial surfaces.

Lytic phage biosensors and antibody beads are able to discriminate between methicillin resistant (MRSA) and sensitive staphylococcus bacteria. The phages were immobilized by a Langmuir-Blodgett method onto a surface of a quartz crystal microbalance sensor and worked as broad range staphylococcus probes. Antibody beads recognize MRSA.

A structurally transformed lytic bacteriophage having a broad host range of Staphylococcus aureus strains and a penicillin-binding protein (PBP 2a) ...

Bioengineering

Demonstrating a Multi-drug Resistant Mycobacterium tuberculosis Amplification Microarray

Simplifying microarray workflow is a necessary first step for creating MDR-TB microarray-based diagnostics that can be routinely used in lower-resource environments. An amplification microarray combines asymmetric PCR amplification, target size selection, target labeling, and microarray hybridization within a single solution and into a single microfluidic chamber. A batch processing method is demonstrated with a 9-plex asymmetric master mix and low-density gel element microarray for genotyping multi-drug resistant Mycobacterium tuberculosis (MDR-TB). The protocol described here can be completed in 6 hr and provide correct genotyping with at least 1,000 cell equivalents of genomic DNA. Incorporating on-chip wash steps is feasible, which will result in an entirely closed amplicon method and system. The extent of multiplexing with an amplification microarray is ultimately constrained by the number of primer pairs that can be combined into a single master mix and still achieve desired sensitivity and specificity performance metrics, rather than the number of probes that are immobilized on the array. Likewise, the total analysis time can be shortened or lengthened depending on the specific intended use, research question, and desired limits of detection. Nevertheless, the general approach significantly streamlines microarray workflow for the end user by reducing the number of manually intensive and time-consuming processing steps, and provides a simplified biochemical and microfluidic path for translating microarray-based diagnostics into routine clinical practice.

Demonstrating a Multi-drug Resistant Mycobacterium tuberculosis Amplification Microarray

An amplification microarray combines asymmetric PCR amplification and microarray hybridization into a single chamber, which significantly streamlines microarray workflow for the end user. Simplifying microarray workflow is a necessary first step for creating microarray-based diagnostics that can be routinely used in lower-resource environments.

Simplifying microarray workflow is a necessary first step for creating MDR-TB microarray-based diagnostics that can be routinely used in lower-resource ...

Identification of Rare Bacterial Pathogens by 16S rRNA Gene Sequencing and MALDI-TOF MS

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in immunocompromised patients. In most cases only few data, mostly published as case reports, are available which investigate the role of such pathogens as an infectious agent. Therefore, in order to clarify the pathogenic character of such microorganisms, it is necessary to conduct epidemiologic studies which include large numbers of these bacteria. The methods used in such a surveillance study have to meet the following criteria: the identification of the strains has to be accurate according to the valid nomenclature, they should be easy to handle (robustness), economical in routine diagnostics and they have to generate comparable results among different laboratories. Generally, there are three strategies for identifying bacterial strains in a routine setting: 1) phenotypic identification characterizing the biochemical and metabolic properties of the bacteria, 2) molecular techniques such as 16S rRNA gene sequencing and 3) mass spectrometry as a novel proteome based approach. Since mass spectrometry and molecular approaches are the most promising tools for identifying a large variety of bacterial species, these two methods are described. Advances, limitations and potential problems when using these techniques are discussed.

Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) and molecular techniques (16S rRNA gene sequencing) permit the identification of rare bacterial pathogens in routine diagnostics. The goal of this protocol lies in the combination of both techniques which leads to more accurate and reliable data.

There are a number of rare and, therefore, insufficiently described bacterial pathogens which are reported to cause severe infections especially in ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to antibiotics. Genomic studies reveal that S. aureus carries many virulence and resistance genes located in mobile genetic elements, suggesting that horizontal gene transfer (HGT) plays a critical role in S. aureus evolution. However, a full and detailed description of the methodology used to study HGT in S. aureus is still lacking, especially regarding natural transformation, which has been recently reported in this bacterium. This work describes three protocols that are useful for the in vitro investigation of HGT in S. aureus: conjugation, phage transduction, and natural transformation. To this aim, the cfr gene (chloramphenicol/florfenicol resistance), which confers the Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A (PhLOPSA)-resistance phenotype, was used. Understanding the mechanisms through which S. aureus transfers genetic materials to other strains is essential to comprehending the rapid acquisition of resistance and helps to clarify the modes of dissemination reported in surveillance programs or to further predict the spreading mode in the future.

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

We describe here three different protocols for the in vitro investigation of conjugation, transduction, and natural transformation in Staphylococcus aureus.

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to ...

Multiplex PCR and Reverse Line Blot Hybridization Assay (mPCR/RLB)

Multiplex PCR/Reverse Line Blot Hybridization assay allows the detection of up to 43 molecular targets in 43 samples using one multiplex PCR reaction followed by probe hybridization on a nylon membrane, which is re-usable. Probes are 5' amine modified to allow fixation to the membrane. Primers are 5' biotin modified which allows detection of hybridized PCR products using streptavidin-peroxidase and a chemiluminescent substrate via photosensitive film. With low setup and consumable costs, this technique is inexpensive (approximately US$2 per sample), high throughput (multiple membranes can be processed simultaneously) and has a short turnaround time (approximately 10 hours). 
The technique can be utilized in a number of ways. Multiple probes can be designed to detect sequence variation within a single amplified product, or multiple products can be amplified
simultaneously, with one (or more) probes used for subsequent detection. A combination of both approaches can also be used within a single assay. The ability to include multiple probes for a single target sequence makes the assay highly specific.
Published applications of mPCR/RLB include detection of antibiotic resistance genes1,2, typing of methicillin-resistant Staphylococcus aureus3-5 and Salmonella sp6, molecular serotyping of Streptococcus pneumoniae7,8, Streptococcus agalactiae9 and enteroviruses10,11, identification of Mycobacterium sp12, detection of genital13-15 and respiratory tract16 and other17 pathogens and detection and identification of mollicutes18. However, the versatility of the technique means the applications are virtually limitless and not restricted to molecular analysis of micro-organisms.
The five steps in mPCR/RLB are a) Primer and Probe design, b) DNA extraction and PCR amplification c) Preparation of the membrane, d) Hybridization and detection, and e) Regeneration of the Membrane.

Multiplex PCR and Reverse Line Blot Hybridization Assay mPCR/RLB

An inexpensive, high throughput method for simultaneous detection of up to 43 molecular targets is described. Applications of mPCR/RLB include microbial typing and detection of multiple pathogens from clinical samples.

Multiplex PCR/Reverse Line Blot Hybridization assay allows the detection of up to 43 molecular targets in 43 samples using one multiplex PCR reaction ...

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Samenvatting

Meer video's verkennen