We thank T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre, and D. Coleman for the kind gift of some reference strains used in this study. This work was in part supported financially by the Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

??? ??? ?? ??? ??? ??? ????? ???????. ??? ??? ? ??? ?? ?? ??? ?? ???????. 1. ?? ?? <ol><li> MRSA? ??? ??? ???? ??? ?????. PCR? ?????? ???, ?? ?? ???? MRSA? ?? ???? ???? ??? ?? ?? (TSA) ??? ????? ??? ??? ?????. ??? ??? ??? ??? ?? ? ? ????. 37 ?? ??

<ol>
	<li>IWG-SCC. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+staphylococcal+cassette+chromosome+mec+(SCCmec):+guidelines+for+reporting+novel+SCCmec+elements.">Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.</a> Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).</li><li>Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+Reporting+Novel+mecA+Gene+Homologues.">Guidelines for Reporting Novel mecA Gene Homologues.</a> Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).</li><li>Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissemination+of+new+methicillin-resistant+Staphylococcus+aureus+clones+in+the+community.">Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community.</a> Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).</li><li>Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combination+of+multiplex+PCRs+for+staphylococcal+cassette+chromosome+mec+type+assignment:+rapid+identification+system+for+mec,+ccr,+and+major+differences+in+junkyard+regions.">Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.</a> Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).</li><li>Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+rapid+identification+of+structural+types+and+variants+of+the+mec+element+in+methicillin-resistant+Staphylococcus+aureus.">Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+to+the+multiplex+PCR+strategy+for+assignment+of+mec+element+types+in+Staphylococcus+aureus.">Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+subtyping+the+staphylococcal+cassette+chromosome+mec+type+IV+in+methicillin-resistant+Staphylococcus+aureus:+'SCCmec+IV+multiplex'.">Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'.</a> Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+multiplex+PCR+assay+for+characterization+and+concomitant+subtyping+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).</li><li>Zhang, K., McClure, J. A., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+multiplex+PCR+assay+for+typing+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Molecular and Cellular Probes. 26 (5), 218-221 (2012).</li><li>de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one-step+microbial+DNA+extraction+method+using+"Chelex+100"+suitable+for+gene+amplification.">A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification.</a> Research in Microbiology. 143 (8), 785-790 (1992).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923 (2012).</li><li>McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+assay+to+facilitate+identification+of+the+recently+described+Staphylococcal+cassette+chromosome+mec+type+VIII.">Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII.</a> Molecular and Cellular Probes. 24 (4), 229-232 (2010).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+staphylococcal+cassette+chromosome+mec+type,+tentatively+designated+type+VIII,+harboring+class+A+mec+and+type+4+ccr+gene+complexes+in+a+Canadian+epidemic+strain+of+methicillin-resistant+Staphylococcus+aureus.">Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).</li></ol>

No conflicts of interest declared.

The multiplex PCR assay described here provides a simple, reliable method for classifying types and major subtypes of SCCmec I-V in Staphylococci, with simultaneous discrimination of MRSA from MSSA. The assay is robust, conveniently done in a single PCR reaction and results are easy to interpret. The assay does have limitations in that it targets individual loci within each SCCmec type, but does not offer comprehensive ccr and mec complex typing, and therefore cannot be considered a gold standard. Regardless, extensive validation of the protocol has proven that it remains a valuable molecular tool for scientific and epidemiological studies on MRSA.
Due to the sophisticated nature of the assay and the large number of primers present in the reaction, there is the potential for difficulties while adapting this assay to individual laboratories. Each laboratory has their own unique conditions and factors such as primer concentration or purity, as well as thermal cycler and PCR component variations which can affect the outcome of the assay. For that reason, it is important to establish and optimize this assay in their laboratory. There are, however, several steps that will assist in successful implementation.
Sample and template preparation is a major step in any PCR reaction and, as such, the first factor affecting the success of this PCR assay is the quality of the DNA template. While any purification method that produces pure DNA would be acceptable for this assay we opted for a simple, rapid boiling method to expedite sample handling. Experience led us to realize that there are critical steps in the heating method that affect the quality of the DNA. For example, the optimal sample volume was determined to be 75-100 &#956;l, and volumes over that were less successful. As well, the heat block for bacterial cell lysis should be set to exactly 95 &#176;C and the sample heated for exactly 10 min, as overheating was found to degrade the DNA. Allowing the heated tubes to cool on the bench prior to centrifugation was another step that was found to increase the efficiency of the M-PCR. While poorer quality DNA may still be sufficient as a template in this assay, taken together these steps dramatically increase the quality of the DNA and make the PCR reaction more efficient.
A second factor which was found to play a significant role in the success of the PCR was the nature of the Taq DNA polymerase. This may not be universal and only 2 types of Taq polymerase were tried in our lab, however, our experience was that only the Platinum Taq from Invitrogen (Carlsbad, CA, USA) worked well, while the Recombinant Taq (Invitrogen, Carlsbad, CA, USA) resulted in unreliable results with missing products. Laboratories should also pay close attention to the quantity and purity of their primers. Primer concentration is determined based on the nature of the equipment in the individual labs and the volumes (hence concentrations) listed in this method are based on our laboratory conditions. These concentrations may need to be varied slightly in order to optimally detect each PCR product, although the relative ratios between primers should remain relatively unchanged. Another caution is related to the amplification step; it is important to ensure that the PCR tubes being used are the correct ones for the thermal cycler. If the tubes do not fit tightly into the machine and optimal heating/cooling does not occur then the PCR will be unsuccessful and several targets may or may not be amplified.
Running the PCR products on the agarose gel is a final step that, while not significantly influencing the success of the reaction, does contain steps which can improve the interpretation of results. In particular, a 2.5% agarose gel was determined to result in superior separation of the PCR products over a 2% gel. Since the assay contains a large number of smaller products with small size differences, a 2.5% gel was particularly helpful in this regard. With respect to staining, gels can be run with ethidium bromide incorporated into them, or stained post running with whichever stain is used in a particular lab. One important note here is that gel red should not be incorporated into the gel prior to running the samples because it affects the mobility of the DNA and renders band interpretation difficult to meaningless.
Despite the apparent complexity of this multiplex PCR assay, it is actually quite simple to set up and offers reliable SCCmec typing results for most samples. Of course, as more SCCmec elements are discovered and described this assay will be limited in its ability to detect them and will require updating. Since initial publication of the assay, several new SCCmec types (VII, IX, X and XI) have been described. Type XI is also unique in that it contains a new mec resistance gene (mecC) 3. Due to the nature of this assay and the specific targets that it employs, these new SCCmec types remain untypeable with the assay. Future modifications to the assay would require the addition of targets specific to these SCCmec types in order to facilitate their detection. However the assay is limited in the number of targets that are realistically possible due to number of primers required and the need to discriminate PCR product sizes. Ultimately a comprehensive assay which targets the ccr and mec complex types would offer a more complete SCCmec typing scheme. However the goal of this assay was to provide a rapid method of detecting SCCmec types and subtypes I-V, which are the most common and major SCCmec types, with presumptive identification of types VI and VIII.

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

?? ?? ?? ?? ??? ?? (MRSA)? ?? 21-67 - KB ??? ?? ? ??? ?? ????, ?? ?? ?? (MECA) ??? ? ?? ??? ?? ?? 1 ?? ??? ?? ??? ??? ? (SCC MEC)? ?? . SCC MEC? ??? ?? ??? ??, ? ?? ??? ?? ? ?? ?? (MEC ??? ???? CCR ??? ???) ? J-?? (?? 1)? ??? ?? ?????. CCR ??? ?????? SCC MEC? ??? ?? recombinases (CCR / ccrAB)? ? ??? ????? ?? ? ??? ???, 431mec ??, ?? ??? mecR1 ? MECI? ???? ?? ?? IS? ???? ???? ?? ?? ??? 1. ?? ? ?? ??? ? ?? ??? (mecB </EM&gt;? MECC)? ?? ??? 2?? ??? ?? ??? ???? ?? ???. SCC MEC ??? ???? ?? CCR ?? ??? ??? ??? ??? ??? ?? ??? ???? J ?? (J1, J2, J3?)? ???? ????. ?? ?? ? ??? ??? (? : ??, B, C, D ? E) ? CCR ?? allotypes (? : 1-8 ?)? ????. ??? ??? ???? allotypes? ?? ??? ??? SCC ? ??? ?????. SCC MEC ?? ? ??? ?? ??? ??? ?? (IWG-SCC)? ??? ?? ?? ?? ???? ?? ??? ?? SCC ? ??? ?? CCR ??? ???? ??? ?? ???? ???? ??????? ??? J ?? DNA 1? ??? ?? ?? ???? ??. MRSA??? ????? ?? multilocus ??? ?? (ST) ? / ?? ??? ?? ??? ??? (SPA)? ?? (? : ST8 ? (??? / ??) ?? ?? ?? ??? ?? ????? ?? SCC ? ??? ?? ?? ??? ?? ????? -T008-MRSA-IVa?). ??? SCC ? ??? ?? ? ????? ???? ?? ?? MRSA (CA-MRSA)? ??? ????, MRSA? ??? ?? ?? ?? ?? ???? ?? ??? ?? ?????. ?? PCR? ?? ??? ?? MEC? CCR ???? ??? ??? ????? ???? SCC MEC? ?????, ??? ?? (20 ~ 30) ???? ?? ? ?? ?? PCR ??? ?????. ??? ??. ?? ??, 21 ???? ? SCC MEC I-IVB 3? ?? ?? ?? ?? PCR ??? ????. ?? ?. subsequently CCR, MEC, ??? J-??? ?? ???? ??????? ??? ??? ???? ??? ???? ?? PCR ?? 4? ? ??? ????. SCC ?? ??? ????? ??, ?? ??? PCR (M-PCR) ??? ??? ?? PCR ???? ?? ? ? ??? ?????. ? Lencastre? ??? SCC MEC I-IV? ?? ???? M-PCR? ????, ??? SCC ? IV? ?? 5,6,7? ?????? ??? M-PCR?, SCC ? IV? ?? ?????????. ??? ??? ??? ? SCC ? IV ??? ???? ?? 2 ?? ??? ???? ???, ?? ? typeable ??? ?????. SCC ? ???? ???? ??, ??? ?? ? ?? SCC MEC? ??? V 8 ??? I? ???? ??? ?? ??? ?? ??? PCR ??? ????, ??? ??? ??? ??? B? ??????? 9 ecame. ? ??? ??? ??? ???? ?? SCC ? ??? ???? ???? ??, ????? (SCOPUS?? 337, 2013? 1? 30? ????) ? ????? ??????. ?? ?? ??, ??? ??? ?? MRSA SCC MEC ???? ????? ??? ?? ???? ?? ?? ??? ?????. ??? ??? ???? ????? ??? ??? ???? ?? ??? ?? ???? ??? ?? ?? ???? ????. MRSA SCC ? ??? ???? ??? ?????? ??, ??? ?? SCC MEC ????? M-PCR?? ???, ??? ????? ??? ??? ?? ? ?? ???? ??? ??? ???? ??? ????? ????.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent</td>
			<td>Company</td>
			<td>Catalogue Number</td>
		 </tr>
		 <tr>
			<td>Tryptic Soy Agar</td>
			<td>Fisher (BD)</td>
			<td>CA90002-700 (236920)</td>
		 </tr>
		 <tr>
			<td>Sterile distilled water</td>
			<td>Life Technologies</td>
			<td>10977-015</td>
		 </tr>
		 <tr>
			<td>Platinum Taq: including 10x PCR buffer and 50 mM MgCl2</td>
			<td>Life Technologies</td>
			<td>10966-034</td>
		 </tr>
		 <tr>
			<td>100 mM dNTP</td>
			<td>Life Technologies</td>
			<td>10297-018</td>
		 </tr>
		 <tr>
			<td>Tris base</td>
			<td>Sigma-Aldrich</td>
			<td>T6066</td>
		 </tr>
		 <tr>
			<td>Boric acid</td>
			<td>Sigma-Aldrich</td>
			<td>B7901</td>
		 </tr>
		 <tr>
			<td>EDTA</td>
			<td>Life Technologies</td>
			<td>15576-028</td>
		 </tr>
		 <tr>
			<td>Agarose</td>
			<td>Life Technologies</td>
			<td>16500-500</td>
		 </tr>
		 <tr>
			<td>Glycerol</td>
			<td>Life Technologies</td>
			<td>15514-011</td>
		 </tr>
		 <tr>
			<td>Bromophenol blue</td>
			<td>Sigma-Aldrich</td>
			<td>B8026</td>
		 </tr>
		 <tr>
			<td>1Kb+ DNA ladder</td>
			<td>Life Technologies</td>
			<td>10787-026</td>
		 </tr>
		 <tr>
			<td>Ethidium bromide</td>
			<td>Sigma-Aldrich</td>
			<td>E7637</td>
		 </tr>
		 <tr>
			<td>1.5ml Microcentrifuge tubes </td>
			<td>VWR (Axygen Scientific)</td>
			<td>10011-700 </td>
		 </tr>
		 <tr>
			<td>Culture sticks</td>
			<td>VWR</td>
			<td>CA10805-018</td>
		 </tr>
		 <tr>
			<td>PCR tubes</td>
			<td>Diamed</td>
			<td>AD0210-FCN (new #: DIATEC420-1250)</td>
		 </tr>
		 <tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417c</td>
		 </tr>
		 <tr>
			<td>Heat block</td>
			<td>VWR</td>
			<td>13259-030 / 13259-286 </td>
		 </tr>
		 <tr>
			<td>Thermalcycler</td>
			<td>Applied Biosystems (2720)</td>
			<td>4359659 </td>
		 </tr>
		 <tr>
			<td>Horizontal, submersible gel electrophoresis chamber with gel mold</td>
			<td>BioRad</td>
			<td>170-4469</td>
		 </tr>
		 <tr>
			<td>Power supply</td>
			<td>BioRad</td>
			<td>164-5050</td>
		 </tr>
		 <tr>
			<td>Rocker shaker</td>
			<td>VWR</td>
			<td>40000-300 </td>
		 </tr>
		 <tr>
			<td>Molecular Imager Gel Doc System</td>
			<td>BioRad</td>
			<td>1708170 </td>
		 </tr>
		</tbody>
 </table>

multiplex pcr assay for typing of staphylococcal cassette chromosome mec types i to v in methicillin-resistant staphylococcus aureus

??? ?? ??? ??? ??? ? (SCC MEC) ??? ?? ? ????? ???? ?? ?? MRSA (CA-MRSA)? ??? ????, ?? ?? ?? ?? ??? ?? (MRSA)? ??? ?? ?? ?? ?? ???? ?? ??? ?? ?????. ?? PCR? ?? ??? ?? MEC? CCR ???? ??? ??? ????? ???? SCC MEC? ?????, ?? ???? ?? ? ?? ?? PCR ??? ??? ??????. ??? ?? ? ?? SCC MEC ?? ? V? ?? I? ???? ??? ?? ??? ?? ??? PCR ??? ????, ??? ?? ??? ????? ??? ?????????. ? ??? ??? ??? ???? ?? SCC ? ??? ???? ???? ?? ????? ? ????? ??????. ???, ??? NAT? ????? ??? ???? ????? ? ??? URE? ??? ?? ???? ??? ?? ?? ???? ????. , MRSA SCC ? ??? ???? ??? ?? ???? ??? ??? ?? ??? PCR ??? ???? ??? ?????, ??? ????? ??? ??? ?? ? ?? ???? ??? ?????.

This updated M-PCR is able to determine (classify) SCCmec types I-V, as well major subtypes of SCCmec IV. The assay targets unique and specific loci of SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE and V, with concomitant mecA gene detection. Tentative identification of SCCmec VI and VIII is also possible, but would require further testing to confirm. Figure 3 illustrates representative SCCmec I-VI and VIII and the locations of each target within the element.
The type I specific primers (red) target orf E008 (strain NCTC10442; AB033763) in the J1 region of SCCmec I, while the type II primers (dark green) are specific to orf NO43 (strain N315; D86934) present in the J2 of all SCCmec II and SCCmec VIII described thus far. Type III (purple), IVa (dark blue), IVb (light green) and IVd (peach) are all specific targets located in the J1 regions of the respective SCCmec types. Type III primers target orf CZ003 (strain 85/2082; AB037671), type IVa target orf CQ002 (strain CA05; AB063172), type IVb target orf CM001 (strain 8/6-3P; AB063173), and type IVd primers target orf CG001 (strain JCSC4469; AB097677). The locus for type IVc primers (burgundy) is located in orf CR008 (strain MR108; AB096217) of the J1 region of SCCmec IVc, but also present in SCCmec IVE which has the similar J1 region. The locus for type IVE primers (light blue) is located in orf IVE01 (strain AR43/3330.1; AJ810121) of the J3 region of SCCmec IVE, as well as present in SCCmec IVF which shares the same J3 region. Finally, the specific target for SCCmec V is orf V011 (strain JCSC3624; AB12121) found in the J2 region of the SCCmec element. Additional PCR targets present in the assay include the mecA gene (brown) found in all SCCmec elements and serving as an internal control, the kdp gene (yellow) located in the J1 region of the prototypical SCCmec II of strain N315, and one specific to orf CZ049 of SCCHg (orange), found adjacent to SCCmec III in the prototypical type III of strain 85/2082. Because SCCmec VIII contains the same J2 region as SCCmec II (and therefore positive for the type II target) we included a target to ccrAB4 (pink) to distinguish between them. ccrAB4 is also present in multiple SCC types like IIA, IVE and IVF as an adjoining SCC element, in addition to being the main ccr complex for types VI and VIII. Of note, SCCmec IIA shares the same J1 region as type IVb and, therefore, is also positive for the IVb target.
Figure 4 is a representative gel demonstrating the expected PCR products for all representative strains of SCCmec types I-VI and VIII, and SCCmec IV subtypes a-F. The M-PCR produced distinct bands corresponding to their respective molecular sizes, easily recognizable in an agarose gel stained with ethidium bromide. For a typical SCCmec I two bands are expected; the type I specific band at 613 bp, as well as the mecA control band at 147 bp (Figure 5). Three representative SCCmec II strains are shown, including the prototypical type II of strain N315, and the less prevalent type IIA, and type IIb. To classify a strain as SCCmec II two bands should be present, including the type II locus target at 128 bp and the mecA control (Figure 6). Strain N315 carries the dominant SCCmec II element, which is identifiable based on of the additional presence of a kdp product at 398 bp (which is carried in its longer J1 region). The less prevalent SCCmec IIA, seen in strain AR14/0298, is positive for the ccrAB4 target at 106 bp (which it carries on an accessory element), as well as the type IVb target at 193 bp (which is a consequence of it sharing the same J1 region as type IVb). SCCmec IIb is also a less prevalent type and only carries the type II and mecA targets. Two representative SCCmec III are shown on the gel, including the prototypical SCCmec III of strain 85/2082, and the less dominant type IIIA of strain JCSC290. SCCmec III are identified based on the presence of two PCR products, including the type III specific target at 257 bp, and the mecA control target (Figure 7). The dominant SCCmec III will also be positive for the mercury target at 280 bp, which is carried on an adjacent SCC element and serves to distinguish it from the less common SCCmec IIIA. Five representative SCCmec IV elements are shown, including Types IVa, IVb, IVc, IVd, IVE and IVF. Unlike with SCCmec I-III, there is no single target present in all of the SCCmec IV subtypes, apart from mecA (Figure 8). The representative SCCmec IVa strain is positive for the type IVa specific product at 776 bp, the representative SCCmec IVb strain is positive for the IVb specific product at 193 bp, the representative SCCmec IVc strain is positive for the IVc product at 200 bp and the representative SCCmec IVd strain is positive for the IVd specific product at 881 bp. The representative SCCmec IVE strain is identified based on the presence of the type IVE band, as well as the ccrAB4 product (present on an adjacent accessory element) and type IVc product (present because SCCmec IVE shares the same J1 region as SCCmec IVc). SCCmec IVF is similar to SCCmec IVE in that it shares the same J3 region and is consequently positive for the IVE target, as well as is positive for the ccrAB4 target due to an adjacent accessory element. SCCmec IVF can, however, be distinguished from SCCmec IVE in that lacks the type IVc target. A typical SCCmec V would have two PCR products present on the gel; the type V specific band at 325 bp and the mecA control at 147 bp (Figure 9). Finally, while the goal of this assay was not to provide definitive identification of either SCCmecVI or VIII, representative strains were included for both since a specific PCR pattern provides suggestive evidence for the presence of these types. Further investigation using traditional typing methods (ccrand mecgene complex typing) for confirmation of both SCCmecVI and VIII 3,4, or using a specific SCCmecVIII typing assay for confirmation of SCCmecVIII 12 would be required. In addition to the mecA target, the representative SCCmec VI would be expected to produce a positive ccrAB4 product at 106 bp as this is its main ccr complex type (Figure 10). The representative SCCmec VIII would also be positive for mecA at 147 bp and ccrAB4 at 106 bp, and would be distinguished from SCCmec VI on the basis of a positive type II specific product in SCCmec VIII (Figure 10), which results from it having the same J2 region as SCCmec II 13.
<img alt="Figure 1" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig1large.jpg" src="/files/ftp_upload/50779/50779fig1.jpg" width="600" /> 
Figure 1. The essential structure of SCCmec elements demonstrating the mec and ccr gene complexes, bracketed by J1, J2 and J3 regions. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig1large.jpg" target="_blank">Click here to view larger figure</a>.

<img alt="Figure 2" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig2large.jpg" src="/files/ftp_upload/50779/50779fig2.jpg" width="600" /> 
 
Figure 2. Sample tube for DNA extraction. The microcentrifuge tube on the left contains sterile water while the tube on the right shows the desired cell turbidity for optimal PCR efficiency. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig2large.jpg" target="_blank">Click here to view larger figure</a>.

<img alt="Figure 3" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig3large.jpg" src="/files/ftp_upload/50779/50779fig3large.jpg" width="600" /> 
Figure 3. Representative SCCmec types I-VI and VIII and the locations of the specific targets used in the M-PCR. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig3large.jpg" target="_blank">Click here to view larger figure</a>.
<img alt="Figure 4" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig4large.jpg" src="/files/ftp_upload/50779/50779fig4.jpg" width="600" /> 
Figure 4. A representative gel demonstrating the expected PCR products for all representative strains of SCCmec types I-VI and VIII, and SCCmec IV subtypes a-F. Enhanced multiplex PCR assay identifies SCCmec types and subtype I-V. Lanes M: 1 Kb plus DNA ladder (Invitrogen). (Adapted from Zhang, et al. 9). <a href="https://www.jove.com/files/ftp_upload/50779/50779fig4large.jpg" target="_blank">Click here to view larger figure</a>.
<img alt="Figure 5" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig5large.jpg" src="/files/ftp_upload/50779/50779fig5.jpg" width="600" /> 
Figure 5. Representative SCCmec I (NCTC10442) sample showing the mecA and type I specific target. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig5large.jpg" target="_blank">Click here to view larger figure</a>.
<img alt="Figure 6" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig6large.jpg" src="/files/ftp_upload/50779/50779fig6.jpg" width="600" /> 
Figure 6. Representative SCCmec II (N315), SCCmec IIA (AR14/0298) and SCCmec IIb (PL150) samples. All samples are positive for mecA and type II specific target. The prototypic SCCmec II caries additional kdp gene, while type IIA carries the same J1 region as SCCmec IVb, as well as the ccrAB4 genes. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig6large.jpg" target="_blank">Click here to view larger figure</a>.
<img alt="Figure 7" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig7large.jpg" src="/files/ftp_upload/50779/50779fig7.jpg" width="600" /> 
Figure 7. Representative SCCmec III (85/2082) and SCCmec IIIA (JCSC290) strains. Both are positive for mecA and the type III specific target. 85/2082 also bears the SCCHg element adjacent to the SCCmec III element. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig7large.jpg" target="_blank">Click here to view larger figure</a>.
<img alt="Figure 8" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig8large.jpg" src="/files/ftp_upload/50779/50779fig8.jpg" width="600" /> 
Figure 8. Representative SCCmec IV strains; SCCmec IVa (CA05), SCCmec IVb (8/6-3P), SCCmec IVc (MR108) and SCCmec IVd (JCSC4469), SCCmec IVE (AR43/3330.1) and SCCmec IVF (CLS-4584). All are positive for mecA and respective type specific targets. SCCmec IVE (AR43/3330.1) and SCCmec IVF (CLS-4584) both share the same J3 region and contain the ccrAB4 genes and are, therefore, positive for the IVE and ccrAB4 specific target. SCCmec IVE shares the same J1 region as type IVc and is, therefore, positive for type IVc target as well. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig8large.jpg" target="_blank">Click here to view larger figure</a>.
<img alt="Figure 9" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig9large.jpg" src="/files/ftp_upload/50779/50779fig9.jpg" width="600" /> 
Figure 9. Representative SCCmec V (WIS [WBG8318]) showing the mecA and type V specific target. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig9large.jpg" target="_blank">Click here to view larger figure</a>.
<img alt="Figure 10" fo:content-width="6in" fo:src="/files/ftp_upload/50779/50779fig9large.jpg" src="/files/ftp_upload/50779/50779fig10.jpg" width="600" /> 
Figure 10. Representative SCCmec VI (HDE288) and SCCmec VIII (C10682). Both strains are positive for the mecA and ccrAB4 targets, while type VIII (which shares the same J2 region as type II) is positive for the type II target as well. <a href="https://www.jove.com/files/ftp_upload/50779/50779fig10large.jpg" target="_blank">Click here to view larger figure</a>.
<table border="1" fo:keep-together.within-page="always">
	<tbody>
		<tr>
			<td>Reagents:</td>
			<td>Vol. (&#956;l) </td>
			<td fo:width="2.5in" width="250">Oligonucleotide sequence</td>
			<td>Amplicon size (bp)</td>
			<td>Specificity</td>
		</tr>
		<tr>
			<td>10x PCR buffer</td>
			<td>2.5</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>50 mM MgCl2</td>
			<td>1.25</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>2 mM dNTP</td>
			<td>2.5</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq</td>
			<td>0.2</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>H2O</td>
			<td>2.28</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Primers (10 &#956;M):</td>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Type I-F</td>
			<td>0.25</td>
			<td>GCTTTAAAGAGTGTCGTTACAGG</td>
			<td rowspan="2">613</td>
			<td rowspan="2">SCCmec I</td>
		</tr>
		<tr>
			<td>Type I-R</td>
			<td>0.25</td>
			<td>GTTCTCTCATAGTATGACGTCC</td>
		</tr>
		<tr>
			<td>Type II-F</td>
			<td>0.25</td>
			<td>CGTTGAAGATGATGAAGCG</td>
			<td rowspan="2">398</td>
			<td rowspan="2">SCCmec II</td>
		</tr>
		<tr>
			<td>Type II-R</td>
			<td>0.25</td>
			<td>CGAAATCAATGGTTAATGGACC</td>
		</tr>
		<tr>
			<td>Type II-F2</td>
			<td>0.2</td>
			<td>TAGCTTATGGTGCTTATGCG</td>
			<td rowspan="2">128</td>
			<td rowspan="2">SCCmec II, VIII</td>
		</tr>
		<tr>
			<td>Type II-R2</td>
			<td>0.2</td>
			<td>GTGCATGATTTCATTTGTGGC</td>
		</tr>
		<tr>
			<td>Type III-F</td>
			<td>0.33</td>
			<td>CCATATTGTGTACGATGCG</td>
			<td rowspan="2">280</td>
			<td rowspan="2">Mercury element of SCCmec III</td>
		</tr>
		<tr>
			<td>Type III-R</td>
			<td>0.33</td>
			<td>CCTTAGTTGTCGTAACAGATCG</td>
		</tr>
		<tr>
			<td>Type III-F5</td>
			<td>0.4</td>
			<td>GAAACTAGTTATTTCCAACGG</td>
			<td rowspan="2">257</td>
			<td rowspan="2">SCCmec III and IIIA</td>
		</tr>
		<tr>
			<td>Type III-R6</td>
			<td>0.4</td>
			<td>GTGTAATTTCTTTTGAAAGATATGG</td>
		</tr>
		<tr>
			<td>Type IVa-F</td>
			<td>0.25</td>
			<td>GCCTTATTCGAAGAAACCG</td>
			<td rowspan="2">776</td>
			<td rowspan="2">SCCmec IVa</td>
		</tr>
		<tr>
			<td>Type IVa-R</td>
			<td>0.25</td>
			<td>CTACTCTTCTGAAAAGCGTCG</td>
		</tr>
		<tr>
			<td>Type IVb-F</td>
			<td>0.7</td>
			<td>TCTGGAATTACTTCAGCTGC</td>
			<td rowspan="2">493</td>
			<td rowspan="2">SCCmec IVb, IIA, IIB, IIC, IIE</td>
		</tr>
		<tr>
			<td>Type IVb-R</td>
			<td>0.7</td>
			<td>AAACAATATTGCTCTCCCTC</td>
		</tr>
		<tr>
			<td>Type IVc-F2</td>
			<td>0.25</td>
			<td>CCTGAATCTAAAGAGATACACCG</td>
			<td rowspan="2">200</td>
			<td rowspan="2">SCCmec IVc, IVE</td>
		</tr>
		<tr>
			<td>Type IVc-R2</td>
			<td>0.25</td>
			<td>GGTTATTTTCATAGTGAATCGC</td>
		</tr>
		<tr>
			<td>Type IVd-F5</td>
			<td>1.8</td>
			<td>CTCAAAATACGGACCCCAATACA</td>
			<td rowspan="2">881</td>
			<td rowspan="2">SCCmec IVd</td>
		</tr>
		<tr>
			<td>Type IVd-R6</td>
			<td>1.8</td>
			<td>TGCTCCAGTAATTGCTAAAG</td>
		</tr>
		<tr>
			<td>Type IVE-F3</td>
			<td>0.75</td>
			<td>CAGATTCATCATTTCAAAGGC</td>
			<td rowspan="2">175</td>
			<td rowspan="2">SCCmec IVE, IVF</td>
		</tr>
		<tr>
			<td>Type IVE-R4</td>
			<td>0.75</td>
			<td>AACAACTATTAGATAATTTCCG</td>
		</tr>
		<tr>
			<td>Type V-F</td>
			<td>0.33</td>
			<td>GAACATTGTTACTTAAATGAGCG</td>
			<td rowspan="2">325</td>
			<td rowspan="2">SCCmec V</td>
		</tr>
		<tr>
			<td>Type V-R</td>
			<td>0.33</td>
			<td>TGAAAGTTGTACCCTTGACACC</td>
		</tr>
		<tr>
			<td>ccr4-Fd</td>
			<td>0.35</td>
			<td>ATCGCTCATTATGGATACYGC</td>
			<td rowspan="3">106</td>
			<td rowspan="3">SCCmec IIA, IIB, IIC, IIE, IVE, IVF, VI, VIII</td>
		</tr>
		<tr>
			<td>ccr4-R5</td>
			<td>0.35</td>
			<td>CCATTTTTTGATAACCTGAACG</td>
		</tr>
		<tr>
			<td>ccr4-R6</td>
			<td>0.35</td>
			<td>CTATTTTTTTATAGCCTGAACG</td>
		</tr>
		<tr>
			<td>MecA147-F</td>
			<td>0.6</td>
			<td>GTGAAGATATACCAAGTGATT</td>
			<td rowspan="2">147</td>
			<td rowspan="2">mecA</td>
		</tr>
		<tr>
			<td>MecA147-R</td>
			<td>0.6</td>
			<td>ATGCGCTATAGATTGAAAGGAT</td>
		</tr>
	</tbody>
</table>
Table 1. PCR reagents and volumes of each per reaction. Note: Primers previously described 9.

Watch this Scientific Journal Video about Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus at JoVE.com

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Methicillin - ??? V? ??? ?? ??? ??? ? ?? I? ?????? ?? ??? PCR ?? ??<em&gt; ?? ??? ??</em

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec

Universidad San Sebastian

Research

JoVE Journal

Immunology and Infection

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

11.8K 조회수.  Alberta Health Services / Calgary Laboratory Services / University of Calgary. We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

비디오: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Experimental Endocarditis Model of Methicillin Resistant Staphylococcus aureus (MRSA) in Rat

Endovascular infections, including endocarditis, are life-threatening infectious syndromes1-3. Staphylococcus aureus is the most common world-wide cause of such syndromes with unacceptably high morbidity and mortality even with appropriate antimicrobial agent treatments4-6. The increase in infections due to methicillin-resistant S. aureus (MRSA), the high rates of vancomycin clinical treatment failures and growing problems of linezolid and daptomycin resistance have all further complicated the management of patients with such infections, and led to high healthcare costs7, 8. In addition, it should be emphasized that most recent studies with antibiotic treatment outcomes have been based in clinical settings, and thus might well be influenced by host factors varying from patient-to-patient. Therefore, a relevant animal model of endovascular infection in which host factors are similar from animal-to-animal is more crucial to investigate microbial pathogenesis, as well as the efficacy of novel antimicrobial agents. Endocarditis in rat is a well-established experimental animal model that closely approximates human native valve endocarditis. This model has been used to examine the role of particular staphylococcal virulence factors and the efficacy of antibiotic treatment regimens for staphylococcal endocarditis. In this report, we describe the experimental endocarditis model due to MRSA that could be used to investigate bacterial pathogenesis and response to antibiotic treatment.

Experimental Endocarditis Model of Methicillin Resistant Staphylococcus aureus MRSA in Rat

Experimental rat endocarditis model due to methicillin-resistant S. aureus.

Methicillin 내성의 실험 심내막염 모델<em&gt; 황색 포도상 구균</em&gt; (MRSA) 쥐에서

Endovascular infections, including endocarditis, are life-threatening infectious syndromes1-3. Staphylococcus aureus is the most common world-wide cause ...

연구

면역학 및 감염병학

Staphylococcus aureus Growth using Human Hemoglobin as an Iron Source

S. aureus is a pathogenic bacterium that requires iron to carry out vital metabolic functions and cause disease. The most abundant reservoir of iron inside the human host is heme, which is the cofactor of hemoglobin. To acquire iron from hemoglobin, S. aureus utilizes an elaborate system known as the iron-regulated surface determinant (Isd) system1. Components of the Isd system first bind host hemoglobin, then extract and import heme, and finally liberate iron from heme in the bacterial cytoplasm2,3. This pathway has been dissected through numerous in vitro studies4-9. Further, the contribution of the Isd system to infection has been repeatedly demonstrated in mouse models8,10-14. Establishing the contribution of the Isd system to hemoglobin-derived iron acquisition and growth has proven to be more challenging. Growth assays using hemoglobin as a sole iron source are complicated by the instability of commercially available hemoglobin, contaminating free iron in the growth medium, and toxicity associated with iron chelators. Here we present a method that overcomes these limitations. High quality hemoglobin is prepared from fresh blood and is stored in liquid nitrogen. Purified hemoglobin is supplemented into iron-deplete medium mimicking the iron-poor environment encountered by pathogens inside the vertebrate host. By starving S. aureus of free iron and supplementing with a minimally manipulated form of hemoglobin we induce growth in a manner that is entirely dependent on the ability to bind hemoglobin, extract heme, pass heme through the bacterial cell envelope and degrade heme in the cytoplasm. This assay will be useful for researchers seeking to elucidate the mechanisms of hemoglobin-/heme-derived iron acquisition in S. aureus and possibly other bacterial pathogens.

Staphylococcus aureus Growth using Human Hemoglobin as an Iron Source

Here we describe a growth assay for Staphylococcus aureus using hemoglobin as the sole source of available nutrient iron. This assay establishes the role of bacterial factors involved in hemoglobin-derived iron acquisition.

철 소스로 인간 혈색소를 사용하여 황색 포도상 구균 성장

S. aureus is a pathogenic bacterium that requires iron to  carry out vital metabolic functions and cause disease. The most abundant  reservoir of iron ...

Studying Interactions of Staphylococcus aureus with Neutrophils by Flow Cytometry and Time Lapse Microscopy

We present methods to study the effect of phenol soluble modulins (PSMs) and other toxins produced and secreted by Staphylococcus aureus on neutrophils. To study the effects of the PSMs on neutrophils we isolate fresh neutrophils using density gradient centrifugation. These neutrophils are loaded with a dye that fluoresces upon calcium mobilization. The activation of neutrophils by PSMs initiates a rapid and transient increase in the free intracellular calcium concentration. In a flow cytometry experiment this rapid mobilization can be measured by monitoring the fluorescence of a pre-loaded dye that reacts to the increased concentration of free Ca2+. Using this method we can determine the PSM concentration necessary to activate the neutrophil, and measure the effects of specific and general inhibitors of the neutrophil activation.	
	To investigate the expression of the PSMs in the intracellular space, we have constructed reporter fusions of the promoter of the PSM&alpha; operon to GFP. When these reporter strains of S. aureus are phagocytosed by neutrophils, the induction of expression can be observed using fluorescence microscopy.

Studying Interactions of Staphylococcus aureus with Neutrophils by Flow Cytometry and Time Lapse Microscopy

We present methods to study the effect of PSMs and other toxins secreted by Staphylococcus aureus on neutrophils using flow cytometry and fluorescence microscopy.

의 상호 작용을 연구<em&gt; 황색 포도상 구균</em&gt; 유동 세포 계측법 및 시간 경과 현미경에 의한 호중구와

We present methods to study the effect of phenol soluble modulins (PSMs)  and other toxins produced and secreted by Staphylococcus  aureus on neutrophils. ...

2D and 3D Chromosome Painting in Malaria Mosquitoes

Fluorescent in situ hybridization (FISH) of whole arm chromosome probes is a robust technique for mapping genomic regions of interest, detecting chromosomal rearrangements, and studying three-dimensional (3D) organization of chromosomes in the cell nucleus. The advent of laser capture microdissection (LCM) and whole genome amplification (WGA) allows obtaining large quantities of DNA from single cells. The increased sensitivity of WGA kits prompted us to develop chromosome paints and to use them for exploring chromosome organization and evolution in non-model organisms. Here, we present a simple method for isolating and amplifying the euchromatic segments of single polytene chromosome arms from ovarian nurse cells of the African malaria mosquito Anopheles gambiae. This procedure provides an efficient platform for obtaining chromosome paints, while reducing the overall risk of introducing foreign DNA to the sample. The use of WGA allows for several rounds of re-amplification, resulting in high quantities of DNA that can be utilized for multiple experiments, including 2D and 3D FISH. We demonstrated that the developed chromosome paints can be successfully used to establish the correspondence between euchromatic portions of polytene and mitotic chromosome arms in An. gambiae. Overall, the union of LCM and single-chromosome WGA provides an efficient tool for creating significant amounts of target DNA for future cytogenetic and genomic studies.

Chromosome painting is a useful method for studying organization of the cell nucleus and evolution of the karyotype. Here, we demonstrate an approach to isolate and amplify specific regions of interest from single polytene chromosomes that are subsequently used for two- and three-dimensional fluorescent in situ hybridization (FISH).

말라리아 모기의 2D 및 3D 염색체 페인팅

Fluorescent in situ hybridization (FISH) of whole arm chromosome probes is a robust technique for mapping genomic regions of interest, detecting ...

High-throughput Quantitative Real-time RT-PCR Assay for Determining Expression Profiles of Types I and III Interferon Subtypes

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific locked nucleic acid (LNA) and molecular beacon (MB) probes, transcript standards, automated multichannel pipetting, and plate drying. Determining expression among the type I interferons (IFN), especially the twelve IFN-&#945; subtypes, is limited by their shared sequence identity; likewise, the sequences of the type III IFN, especially IFN-&#955;2 and -&#955;3, are highly similar. This assay provides a reliable, reproducible, and relatively inexpensive means to analyze the expression of the seventeen interferon subtype transcripts.

This protocol describes a high-throughput qRT-PCR assay for the analysis of type I and III IFN expression signatures. The assay discriminates single base pair differences between the highly similar transcripts of these genes. Through batch assembly and robotic pipetting, the assays are consistent and reproducible.

높은 처리량 정량 실시간 RT-PCR 분석 유형 I과 III 인터페론 하위 유형의 발현 양상을 결정하는

Described in this report is a qRT-PCR assay for the analysis of seventeen human IFN subtypes in a 384-well plate format that incorporates highly specific ...

Targeting Biofilm Associated Staphylococcus aureus Using Resazurin Based Drug-susceptibility Assay

Most pathogenic bacteria are able to form biofilms during infection, but due to the difficulty of manipulating and assessing biofilms, the vast majority of laboratory work is conducted with planktonic cells. Here, we describe a peg plate biofilm assay as performed with Staphylococcus aureus. Bacterial biofilms are grown on pegs attached to a 96-well microtiter plate lid, washed through gentle submersion in buffer, and placed in a drug challenge plate. After subsequent incubation they are again washed and moved to a final recovery plate, in which the fluorescent dye resazurin serves as a viability indicator. This assay offers greatly increased ease-of-use, reliability, and reproducibility, as well as a wealth of data when conducted as a kinetic read. Moreover, this assay can be adapted to a medium-throughput drug screening approach by which an endpoint fluorescent readout is taken instead, offering a path for drug discovery efforts.

Targeting Biofilm Associated Staphylococcus aureus Using Resazurin Based Drug-susceptibility Assay

Most bacterial infections produce a biofilm. By virtue of their environment, biofilm associated bacteria are often phenotypically drug resistant. Novel antibacterial molecules that kill bacteria in biofilms are thus a high priority. We establish an assay to quickly screen for antimicrobial compounds that are effective at eradicating biofilms.

바이오 필름 관련 타겟팅<em&gt; 황색 포도상 구균</em&gt; 사용 레사 주린 기반 약물 감수성 분석

Most pathogenic bacteria are able to form biofilms during infection, but due to the difficulty of manipulating and assessing biofilms, the vast majority ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

의 유전자형<em&gt; 황색 포도상 구균</em&gt;에 의해 리보솜 스페이서 PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to antibiotics. Genomic studies reveal that S. aureus carries many virulence and resistance genes located in mobile genetic elements, suggesting that horizontal gene transfer (HGT) plays a critical role in S. aureus evolution. However, a full and detailed description of the methodology used to study HGT in S. aureus is still lacking, especially regarding natural transformation, which has been recently reported in this bacterium. This work describes three protocols that are useful for the in vitro investigation of HGT in S. aureus: conjugation, phage transduction, and natural transformation. To this aim, the cfr gene (chloramphenicol/florfenicol resistance), which confers the Phenicols, Lincosamides, Oxazolidinones, Pleuromutilins, and Streptogramin A (PhLOPSA)-resistance phenotype, was used. Understanding the mechanisms through which S. aureus transfers genetic materials to other strains is essential to comprehending the rapid acquisition of resistance and helps to clarify the modes of dissemination reported in surveillance programs or to further predict the spreading mode in the future.

Methodology for the Study of Horizontal Gene Transfer in Staphylococcus aureus

We describe here three different protocols for the in vitro investigation of conjugation, transduction, and natural transformation in Staphylococcus aureus.

수평 유전자 전달의 연구에 대한 방법론<em&gt; 황색 포도상 구균</em

One important feature of the major opportunistic human pathogen Staphylococcus aureus is its extraordinary ability to rapidly acquire resistance to ...

Bead Based Multiplex Assay for Analysis of Tear Cytokine Profiles

Tear film is a complex mixture of lipids, proteins and minerals which covers the external surface of the eye, thereby providing lubrication, nutrition and protection to the underlying cells. Analysis of tears is an emerging area for the identification of biomarkers for the prediction, diagnosis, and prognosis of various ocular diseases. Tears are easily accessible and their collection is non-invasive. Therefore, advancing technologies are gaining prominence for identification of multiple analytes in tears to study changes in protein or metabolite composition and its association with pathological conditions. Tear cytokines are ideal biomarkers for studying the health of the ocular surface and also help in understanding the mechanisms of different ocular surface disorders like dry eye disease and vernal conjunctivitis. Bead based multiplex assays have the capability of detecting multiple analytes in a small amount of sample with a higher sensitivity. Here we describe a standardized protocol of tear sample collection, extraction and analysis of cytokine profiling using a bead based multiplex assay.

Analysis of tear film cytokines helps in studying various ocular diseases. Bead based multiplex assays are simple and sensitive and enable the testing of multiple targets in samples with small volumes. Here we describe a protocol for tear film cytokine profiling a using bead based multiplex assay.

구슬 눈물 Cytokine 프로 파일의 분석에 대 한 다중 분석 결과 기반으로

Tear film is a complex mixture of lipids, proteins and minerals which covers the external surface of the eye, thereby providing lubrication, nutrition and ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

마우스 모델을 평가 타고 난 면역 반응 포도 상 구 균 감염

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...