We thank T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre, and D. Coleman for the kind gift of some reference strains used in this study. This work was in part supported financially by the Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

These procedures should be conducted in a certified biosafety level 2 laboratory. Appropriate personal protective equipment such as gloves and lab coats should be used at all times.
1. Sample Preparation
<ol>
	<li>Fresh overnight plate cultures of MRSA are required. On the day before PCR is to be done, select a single colony of MRSA with a sterile culture stick and prepare a heavy streak of the bacteria on a Tryptic Soy Agar (TSA) plate. Multiple samples can be streaked onto a single plate. Incubate overnight at 37 &#176;C.</li>
	<li>Add 75 &#956;l of sterile distilled water to a 1.5 ml microcentrifuge tube. Using a sterile culture stick pick up a small amount of bacteria from the heavy overnight streak. Swirl the bacteria in the sterile water to prepare a turbid solution (Figure 2). Repeat for all samples.</li>
	<li>Incubate the tubes in a dry heat block set at 95 &#176;C for 10 min to lyse the bacteria and release the DNA.</li>
</ol>
Note: If the bacterial solution is too weak or too concentrated PCR efficiency is reduced. Likewise, if the temperature is above 95 &#176;C or the incubation is longer than 10 min the PCR efficiency is reduced.
<ol start="4">
	<li>Remove the samples from the heat block and let stand at room temperature for 5 min.</li>
	<li>Centrifuge the samples at 13,000 rpm for 1 min, creating a cellular debris pellet and clear supernatant containing the DNA. Samples can be stored at -20 &#176;C for future use.</li>
</ol>
Note: If using a previously prepared and frozen sample, remove the microcentrifuge tube from the freezer and let stand at room temperature to fully thaw. If the pellet has been disturbed re-centrifuge the sample.
Note: gDNA prepared by any other method, including chelex extraction10, or column extraction (QIAmp DNA Mini Kit, Qiagen) is also acceptable.
2. PCR Preparation
Note: Control samples should be included in each PCR run and contain a minimum of types I, II, IIA, III, IVa, IVb, IVc, IVd, IVE and V. Ten extra samples should, therefore, be added to the count when preparing the master mix. DNA for the controls can be prepared ahead of time and stored for extended periods of time in the freezer.
<ol>
	<li>Remove PCR reagents, including 10x PCR buffer (without MgCl2), 50 mM MgCl2, dNTPs and primers, from the -20 &#176;C freezer and allow to thaw on the clean PCR bench (no bacteria or DNA permitted) at room temperature. 0.2 ml PCR tubes can be prepared and labeled at this time. 
	If new stocks of primers or dNTPs are required they can be prepared as follows:
	<ol>
		<li>Prepare primers by diluting concentrated stocks to 10 &#956;M working solutions with sterile distilled water. The primer stocks and working solutions can be kept frozen at -20 &#176;C for use at future dates.</li>
		<li>Prepare dNTPs by diluting commercial stocks to a working solution containing 2 &#956;M of each dNTP. In order to minimize the number of freeze/thaw cycles that the dNTPs are subjected to, stocks of 10 &#956;M of each dNTP can be prepared ahead of time, 50 &#956;l aliquots placed in 0.5 ml microcentrifuge tubes and stored at -20 &#176;C. As needed, a tube of the 10 &#956;M is removed and diluted to 2 &#956;M of each dNTP by adding 200 &#956;l of sterile distilled water.</li>
	</ol>
	</li>
	<li>Once thawed, vortex briefly to mix all reagents, then combine as per Table 1. It is important to use platinum taq DNA polymerase (as opposed to regular taq) because this has been found to influence the success of the reaction. Generally a master mix is prepared, vortexed briefly to mix and aliquoted into the individual PCR tubes.</li>
	<li>Close all PCR tubes and move to the general work bench. Add the template to the PCR tubes by pipetting 2 &#956;l of the clear supernatant from the previously prepared bacterial samples.</li>
	<li>Move to the dedicated amplification location and place the tubes into the thermal cycler under the following protocol: 94 &#176;C for 5 min, followed by 10 cycles of 94 &#176;C 45 sec, 65 &#176;C 45 sec, 72 &#176;C 1.5 min. A further 25 cycles of 94 &#176;C 45 sec, 52 &#176;C 45 sec, 72 &#176;C 2 min were followed by a 10 min incubation at 72 &#176;C and a hold at 4 &#176;C.</li>
</ol>
3. Agarose Gel Electrophoresis
(see Lee, P.Y. et al., J. Vis. Exp. (62), e3923, doi:10.3791/3923 (2012) for more details) 11.
A dedicated gel electrophoresis location is preferred. PCR products are run on a 2.5% agarose gel in 0.5x TBE buffer (110 mM Tris; 90 mM Borate; 2.5 mM EDTA; pH 8.3).
<ol>
	<li>Weigh 2.5 g of agarose and add to 100 ml of 0.5x TBE buffer in a glass Erlenmeyer flask. Cover the flask with plastic wrap and boil the solution in a microwave until fully dissolved. A 2.5% gel will boil over quickly, therefore stop the microwave and swirl the solution regularly.</li>
	<li>Cool the agarose until comfortable to touch by swirling under cold water, or by resting on the bench for 5 min. Pour the agarose into the casting tray.</li>
	<li>Remove tubes from the PCR thermal cycler and prepare the samples by add 2 &#956;l of 6x DNA loading dye (40% glycerol/0.25% bromophenol blue) to each sample. Load 5-10 &#956;l of sample per well on the gel. A 1 Kb+ or 100 bp DNA ladder is appropriate for the expected band sizes.</li>
	<li>Ethidium bromide (EtBr) can be added to the gel prior to pouring it, or alternatively the gel can be stained in an EtBr bath prior to being visualized. Place the finished gel in a solution of 0.5 &#956;g/ml EtBr in distilled water and mix gently on shaker for 10 min. Transfer the gel to a clean container and destain in distilled water for a further 10 min.</li>
</ol>

<ol>
	<li>IWG-SCC. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Classification+of+staphylococcal+cassette+chromosome+mec+(SCCmec):+guidelines+for+reporting+novel+SCCmec+elements.">Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements.</a> Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).</li><li>Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+for+Reporting+Novel+mecA+Gene+Homologues.">Guidelines for Reporting Novel mecA Gene Homologues.</a> Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).</li><li>Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissemination+of+new+methicillin-resistant+Staphylococcus+aureus+clones+in+the+community.">Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community.</a> Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).</li><li>Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combination+of+multiplex+PCRs+for+staphylococcal+cassette+chromosome+mec+type+assignment:+rapid+identification+system+for+mec,+ccr,+and+major+differences+in+junkyard+regions.">Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions.</a> Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).</li><li>Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+rapid+identification+of+structural+types+and+variants+of+the+mec+element+in+methicillin-resistant+Staphylococcus+aureus.">Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+to+the+multiplex+PCR+strategy+for+assignment+of+mec+element+types+in+Staphylococcus+aureus.">Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).</li><li>Milheirico, C., Oliveira, D. C., de Lencastre, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+strategy+for+subtyping+the+staphylococcal+cassette+chromosome+mec+type+IV+in+methicillin-resistant+Staphylococcus+aureus:+'SCCmec+IV+multiplex'.">Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'.</a> Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+multiplex+PCR+assay+for+characterization+and+concomitant+subtyping+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).</li><li>Zhang, K., McClure, J. A., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+multiplex+PCR+assay+for+typing+of+staphylococcal+cassette+chromosome+mec+types+I+to+V+in+methicillin-resistant+Staphylococcus+aureus.">Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus.</a> Molecular and Cellular Probes. 26 (5), 218-221 (2012).</li><li>de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one-step+microbial+DNA+extraction+method+using+"Chelex+100"+suitable+for+gene+amplification.">A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification.</a> Research in Microbiology. 143 (8), 785-790 (1992).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> J. Vis. Exp. (62), e3923 (2012).</li><li>McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+PCR+assay+to+facilitate+identification+of+the+recently+described+Staphylococcal+cassette+chromosome+mec+type+VIII.">Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII.</a> Molecular and Cellular Probes. 24 (4), 229-232 (2010).</li><li>Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+staphylococcal+cassette+chromosome+mec+type,+tentatively+designated+type+VIII,+harboring+class+A+mec+and+type+4+ccr+gene+complexes+in+a+Canadian+epidemic+strain+of+methicillin-resistant+Staphylococcus+aureus.">Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus.</a> Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).</li></ol>

No conflicts of interest declared.

The multiplex PCR assay described here provides a simple, reliable method for classifying types and major subtypes of SCCmec I-V in Staphylococci, with simultaneous discrimination of MRSA from MSSA. The assay is robust, conveniently done in a single PCR reaction and results are easy to interpret. The assay does have limitations in that it targets individual loci within each SCCmec type, but does not offer comprehensive ccr and mec complex typing, and therefore cannot be considered a go...

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.
In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:
TTCTCATTGATGCTGAAGCC
To:
GAAACTAGTTATTTCCAACGG

An erratum was issued for: <a href="https://www.jove.com/video/50779/multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec">Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus</a>.&#160; There was a&#160;typo&#160;in Table 1.

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Methicillin-resistant Staphylococcus aureus (MRSA) has acquired and integrated into its genome a 21-67-kb mobile genetic element, termed the staphylococcal cassette chromosome mec (SCCmec) that harbors the methicillin resistance (mecA) gene and other antibiotic resistance determinants 1. SCCmec is characterized by the presence of terminal direct and inverted repeats, two essential genetic components (the mec gene complex and the ccr gene complex), and the J-regions (Figure 1). The mec gene complex is composed of IS431mec, mecA, and intact or truncated sets of regulatory genes, mecR1 and mecI, while the ccr gene complex encodes the recombinases (ccr/ccrAB) that mediate integration of SCCmec into and its excision from the recipient chromosome 1. Recently two novel mec resistance genes (mecB and mecC) were described, which show significant sequence divergence from the mecA gene 2. The rest of the SCCmec element is comprised of J regions (J1, J2, and J3) that are located between and around the mec and ccr complexes and contain various genes or pseudogenes. There are several classes of mec complex (such as A, B, C, D and E) and allotypes of ccr complex (such as 1-8) described. Different combinations of these complex classes and allotypes generate various SCCmec types. According to the guidelines of SCCmec nomenclature and classification by the International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (IWG-SCC), SCCmec elements are classified into types based on the nature of the mec and ccr gene complexes, and are further classified into subtypes according to differences in their J region DNA 1. MRSA clones are commonly defined by incorporation of SCCmec typing information in conjunction with that provided by (gene/genomic) sequence-based typing methods, such as multilocus sequence typing (ST) and/or staphylococcal protein A gene (spa) typing (e.g. ST8-t008-MRSA-IVa). Therefore, SCCmec typing is a very important molecular tool for understanding the epidemiology and clonal strain relatedness of MRSA, particularly with the emerging outbreaks of community-associated MRSA (CA-MRSA) occurring on a worldwide basis.
Traditional PCR typing schemes classify SCCmec by targeting and identifying the individual mec and ccr gene complex types, but require the use of many (20 to 30) primer sets and multiple individual PCR experiments. Okuma et al., for example, employed 21 primers and many single target PCR reactions in detecting SCCmec I-IVb 3. Kondo et al. subsequently developed a more complete assay for identification of ccr, mec, and major differences in the J-regions, but it also required a large number of primers and multiple PCR reactions 4. To simplify SCCmec typing, multiplex PCR (M-PCR) assays were developed allowing samples to be processed in a single PCR reaction. De Lencastre and colleagues developed an M-PCR for quick screening of SCCmec I-IV, and later updated for SCCmec I-V, with a separate M-PCR for identifying SCCmec IV subtypes 5,6,7. However, these assays are more difficult to interpret, require 2 reactions in order to classify SCCmec IV subtypes, and result in several non-typeable subtypes. In an attempt to improve SCCmec typing, we designed and published a simple multiplex PCR assay for quick-screening of major SCCmec types and subtypes I to V 8, and later updated it as new sequence information became available 9. This simple assay targets individual SCCmec types in a single reaction, is easy to interpret and has been extensively used worldwide (337 from SCOPUS; updated Jan. 30, 2013). Since the original publication, we have received many requests for assistance from groups setting up this assay as part of their in-house MRSA SCCmec typing. Due to the sophisticated nature of the assay and the large number of primers present in the reaction, there is the potential for difficulties while adapting this assay to individual laboratories. To facilitate the process of establishing a MRSA SCCmec assay, we are going to demonstrate how to set up our M-PCR for SCCmec typing, as well as discuss some of the vital steps and procedural nuances that make it successful.

<table border="1">
		<tbody>
		 <tr>
			<td>Name of Reagent</td>
			<td>Company</td>
			<td>Catalogue Number</td>
		 </tr>
		 <tr>
			<td>Tryptic Soy Agar</td>
			<td>Fisher (BD)</td>
			<td>CA90002-700 (236920)</td>
		 </tr>
		 <tr>
			<td>Sterile distilled water</td>
			<td>Life Technologies</td>
			<td>10977-015</td>
		 </tr>
		 <tr>
			<td>Platinum Taq: including 10x PCR buffer and 50 mM MgCl2</td>
			<td>Life Technologies</td>
			<td>10966-034</td>
		 </tr>
		 <tr>
			<td>100 mM dNTP</td>
			<td>Life Technologies</td>
			<td>10297-018</td>
		 </tr>
		 <tr>
			<td>Tris base</td>
			<td>Sigma-Aldrich</td>
			<td>T6066</td>
		 </tr>
		 <tr>
			<td>Boric acid</td>
			<td>Sigma-Aldrich</td>
			<td>B7901</td>
		 </tr>
		 <tr>
			<td>EDTA</td>
			<td>Life Technologies</td>
			<td>15576-028</td>
		 </tr>
		 <tr>
			<td>Agarose</td>
			<td>Life Technologies</td>
			<td>16500-500</td>
		 </tr>
		 <tr>
			<td>Glycerol</td>
			<td>Life Technologies</td>
			<td>15514-011</td>
		 </tr>
		 <tr>
			<td>Bromophenol blue</td>
			<td>Sigma-Aldrich</td>
			<td>B8026</td>
		 </tr>
		 <tr>
			<td>1Kb+ DNA ladder</td>
			<td>Life Technologies</td>
			<td>10787-026</td>
		 </tr>
		 <tr>
			<td>Ethidium bromide</td>
			<td>Sigma-Aldrich</td>
			<td>E7637</td>
		 </tr>
		 <tr>
			<td>1.5ml Microcentrifuge tubes </td>
			<td>VWR (Axygen Scientific)</td>
			<td>10011-700 </td>
		 </tr>
		 <tr>
			<td>Culture sticks</td>
			<td>VWR</td>
			<td>CA10805-018</td>
		 </tr>
		 <tr>
			<td>PCR tubes</td>
			<td>Diamed</td>
			<td>AD0210-FCN (new #: DIATEC420-1250)</td>
		 </tr>
		 <tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5417c</td>
		 </tr>
		 <tr>
			<td>Heat block</td>
			<td>VWR</td>
			<td>13259-030 / 13259-286 </td>
		 </tr>
		 <tr>
			<td>Thermalcycler</td>
			<td>Applied Biosystems (2720)</td>
			<td>4359659 </td>
		 </tr>
		 <tr>
			<td>Horizontal, submersible gel electrophoresis chamber with gel mold</td>
			<td>BioRad</td>
			<td>170-4469</td>
		 </tr>
		 <tr>
			<td>Power supply</td>
			<td>BioRad</td>
			<td>164-5050</td>
		 </tr>
		 <tr>
			<td>Rocker shaker</td>
			<td>VWR</td>
			<td>40000-300 </td>
		 </tr>
		 <tr>
			<td>Molecular Imager Gel Doc System</td>
			<td>BioRad</td>
			<td>1708170 </td>
		 </tr>
		</tbody>
 </table>

multiplex pcr assay for typing of staphylococcal cassette chromosome mec types i to v in methicillin-resistant staphylococcus aureus

Staphylococcal Cassette Chromosome mec (SCCmec) typing is a very important molecular tool for understanding the epidemiology and clonal strain relatedness of methicillin-resistant Staphylococcus aureus (MRSA), particularly with the emerging outbreaks of community-associated MRSA (CA-MRSA) occurring on a worldwide basis. Traditional PCR typing schemes classify SCCmec by targeting and identifying the individual mec and ccr gene complex types, but require the use of many primer sets and multiple individual PCR experiments. We designed and published a simple multiplex PCR assay for quick-screening of major SCCmec types and subtypes I to V, and later updated it as new sequence information became available. This simple assay targets individual SCCmec types in a single reaction, is easy to interpret and has been extensively used worldwide. However, due to the sophisticated nature of the assay and the large number of primers present in the reaction, there is the potential for difficulties while adapting this assay to individual laboratories. To facilitate the process of establishing a MRSA SCCmec assay, here we demonstrate how to set up our multiplex PCR assay, and discuss some of the vital steps and procedural nuances that make it successful.

This updated M-PCR is able to determine (classify) SCCmec types I-V, as well major subtypes of SCCmec IV. The assay targets unique and specific loci of SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE and V, with concomitant mecA gene detection. Tentative identification of SCCmec VI and VIII is also possible, but would require further testing to confirm. Figure 3 illustrates representative SCCmec I-VI and VIII and the locations of each target within the ele...

Watch this Scientific Journal Video about Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus at JoVE.com

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Staphylococcal Cassette Chromosome mec (SCCmec) typing  is a very important molecular tool for understanding the epidemiology and  clonal strain ...

multiplex-pcr-assay-for-typing-staphylococcal-cassette-chromosome-mec

Research

JoVE Journal

Immunology and Infection

11.7K Views.  Alberta Health Services / Calgary Laboratory Services / University of Calgary. We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.