Funding for this research was provided by National Institutes of Health NIH-AR047410 (KEM)

This protocol follows the animal care guidelines of Oklahoma State University Center for Health Sciences IACUC (#2016-03).
1. Carrageenan-induced inflammation (C-II)
<ol>
	<li>Anesthetize male and/or female Sprague Dawley rats (200&#8211;250 g; 8&#8211;9 weeks old) with isoflurane (or injectable anesthetic).</li>
	<li>Check the depth of anesthesia by touching the cornea and lightly pinching the left hind paw. When the animal is appropriately anesthetized, no corneal or paw response will be observed.</li>
	<li>Subcutaneously inject the right glabrous, hind paw with 100 &#181;L of 1% (w/v) &#955;-carrageenan diluted in phosphate-buffered saline (PBS) and allow the rat to fully recover from anesthesia20.
	<ol>
		<li>Make sure that appropriate controls are used, such as na&#239;ve rats without isoflurane in this report. Preliminary studies indicate that na&#239;ve rats with or without isoflurane have the same basal expression of epidermal IL-6 and NGF. 
		NOTE: Na&#239;ve rats are preferred controls for inflammation studies since subcutaneous saline or PBS cause a local inflammation23,37.</li>
	</ol>
	</li>
	<li>At the 6-12 h time points, euthanize the rats with CO2 and measure hind paw metatarsal thickness with calipers. Cut 1 mm x 2 mm pieces of glabrous hind paw skin with a sharp scalpel. If there is hair&#160;on the skin, shave the area before cutting 1 mm x 2 mm pieces of skin. 
	NOTE: Make sure that the appropriate timepoints are chosen according to the specific studies.</li>
	<li>Using microdissection forceps, transfer the skin into 1 mL of cold Dulbecco&#39;s Modified Eagle Medium (DMEM) in a microcentrifuge tube on ice and keep cold for 15&#8211;60 min.</li>
</ol>
2. Thermolysin separation of epidermis and dermis
<ol>
	<li>Prepare and activate thermolysin.
	<ol>
		<li>Prepare a solution of thermolysin, by adding 5 mg of Geobacillus stearothermophilus to 10 mL of PBS, at pH = 8 (concentration 500 &#181;g/mL).</li>
		<li>Prepare a 1 M solution of calcium chloride (CaCl2 anhydrous) by adding 1.11 g into 10 mL of distilled H2O.</li>
		<li>To prevent autolysis of thermolysin, add 10 &#181;L of calcium chloride to 10 mL of thermolysin solution. The calcium chloride final concentration will be 1 mM.</li>
		<li>Aliquot 1 mL of activated thermolysin into 10 wells of a 24 well cell culture plate on ice.</li>
	</ol>
	</li>
	<li>Use thermolysin enzyme digestion to separate the epidermis from dermis.
	<ol>
		<li>Using microdissection forceps, transfer one skin sample into each well of activated thermolysin. Make sure not to immerse the skin in the thermolysin solution.</li>
		<li>Gently tap the skin on the side of the well to assist in releasing the skin sample from the forceps to float on the thermolysin solution.</li>
		<li>Float the skin into the thermolysin solution with the stratum corneum (outer epidermis) side up and dermis facing down. It is critical that the dermis faces down, or the effective separation will not take place. 
		NOTE: The amount of time for thermolysin incubation must be determined empirically by the end-user. Glabrous, hind paw skin from Sprague Dawley rats (200&#8211;250 g; 8&#8211;9 weeks old) often requires 2.0&#8211;2.5 h for separation. Incubation time is expected to vary with species and age.</li>
		<li>After the appropriate incubation time in thermolysin, use microdissection forceps to transfer one skin sample into a well of a 6 well cell culture plate with 7&#8211;8 mL of cold (4 &#176;C) DMEM. This allows more room for separation of the epidermis from the dermis.</li>
		<li>Immerse the skin into the DMEM.</li>
		<li>Gently brush the epidermis with the forceps around the perimeter of the skin until the near-translucent epidermis is observed at the borders. If this cannot be achieved, return the skin sample to the thermolysin solution for another 15&#8211;30 min.</li>
		<li>Once the epidermis noticeably separates from the dermis, then carefully hold both the epidermis and dermis with microdissection forceps and very slowly pull the epidermis from the dermis.</li>
		<li>Evaluate the translucence of the isolated epidermis and make sure it is optically consistent. See Figure 2 for an example of a 1 mm x 2 mm sample of rat epidermis. If there is a variation in the translucence, then proper separation has not occurred.</li>
	</ol>
	</li>
	<li>Inactivate thermolysin using ethylenediaminetetraacetic acid (EDTA) in the separated pieces of epidermis and dermis. 
	CAUTION: The thermolysin that remains in the epidermis and dermis is still active and can damage the layers if not inactivated.
	<ol>
		<li>Prepare a 0.5 M EDTA stock solution. To do so, slowly add 0.93 g EDTA into 5 mL of double-distilled water. Add sodium hydroxide to the solution until it clears. Ensure that the pH of the solution is ~8.0.</li>
		<li>Make a 5 mM EDTA solution in DMEM. Add 0.25 mL of 0.5 M EDTA stock solution to 25 mL of DMEM.</li>
		<li>Place the separated epidermis and dermis into the 5 mM EDTA/DMEM solution at 4 &#176;C for 30 min to deactivate thermolysin&#8217;s activity.</li>
	</ol>
	</li>
	<li>Evaluate the epidermis with tinctorial histology8,9,10.
	<ol>
		<li>Fix a portion of the epidermis in a 10% neutral formalin, 4% paraformaldehyde, or 0.25% paraformaldehyde with 0.8% picric acid solution for 1 h at room temperature (RT) with agitation.</li>
		<li>Place the fixed epidermis in 10% sucrose in PBS for 1 h at RT with agitation.</li>
		<li>Freeze the epidermis in a tissue embedding matrix for sectioning. Cut 14 &#181;m cross-sections using a cryostat and thaw-mount sections onto gelatin-coated glass microscope slides.</li>
		<li>Dry sections on a slide warmer and stain with a working solution of toluidine blue (TB; 10% TB in 1% sodium chloride) for 90 s. Appose coverslips with an aqueous mounting medium.</li>
		<li>Observe the epidermis with brightfield microscopy at 50x&#8211;250x. 
		NOTE: If proper separation has occurred, the epidermis will be divided cleanly from the dermis and the five layers will be detected: stratum basale, stratum spinosum, stratum granulosum, stratum lucidum, and stratum corneum. An example of separated rat skin epidermis can be seen in Figure 3.</li>
	</ol>
	</li>
</ol>
3. Protein extraction and western blot analysis
<ol>
	<li>Perform western blotting on the separated tissue samples using previously published protocol21.</li>
	<li>Homogenize the epidermis in 50 &#956;L of lysis buffer (25mM Tris HCl, pH = 7.4, 150 mM NaCl, 1 mM EDTA, 5% glycerol, and 1% Triton X-100) containing a phosphatase and protease inhibitor cocktail.</li>
	<li>Centrifuge samples at a max speed for 15 min at 4 &#176;C and evaluate the supernatant for protein concentration using a protein assay kit.</li>
	<li>Load equal concentrations of protein (30 &#181;g) onto SDS gels, perform electrophoresis, and then transfer proteins to nitrocellulose or PVDF membranes.</li>
	<li>Block membranes with 5% milk for 2 h and incubate overnight in primary antibody (mouse anti-NGF, E12, 1:1000).</li>
	<li>Wash 3x with PBS with 0.3% tween for 10 min each and incubate with a labeled secondary antibody (e.g., alkaline phosphatase labeled rabbit anti-mouse IgG).</li>
	<li>Use a scanning system to evaluate western blot signal (e.g., ECF substrate and an imaging platform).</li>
</ol>
4. Immunohistochemistry
<ol>
	<li>Place tissue samples in a fixative for optimal immunoreactivity: 0.96% (w/v) picric acid and 0.2% (w/v) formaldehyde in 0.1 M sodium phosphate buffer, pH = 7.321,22,23 for 4 h at RT. Transfer to 10% sucrose in PBS overnight at 4 &#176;C.</li>
	<li>Perform standard immunohistochemistry on the tissue sections21,22,23.</li>
	<li>Embed the epidermis from animals into a single frozen block in embedding matrix and cut 10&#8211;30 &#181;m sections on a cryostat. Mount the sections on gelatin-coated, glass microscope slides and dry at 37 &#176;C for 2 h.</li>
	<li>Wash sections for three, 10 min rinses in PBS and incubate for 24&#8211;96 h in primary antisera, [e.g., mouse anti-NGF (E12, 1:2000)] and rabbit anti-protein gene product 9.9 (PGP 9.5, 1:2000) diluted in PBS containing 0.3% (w/v) Triton X-100 (PBS-T) PBS-T with 0.5% bovine serum albumin (BSA) and 0.5% polyvinylpyrrolidone (PVP).</li>
	<li>After primary antiserum incubation, rinse sections three times for 10 min in PBS and incubate 1 h at RT in Alexa Fluor 488 donkey anti-rabbit IgG (1:1000) and Alexa Fluor 555 donkey anti-mouse IgG (1:1000) diluted in PBS-T.</li>
	<li>Rinse sections three times in PBS for 10 min and affix coverslips with non-fading mounting medium to retard fading of immunofluorescence.</li>
</ol>
5. RNA isolation and cDNA synthesis
<ol>
	<li>Perform standard reverse transcriptase polymerase chain reaction (RT-PCR) on the skin samples21. Isolate total RNA using a phenol, guanidine isothiocyanate solution.</li>
	<li>Carry out complementary DNA synthesis by Moloney murine leukemia virus reverse transcriptase.</li>
	<li>Use the following primer sequences for NGF and IL-6 amplification: 
	NGF (Sense) - GTGGACCCCAAACTGTTTAAGAAACGG 
	NGF (Antisense) &#8211; GTGAGTCCTGTTGAAGGAGATTGTACCATG 
	IL-6 (Sense) - GCAATTCTGATTGTATGAACAGCGATGATGC; 
	IL-6 (Antisense) &#8211; GTAGAAACGGAACTCCAGAAGACCAGAG</li>
	<li>Compare the levels of NGF and IL-6 mRNA to &#946;-actin housekeeping gene: 
	&#946;-ACTIN (Sense) - TGCGTGACATTAAAGAGAAGCTGTGCTATG 
	&#946;-ACTIN (Antisense) &#8211; GAACCGCTCATTGCCGATAGTGATGA</li>
	<li>Evaluate with qualitative RT-PCR using thermal cycler and quantitative real-time PCR (qRT-PCR) using a qRT-PCR system.</li>
</ol>

<ol><li>Choi, J. E., Di Nardo, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Skin+neurogenic+inflammation%5BTitle%5D)+AND+%22Seminars+in+Immunopathology%22%5BJournal%5D)">Skin neurogenic inflammation.</a> Seminars in Immunopathology. 40 (3), 249-259 (2018).</li>
<li>Manti, S., Brown, P., Perez, M. K., Piedimonte, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+role+of+neurotrophins+in+inflammation+and+allergy%5BTitle%5D)+AND+%22Vitamins+and+Hormones%22%5BJournal%5D)">The role of neurotrophins in inflammation and allergy.</a> Vitamins and Hormones. 104, 313-341 (2017).</li>
<li>Schäkel, K., Schön, M. P., Ghoreschi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pathogenesis+of+psoriasis%5BTitle%5D)+AND+%22Zeitschrift+f%C3%BCr+Dermatologie%2C+Venerologie%2C+und+verwandte+Gebiete%22%5BJournal%5D)">Pathogenesis of psoriasis.</a> Zeitschrift für Dermatologie, Venerologie, und verwandte Gebiete. 67 (6), 422-431 (2016).</li>
<li>Zou, Y., Maibach, H. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dermal-epidermal+separation+methods%3A+research+implications%5BTitle%5D)+AND+%22Archives+of+Dermatological+Research%22%5BJournal%5D)">Dermal-epidermal separation methods: research implications.</a> Archives of Dermatological Research. 310 (1), 1-9 (2018).</li>
<li>Baumberger, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Methods+for+the+separation+of+epidermis+from+dermis+and+some+physiologic+and+chemical+properties+of+isolated+epidermis%5BTitle%5D)+AND+%22Journal+of+the+National+Cancer+Institute%22%5BJournal%5D)">Methods for the separation of epidermis from dermis and some physiologic and chemical properties of isolated epidermis.</a> Journal of the National Cancer Institute. 2, 413-423 (1942).</li>
<li>Felsher, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Studies+on+the+adherence+of+the+epidermis+to+the+corium%5BTitle%5D)+AND+%22Journal+of+Investigative+Dermatology%22%5BJournal%5D)">Studies on the adherence of the epidermis to the corium.</a> Journal of Investigative Dermatology. 8, 35-47 (1947).</li>
<li>Einbinder, J. M., Walzer, R. A., Mandl, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Epidermal-dermal+separation+with+proteolytic+enzymes%5BTitle%5D)+AND+%22Journal+of+Investigative+Dermatology%22%5BJournal%5D)">Epidermal-dermal separation with proteolytic enzymes.</a> Journal of Investigative Dermatology. 46, 492-504 (1966).</li>
<li>Rakhorst, H. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mucosal+keratinocyte+isolation%3A+a+short+comparative+study+on+thermolysin+and+dispase%5BTitle%5D)+AND+%22International+Association+of+Oral+and+Maxillofacial+Surgeons%22%5BJournal%5D)">Mucosal keratinocyte isolation: a short comparative study on thermolysin and dispase.</a> International Association of Oral and Maxillofacial Surgeons. 35 (10), 935-940 (2006).</li>
<li>Tschachler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sheet+preparations+expose+the+dermal+nerve+plexus+of+human+skin+and+render+the+dermal+nerve+end+organ+accessible+to+extensive+analysis%5BTitle%5D)+AND+%22Journal+of+Investigative+Dermatology%22%5BJournal%5D)">Sheet preparations expose the dermal nerve plexus of human skin and render the dermal nerve end organ accessible to extensive analysis.</a> Journal of Investigative Dermatology. 122 (1), 177-182 (2004).</li>
<li>Walzer, C., Benathan, M., Frenk, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Thermolysin+treatment-a+new+method+for+dermo-epidermal+separation%5BTitle%5D)+AND+%22Journal+of+Investigative+Dermatology%22%5BJournal%5D)">Thermolysin treatment-a new method for dermo-epidermal separation.</a> Journal of Investigative Dermatology. 92, 78-81 (1989).</li>
<li>Anderson, M. B., Miller, K. E., Schechter, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+of+rat+epidermis+and+dermis+following+thermolysin+separation%3A+PGP+9.5+and+Nav+1.8+localization%5BTitle%5D)+AND+%22Society+for+Neuroscience+Abstract%22%5BJournal%5D)">Evaluation of rat epidermis and dermis following thermolysin separation: PGP 9.5 and Nav 1.8 localization.</a> Society for Neuroscience Abstract. 584 (9), (2010).</li>
<li>Ibitokun, B. O., Anderson, M. B., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Separation+of+corneal+epithelium+from+the+stroma+using+thermolysin%3A+evaluation+of+corneal+afferents%5BTitle%5D)+AND+%22Society+for+Neuroscience+Abstract%22%5BJournal%5D)">Separation of corneal epithelium from the stroma using thermolysin: evaluation of corneal afferents.</a> Society for Neuroscience Abstract. , 584(2010).</li>
<li>Nawani, P., Anderson, M., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Structure-property+relationship+of+skin%5BTitle%5D)+AND+%22Oklahoma+Center+for+Neuroscience+Symposium+Abstract%22%5BJournal%5D)">Structure-property relationship of skin.</a> Oklahoma Center for Neuroscience Symposium Abstract. , # 17 (2011).</li>
<li>Anderson, M. B., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Intra-epidermal+nerve+fiber+reconstruction+and+quantification+in+three-dimensions%5BTitle%5D)+AND+%22Society+for+Neuroscience+Abstract%22%5BJournal%5D)">Intra-epidermal nerve fiber reconstruction and quantification in three-dimensions.</a> Society for Neuroscience Abstract. 220, 23(2017).</li>
<li>Gujar, V. K. E., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Expression+of+nerve+growth+factor+in+adjuvant-induced+arthritis+%28AIA%29%3A+A+temporal+study%5BTitle%5D)+AND+%22Society+for+Neuroscience+Abstract%22%5BJournal%5D)">Expression of nerve growth factor in adjuvant-induced arthritis (AIA): A temporal study.</a> Society for Neuroscience Abstract. 220, 23(2017).</li>
<li>Vinegar, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((to+carrageenan-induced+inflammation+in+the+hind+limb+of+the+rat%5BTitle%5D)+AND+%22Federation+Proceedings%22%5BJournal%5D)">to carrageenan-induced inflammation in the hind limb of the rat.</a> Federation Proceedings. 46 (1), 118-126 (1987).</li>
<li>Fehrenbacher, J. C., Vasko, M. R., Duarte, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Models+of+inflammation%3A+Carrageenan-+or+complete+Freund%27s+Adjuvant+%28CFA%29-induced+edema+and+hypersensitivity+in+the+rat%5BTitle%5D)+AND+%22Current+Protocols+in+Pharmacology%22%5BJournal%5D)">Models of inflammation: Carrageenan- or complete Freund's Adjuvant (CFA)-induced edema and hypersensitivity in the rat.</a> Current Protocols in Pharmacology. , Chapter 5, Unit 5.4 (2012).</li>
<li>Li, K. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((exerts+its+anti-inflammatory+effects+associated+with+suppressing+ERK%2Fp38+MAPK+and+Heme+Oxygenase-1+activation+in+lipopolysaccharide-stimulated+RAW+264.7+macrophages+and+carrageenan-induced+mice+paw+edema%5BTitle%5D)+AND+%22International+Immunopharmacology%22%5BJournal%5D)">exerts its anti-inflammatory effects associated with suppressing ERK/p38 MAPK and Heme Oxygenase-1 activation in lipopolysaccharide-stimulated RAW 264.7 macrophages and carrageenan-induced mice paw edema.</a> International Immunopharmacology. 54, 366-374 (2018).</li>
<li>Sammons, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Carrageenan-induced+thermal+hyperalgesia+in+the+mouse%3A+role+of+nerve+growth+factor+and+the+mitogen-activated+protein+kinase+pathway%5BTitle%5D)+AND+%22Brain+Research%22%5BJournal%5D)">Carrageenan-induced thermal hyperalgesia in the mouse: role of nerve growth factor and the mitogen-activated protein kinase pathway.</a> Brain Research. 876 (1-2), 48-54 (2000).</li>
<li>Hoffman, E. M., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Peripheral+inhibition+of+glutaminase+reduces+carrageenan+induced+Fos+expression+in+the+superficial+dorsal+horn+of+the+rat%5BTitle%5D)+AND+%22Neuroscience+Letters%22%5BJournal%5D)">Peripheral inhibition of glutaminase reduces carrageenan induced Fos expression in the superficial dorsal horn of the rat.</a> Neuroscience Letters. 472 (3), 157-160 (2010).</li>
<li>Crosby, H. A., Ihnat, M., Spencer, D., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Expression+of+glutaminase+and+vesicular+glutamate+transporter+type+2+immunoreactivity+in+rat+sacral+dorsal+root+ganglia+following+a+surgical+tail+incision%5BTitle%5D)+AND+%22Pharmacy+and+Pharmacology+International+Journal%22%5BJournal%5D)">Expression of glutaminase and vesicular glutamate transporter type 2 immunoreactivity in rat sacral dorsal root ganglia following a surgical tail incision.</a> Pharmacy and Pharmacology International Journal. 2 (3), 00023(2015).</li>
<li>Hoffman, E. M., Schechter, R., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Fixative+composition+alters+distributions+of+immunoreactivity+for+glutaminase+and+two+markers+of+nociceptive+neurons+Nav1.8+and+TRPV1%2C+in+the+rat+dorsal+ganglion%5BTitle%5D)+AND+%22Journal+of+Histochemistry+and+Cytochemistry%22%5BJournal%5D)">Fixative composition alters distributions of immunoreactivity for glutaminase and two markers of nociceptive neurons Nav1.8 and TRPV1, in the rat dorsal ganglion.</a> Journal of Histochemistry and Cytochemistry. 58 (4), 329-344 (2010).</li>
<li>Hoffman, E. M., Zhang, Z., Schechter, R., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Glutaminase+increases+in+rat+dorsal+root+ganglion+neurons+after+unilateral+adjuvant-induced+hind+paw+inflammation%5BTitle%5D)+AND+%22Biomolecules%22%5BJournal%5D)">Glutaminase increases in rat dorsal root ganglion neurons after unilateral adjuvant-induced hind paw inflammation.</a> Biomolecules. 6 (1), 10(2016).</li>
<li>van den Burg, B., Eijsink, V. Thermolysin and related Bacillus metallopeptidases. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3avan+den+Burg%2C+B+%22Handbook+of+Proteolytic+Enzymes%22">Handbook of Proteolytic Enzymes</a>. , Volume 1, Chapter 111 540-553 (2013).</li>
<li>Matthews, B. W. Thermolysin. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aMatthews%2C+BW+%22Encyclopedia+of+Inorganic+and+Bioinorganic+Chemistry%22">Encyclopedia of Inorganic and Bioinorganic Chemistry</a>. , (2011).</li>
<li>Hybbinette, S., Boström, M., Lindberg, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Enzymatic+dissociation+of+keratinocytes+from+human+skin+biopsies+for+in+vitro+cell+propagation%5BTitle%5D)+AND+%22Experimental+Dermatology%22%5BJournal%5D)">Enzymatic dissociation of keratinocytes from human skin biopsies for in vitro cell propagation.</a> Experimental Dermatology. 8 (1), 30-38 (1999).</li>
<li>Glade, C. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Multiparameter+flow+cytometric+characterization+of+epidermal+cell+suspensions+prepared+from+normal+and+hyperproliferative+human+skin+using+an+optimized+thermolysin-trypsin+protocol%5BTitle%5D)+AND+%22Archives+of+Dermatological+Research%22%5BJournal%5D)">Multiparameter flow cytometric characterization of epidermal cell suspensions prepared from normal and hyperproliferative human skin using an optimized thermolysin-trypsin protocol.</a> Archives of Dermatological Research. 288 (4), 203-210 (1996).</li>
<li>Sato, J. D., Kan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Media+for+culture+of+mammalian+cells%5BTitle%5D)+AND+%22Current+Protocols+in+Cell+Biology%22%5BJournal%5D)">Media for culture of mammalian cells.</a> Current Protocols in Cell Biology. , Chapter 1: Unit 1.2 (2001).</li>
<li>Gragnani, A., Sobral, C. S., Ferreira, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Thermolysin+in+human+cultured+keratinocyte+isolation%5BTitle%5D)+AND+%22Brazilian+Journal+of+Biology%22%5BJournal%5D)">Thermolysin in human cultured keratinocyte isolation.</a> Brazilian Journal of Biology. 67 (1), 105-109 (2007).</li>
<li>Germain, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improvement+of+human+keratinocyte+isolation+and+culture+using+thermolysin%5BTitle%5D)+AND+%22Burns%22%5BJournal%5D)">Improvement of human keratinocyte isolation and culture using thermolysin.</a> Burns. 19 (2), 99-104 (1993).</li>
<li>Michel, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Characterization+of+a+new+tissue-engineered+human+skin+equivalent+with+hair%5BTitle%5D)+AND+%22In+Vitro+Cellular+%26+Developmental+Biology.+Animal%22%5BJournal%5D)">Characterization of a new tissue-engineered human skin equivalent with hair.</a> In Vitro Cellular & Developmental Biology. Animal. 35 (6), 318-326 (1999).</li>
<li>Fassina, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Autolysis+of+thermolysin.+Isolation+and+characterization+of+a+folded+three-fragment+complex%5BTitle%5D)+AND+%22European+Journal+of+Biochemistry%22%5BJournal%5D)">Autolysis of thermolysin. Isolation and characterization of a folded three-fragment complex.</a> European Journal of Biochemistry. 156 (2), 221-228 (1986).</li>
<li>Petho, G., Reeh, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Sensory+and+signaling+mechanisms+of+bradykinin%2C+eicosanoids%2C+platelet-activating+factor%2C+and+nitric+oxide+in+peripheral+nociceptors%5BTitle%5D)+AND+%22Physiological+Reviews%22%5BJournal%5D)">Sensory and signaling mechanisms of bradykinin, eicosanoids, platelet-activating factor, and nitric oxide in peripheral nociceptors.</a> Physiological Reviews. 92 (4), 1699-1775 (2012).</li>
<li>Djouhri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Time+course+and+nerve+growth+factor+dependence+of+inflammation-induced+alterations+in+electrophysiological+membrane+properties+in+nociceptive+primary+afferent+neurons%5BTitle%5D)+AND+%22Journal+of+Neuroscience%22%5BJournal%5D)">Time course and nerve growth factor dependence of inflammation-induced alterations in electrophysiological membrane properties in nociceptive primary afferent neurons.</a> Journal of Neuroscience. 21 (22), 8722-8733 (2001).</li>
<li>Denk, F., Bennett, D. L., McMahon, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Nerve+growth+factor+and+pain+mechanisms%5BTitle%5D)+AND+%22Annual+Review+of+Neuroscience%22%5BJournal%5D)">Nerve growth factor and pain mechanisms.</a> Annual Review of Neuroscience. 40, 307-325 (2017).</li>
<li>Flint, M. S., Dearman, R. J., Kimber, I., Hotchkiss, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+and+in+situ+localization+of+cutaneous+tumour+necrosis+factor+alpha+%28TNF-alpha%29+and+interleukin+6+%28IL-6%29+following+skin+sensitization%5BTitle%5D)+AND+%22Cytokine%22%5BJournal%5D)">Production and in situ localization of cutaneous tumour necrosis factor alpha (TNF-alpha) and interleukin 6 (IL-6) following skin sensitization.</a> Cytokine. 10 (3), 213-219 (1998).</li>
<li>Crosby, H. A., Ihnat, M., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluating+the+toxicity+of+the+analgesic+glutaminase+inhibitor+6-diazo-5-oxo-L-norleucine+in+vitro+and+on+rat+dermal+skin+fibroblasts%5BTitle%5D)+AND+%22MOJ+Toxicology%22%5BJournal%5D)">Evaluating the toxicity of the analgesic glutaminase inhibitor 6-diazo-5-oxo-L-norleucine in vitro and on rat dermal skin fibroblasts.</a> MOJ Toxicology. 1 (1), 00005(2015).</li>
</ol>

The authors have no disclosures.

The study determined that the epidermis of rat hind paw glabrous skin was easily separated from dermis using thermolysin (0.5 mG/mL) in PBS with 1 mM calcium chloride at 4 &deg;C for 2.5 h. Histological evaluation indicated that the epidermis was separated from the dermis at the basement membrane and that the epidermal rete ridges were intact. Thermolysin is an extracellular metalloendopeptidase produced by Gram-positive (Geo)Bacillus thermoproteolyticus24. Its activity is stable...

Evaluation of inflammatory mediators and neurotrophic factors from the skin can be limited due to the heterogeneity of cell types found in the inflamed dermis and epidermis1,2,3. Several enzymes, chemical, thermal, or mechanical techniques involving separation of the two layers or for performing cell dissociation for evaluation have been reviewed recently4. Acid, alkali, neutral salt, and heat can divide the epidermis from dermis quickly, but cellular and extracellular swelling often occurs5,6. Trypsin, pancreatin, elastase, keratinase, collagenase, pronase, dispase, and thermolysin are enzymes that have been used for epidermal-dermal separation4,7. Trypsin and other broad scale proteolytic enzymes are active at 37&ndash;40 &deg;C but must be monitored carefully to prevent dissociation of epidermal layers. Dispase cleaves the epidermis at the lamina densa, but requires 24 h for separation in the cold4,8 or shorter timepoints at 37 &deg;C4,9. A limiting feature of all these techniques is the potential disruption of tissue morphology and loss of integrity of mRNA and protein.
To maintain the integrity of mRNA and protein, a skin separation method should be carried out in the cold for a short period of time. In evaluating skin separation techniques for inflammation studies, thermolysin is an effective enzyme to separate the epidermis from dermis at cold temperatures4. Thermolysin is active at 4 &deg;C, cleaves epidermal hemidesmosomes from the lamina lucida, and separates the epidermis from dermis within 1&ndash;3 h4,8,10. The goal of this report is to optimize the use of thermolysin for separation of inflamed rat epidermis from dermis to detect mRNA and protein levels for inflammatory mediators and neurotrophic factors. Several preliminary reports have been presented11,12,13,14,15. The objective of this manuscript is to describe an optimal skin separation technique using thermolysin and demonstrate the detection of 1) markers of inflammation, 2) interleukin-6 (IL-6) mRNA, and 3) nerve growth factor (NGF) mRNA and protein in the epidermis of rats with carrageenan-induced inflammation (C-II)16,17. A preliminary report using the complete Freund&rsquo;s adjuvant model indicates that NGF mRNA and protein levels increase early during inflammation15. In mice, skin sensitization with the topical application of oxazolone causes an early rise in the IL-6 mRNA using in situ hybridization36. Both IL-6 and NGF have been implicated in C-II18,19, but there have been no reports describing mRNA or protein levels for IL-6 or NGF specifically from the epidermis during the acute stages of C-II.
The thermolysin technique is inexpensive and straightforward to perform. Furthermore, thermolysin separation of the epidermis from dermis allows for mRNA, western blot, and immunohistochemical analysis of inflammatory mediators and neurotrophic factors during the process of inflammation15. Investigators should be able to easily use this technique in both preclinical and clinical studies of skin inflammation.

<table><tbody><tr><td>&amp;lambda;-carrageenan</td><td>Millipore Sigma</td><td>22049</td><td>Subcutaneous injection of carrageenan induces inflammation</td></tr><tr><td>7500 Fast Real-Time PCR System</td><td>Thermo Fisher Scientific</td><td>4351107</td><td>For RT-PCR analysis</td></tr><tr><td>Calcium chloride (CaCl2), anhydrous</td><td>Millipore Sigma</td><td>499609</td><td>Prevents autolysis of thermolysin</td></tr><tr><td>Crystal Mount Aqueous Mounting Medium</td><td>Millipore Sigma</td><td>C0612</td><td>Aqueous mounting medium after toluidine blue staining</td></tr><tr><td>Donkey anti-Mouse Alexa Fluor 555</td><td>Thermo Fisher Scientific</td><td>A-31570</td><td>Secondary antibody for immunohistochemistry</td></tr><tr><td>Donkey anti-Rabbit IgG, Alexa Fluor 488</td><td>Thermo Fisher Scientific</td><td>A-21206</td><td>Secondary antibody for immunohistochemistry</td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium</td><td>Thermo Fisher Scientific</td><td>11966-025</td><td>To maintain tissue integrity</td></tr><tr><td>Ethylenediaminetetraacetic acid</td><td>Millipore Sigma</td><td>E6758</td><td>Stops thermolysin reaction</td></tr><tr><td>Moloney Murine Leukemia Virus (M-MLV) Reverse transcriptase</td><td>Promega</td><td>M1701</td><td>For complementary DNA synthesis</td></tr><tr><td>Mouse anti-NGF Antibody (E-12)</td><td>Santa Cruz Biotechnology</td><td>sc-365944</td><td>For neurotrophin immunohistochemistry</td></tr><tr><td>ProLong Gold Antifade Mountant</td><td>Thermo Fisher Scientific</td><td>P36930</td><td>To retard immunofluorescence quenching</td></tr><tr><td>Rabbit anti-PGP 9.5</td><td>Cedarlane Labs</td><td>CL7756AP</td><td>For intraepidermal nerve staining</td></tr><tr><td>SAS Sprague Dawley Rat</td><td>Charles River</td><td>Strain Code 400</td><td>Animal used for inflammation studies</td></tr><tr><td>Shandon M-1 Embedding Matrix</td><td>Thermo Fisher Scientific</td><td>1310TS</td><td>Tissue embedding matrix for tinctorial- and immuno-histochemistry</td></tr><tr><td>SimpliAmp Thermal Cycler</td><td>Thermo Fisher Scientific</td><td>A24811</td><td>For RT-PCR analysis</td></tr><tr><td>SYBR Select Master Mix</td><td>Thermo Fisher Scientific</td><td>4472908</td><td>For RT-PCR analysis</td></tr><tr><td>Thermolysin</td><td>Millipore Sigma</td><td>T7902</td><td>From Geobacillus stearothermophilus</td></tr><tr><td>Toluidine Blue</td><td>Millipore Sigma</td><td>89640</td><td>For tinctorial staining for brightfield microscopy</td></tr><tr><td>TRIzol Reagent</td><td>Thermo Fisher Scientific</td><td>15596026</td><td>For total RNA extraction for RTPCR</td></tr></tbody></table>

separation of rat epidermis and dermis with thermolysin to detect site-specific inflammatory mrna and protein

Easy-to-use and inexpensive techniques are needed to determine the site-specific production of inflammatory mediators and neurotrophins during skin injury, inflammation, and/or sensitization. The goal of this study is to describe an epidermal-dermal separation protocol using thermolysin, a proteinase that is active at 4 &deg;C. To illustrate this procedure, Sprague Dawley rats are anesthetized, and right hind paws are injected with carrageenan. Six and twelve hours after injection, rats with inflammation and na&iuml;ve rats are euthanized, and a piece of hind paw, glabrous skin is placed in cold Dulbecco's Modified Eagle Medium. The epidermis is then separated at the basement membrane from the dermis by thermolysin in PBS with calcium chloride. Next, the dermis is secured by microdissection forceps, and the epidermis is gently teased away. Toluidine blue staining of tissue sections show that the epidermis is separated cleanly from the dermis at the basement membrane. All keratinocyte cell layers remain intact, and the epidermal rete ridges along with indentations from dermal papillae are clearly observed. Qualitative and real-time RT-PCR is used to determine nerve growth factor and interleukin-6 expression levels. Western blotting and immunohistochemistry are finally performed to detect amounts of nerve growth factor. This report illustrates that cold thermolysin digestion is an effective method to separate epidermis from dermis for evaluation of mRNA and protein alterations during inflammation.

Carrageenan injection into the rat hind paw caused classic symptoms of inflammation such as redness and edema16,17. The swelling of the hind paw was measured with mechanical calipers20. A baseline value of the thickness of the paw was obtained for each rat before carrageenan treatment and measured again at 6 h and 12 h. Paw thickness was increased significantly compared to the baseline values (Figure 1).
<...

Watch this Scientific Journal Video about Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein at JoVE.com

Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein

Presented here is a protocol for the separation of epidermis from dermis to evaluate inflammatory mediator production. Following inflammation, rat hind paw epidermis is separated from the dermis by thermolysin at 4 &#176;C. The epidermis is then used for mRNA analysis by RT-PCR and protein evaluation by western blot and immunohistochemistry.

Easy-to-use and inexpensive techniques are needed to determine the site-specific production of inflammatory mediators and neurotrophins during skin ...

separation-rat-epidermis-dermis-with-thermolysin-to-detect-site

Research

JoVE Journal

Immunology and Infection

5.2K Views.  Oklahoma State University Center for Health Sciences. Ons protocol is een gebruiksvriendelijke en goedkope epidermale-huidscheidingstechniek voor het bepalen van de plaatsspecifieke productie van ontstekingsmediators en neurotrofinen tijdens huidontsteking. Het belangrijkste voordeel van deze techniek is dat enzymatische scheiding van de epidermis van de dermis wordt uitgevoerd bij vier graden Celsius, waardoor de integriteit van mRNA en eiwit behouden blijft. Deze methode geeft inzicht in de soorten mediatoren die primaire afferente terminals s...

Video: Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein

Isolation of Papillary and Reticular Fibroblasts from Human Skin by Fluorescence-activated Cell Sorting

Fibroblasts are a highly heterogeneous cell population implicated in the pathogenesis of many human diseases. In human skin dermis, fibroblasts have traditionally been attributed to the superficial papillary or lower reticular dermis according to their histological localization. In mouse dermis, papillary and reticular fibroblasts originate from two different lineages with diverging functions regarding physiological and pathological processes and a distinct cell surface marker expression profile by which they can be distinguished.
Importantly, evidence from explant cultures from superficial and lower dermal layers suggest that at least two functionally distinct dermal fibroblasts lineages exist in human skin dermis as well. However, unlike for mouse skin, cell surface markers enabling the discrimination of different fibroblast subsets have not yet been established for human skin. We developed a novel protocol for the isolation of human papillary and reticular fibroblast populations via fluorescence-activated cell sorting (FACS) using the two cell surface markers Fibroblast Activation Protein (FAP) and Thymocyte antigen 1 (Thy1)/CD90. This method enables the isolation of pure fibroblast subsets without in vitro manipulation, which was shown to affect gene expression, thus permitting accurate functional analysis of human dermal fibroblast subsets in regard to tissue homeostasis or disease pathology.

This manuscript describes a FACS-based protocol for isolation of papillary and reticular fibroblasts from human skin. It circumvents in vitro culture which was inevitable with the commonly used isolation protocol via explant cultures. The emanating fibroblast subsets are functionally distinct and display differential gene expression and localization within the dermis.

Fibroblasts are a highly heterogeneous cell population implicated in the pathogenesis of many human diseases. In human skin dermis, fibroblasts have ...

Genetics

Rat Mammary Epithelial Cell Transplantation into the Interscapular White Fat Pad

As early as the 1970s, researchers have successfully transplanted mammary epithelial cells into the interscapular white fat pad of rats. Grafting mammary epithelium using transplantation techniques takes advantage of the hormonal environment provided by the adolescent rodent host. These studies are ideally suited to explore the impact of various biological manipulations on mammary gland development and dissect many aspects of mammary gland biology. A common, but limiting, feature is that transplanted epithelial cells are strongly influenced by the surrounding stroma and outcompeted by endogenous epithelium; to utilize native mammary tissue, the abdominal-inguinal white fat pad must be cleared to remove host mammary epithelium prior to the transplantation. A major obstacle when using the rat model organism is that clearing the developing mammary tree in post-weaned rats is not efficient. When transplanted into gland-free fat pads, donor epithelial cells can repopulate the cleared host fat pad and form a functional mammary gland. The interscapular fat pad is an alternative location for these grafts. A major advantage is that it lacks ductal structures yet provides the normal stroma that is necessary to promote epithelial outgrowth and is easily accessible in the rat. Another major advantage of this technique is that it is minimally invasive, because it eliminates the need to cauterize and remove the growing endogenous mammary tree. Additionally, the interscapular fat pad contains a medial blood vessel that can be used to separate sites for grafting. Because the endogenous glands remain intact, this technique can also be used for studies comparing the endogenous mammary gland to the transplanted gland. This paper describes the method of mammary epithelial cell transplantation into the interscapular white fat pad of rats.

This article describes a transplantation method to graft donor rat mammary epithelial cells into the interscapular white fat pad of recipient animals. This method can be used to examine host and/or donor effects on mammary epithelium development and eliminates the need for pre-clearing, thereby extending the usefulness of this technique.

As early as the 1970s, researchers have successfully transplanted mammary epithelial cells into the interscapular white fat pad of rats. Grafting mammary ...

Cancer Research

Preparation of Single-cell Suspensions for Cytofluorimetric Analysis from Different Mouse Skin Regions

The skin is a barrier organ that interacts with the external environment. Being continuously exposed to potential microbial invasion, the dermis and epidermis home a variety of immune cells in both homeostatic and inflammatory conditions. Tools to obtain skin cell release for cytofluorimetric analyses are, therefore, very useful in order to study the complex network of immune cells residing in the skin and their response to microbial stimuli. Here, we describe an efficient methodology for the digestion of mouse skin to rapidly and efficiently obtain single-cell suspensions. This protocol allows maintenance of maximum cell viability without compromising surface antigen expression. We also describe how to take and digest skin samples from different anatomical locations, such as the ear, trunk, tail, and footpad. The obtained suspensions are then stained and analyzed by flow cytometry to discriminate between different leukocyte populations.

The skin is home to a complex immune cell network. We describe an efficient methodology for the digestion of mouse skin, from different parts of the animal's body, in order to obtain a single-cell suspension and analyze the different leukocyte populations resident in the skin by flow cytometry.

The skin is a barrier organ that interacts with the external environment. Being continuously exposed to potential microbial invasion, the dermis and ...

Isolation of Infiltrating Leukocytes from Mouse Skin Using Enzymatic Digest and Gradient Separation

Dissociating murine skin into a single cell suspension is essential for downstream cellular analysis such as the characterization of infiltrating immune cells in rodent models of skin inflammation. Here, we describe a protocol for the digestion of mouse skin in a nutrient-rich solution with collagenase D, followed by separation of hematopoietic cells using a discontinuous density gradient. Cells thus obtained can be used for in vitro studies, in vivo transfer, and other downstream cellular and molecular analyses including flow cytometry. This protocol is an effective and economical alternative to expensive mechanical dissociators, specialized separation columns, and harsher trypsin- and dispase-based digestion methods, which may compromise cellular viability or density of surface proteins relevant for phenotypic characterization or cellular function. As shown here in our representative data, this protocol produced highly viable cells, contained specific immune cell subsets, and had no effect on integrity of common surface marker proteins used in flow cytometric analysis.

This protocol describes enzymatic digestion of mouse skin in nutrient-rich medium followed by gradient separation to isolate leukocytes. Cells thus derived can be used for diverse downstream applications. This is an effective, economical, and improved alternative to tissue dissociation machines and harsher trypsin and dispase-based tissue digestion protocols.

Dissociating murine skin into a single cell suspension is essential for downstream cellular analysis such as the characterization of infiltrating immune ...

Rat Mesentery Exteriorization: A Model for Investigating the Cellular Dynamics Involved in Angiogenesis

Microvacular network growth and remodeling are critical aspects of wound healing, inflammation, diabetic retinopathy, tumor growth and other disease conditions1, 2. Network growth is commonly attributed to angiogenesis, defined as the growth of new vessels from pre-existing vessels. The angiogenic process is also directly linked to arteriogenesis, defined as the capillary acquisition of a perivascular cell coating and vessel enlargement. Needless to say, angiogenesis is complex and involves multiple players at the cellular and molecular level3. Understanding how a microvascular network grows requires identifying the spatial and temporal dynamics along the hierarchy of a network over the time course of angiogenesis. This information is critical for the development of therapies aimed at manipulating vessel growth.
The exteriorization model described in this article represents a simple, reproducible model for stimulating angiogenesis in the rat mesentery. It was adapted from wound-healing models in the rat mesentery4-7, and is an alternative to stimulate angiogenesis in the mesentery via i.p. injections of pro-angiogenic agents8, 9. The exteriorization model is attractive because it requires minimal surgical intervention and produces dramatic, reproducible increases in capillary sprouts, vascular area and vascular density over a relatively short time course in a tissue that allows for the two-dimensional visualization of entire microvascular networks down to single cell level. The stimulated growth reflects natural angiogenic responses in a physiological environment without interference of foreign angiogenic molecules. Using immunohistochemical labeling methods, this model has been proven extremely useful in identifying novel cellular events involved in angiogenesis. Investigators can readily correlate the angiogenic metrics during the time course of remodeling with time specific dynamics, such as cellular phenotypic changes or cellular interactions4, 5, 7, 10, 11.

This article describes a simple model for stimulating angiogenesis in the rat mesentery. The model produces dramatic increases in capillary sprouting, vascular area and vascular density over a relatively short time course in a tissue that allows en face visualization of entire microvascular networks down to the single cell level.

Microvacular network growth and remodeling are critical aspects of wound healing, inflammation, diabetic retinopathy, tumor growth and other disease ...

Biology

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

A Cryo-pulverization Protocol for Processing Mouse Paws to Evaluate Molecular Pathways of Tissue Inflammation in a Collagen Induced Arthritis Model

Profiling molecular changes in local tissues is crucial to understand the mechanism(s) of action of therapeutic candidates in vivo. In the field of arthritis research, many studies are focused on inflamed joints that are composed of a complex mixture of bone, cartilage, muscle, stromal cells and immune cells. Here, we established a reliable and robust mechanical method to disrupt inflamed mouse paws into homogeneous pulverized samples in a cryogenically controlled environment. Protein and RNA lysates were processed to enable proteomic and transcriptional endpoints and molecular characterization of relevant disease pathways in local tissue.

A cryogenic pulverization method to process murine paws using a liquid nitrogen freezer mill was developed to improve the yield and quality of RNA or protein extracted from the tissues and enable the analysis of molecular profiles associated with inflammatory responses.

Profiling molecular changes in local tissues is crucial to understand the mechanism(s) of action of therapeutic candidates in vivo. In the field of ...

Two Peeling Methods for the Isolation of Photoreceptor Cell Compartments in the Mouse Retina for Protein Analysis

Rod photoreceptors are highly polarized sensory neurons with distinct compartments. Mouse rods are long (~80 &#181;m) and thin (~2 &#181;m) and are laterally packed in the outermost layer of the retina, the photoreceptor layer, resulting in alignment of analogous subcellular compartments. Traditionally, tangential sectioning of the frozen flat-mounted retina has been used to study the movement and localization of proteins within different rod compartments. However, the high curvature of the rod-dominant mouse retina makes tangential sectioning challenging. Motivated by the study of protein transport between compartments, we developed two peeling methods that reliably isolate the rod outer segment (ROS) and other subcellular compartments for western blots. Our relatively quick and simple techniques deliver enriched and subcellular-specific fractions to quantitatively measure the distribution and redistribution of important photoreceptor proteins in normal rods. Moreover, these isolation techniques can also be easily adapted to isolate and quantitatively investigate the protein composition of other cellular layers within both healthy and degenerating retinae.

This protocol presents two techniques to isolate the subcellular compartments of murine rod photoreceptors for protein analysis. The first method utilizes live retinae and cellulose filter paper to separate rod outer segments, while the second employs lyophilized retinae and adhesive tape to peel away rod inner and outer segment layers.

Rod photoreceptors are highly polarized sensory neurons with distinct compartments. Mouse rods are long (~80 &#181;m) and thin (~2 &#181;m) and are ...

Neuroscience

Laser Capture Microdissection of Highly Pure Trabecular Meshwork from Mouse Eyes for Gene Expression Analysis

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great tool for the study of the molecular mechanisms underlying cell differentiation and the development and progression of various diseases, including glaucoma. Glaucoma, which comprises a family of progressive optic neuropathies, is the most common cause of irreversible blindness worldwide. Structural changes and damage within the trabecular meshwork (TM) can result in increased intraocular pressure (IOP), which is a major risk factor for developing glaucoma. However, the precise molecular mechanisms involved are still poorly understood. The ability to perform gene expression analysis will be crucial in obtaining further insights into the function of these cells and its role in the regulation of IOP and glaucoma development. To achieve this, a reproducible method for isolating highly enriched TM from frozen sections of mouse eyes and a method for downstream gene expression analysis, such as RT-qPCR and RNA-Seq is needed. The method described herein is developed to isolate highly pure TM from mouse eyes for downstream digital PCR and microarray analysis. In addition, this technique can be easily adapted for the isolation of other highly enriched ocular cells and cell compartments that have been difficult to isolate from mouse eyes. The combination of LCM and RNA analysis can contribute to a more comprehensive understanding of the cellular events underlying glaucoma.

Here, we describe a protocol for a reproducible laser capture microdissection (LCM) for isolating trabecular meshwork (TM) for downstream RNA analysis. The ability to analyze changes in gene expression in the TM will help in understanding the underlying molecular mechanisms of TM-related ocular diseases.

Laser capture microdissection (LCM) has allowed gene expression analysis of single cells and enriched cell populations in tissue sections. LCM is a great ...

Laser Capture Microdissection on Surgical Tissues to Identify Aberrant Gene Expression in Impaired Wound Healing in Type 2 Diabetes

The global prevalence Type 2 diabetes mellitus (T2DM) is escalating at a rapid rate. Patients with T2DM suffer from a multitude of complications and one of these is impaired wound healing. This can lead to the development of non-healing sores or foot ulcers and ultimately to amputation. In healthy individuals, wound healing follows a controlled and overlapping sequence of events encompassing inflammation, proliferation, and remodelling. In T2DM, one or more of these steps becomes dysfunctional. Current models to study impaired wound healing in T2DM include in vitro scratch wound assays, skin equivalents, or animal models to examine molecular mechanisms underpinning wound healing and/or potential therapeutic options. However, these do not fully recapitulate the complex wound healing process in T2DM patients, and ex vivo human skin tests are problematic due to the ethics of taking punch biopsies from patients where it is known they will heal poorly. Here, a technique is described whereby expression profiles of the specific cells involved in the (dys)functional wound healing response in T2DM patients can be examined using surplus tissue discarded following amputation or elective cosmetic surgery. In this protocol samples of donated skin are collected, wounded, cultured ex vivo in the air liquid interface, fixed at different time points and sectioned. Specific cell types involved in wound healing (e.g., epidermal keratinocytes, dermal fibroblasts (papillary and reticular), the vasculature) are isolated using laser capture microdissection and differences in gene expression analyzed by sequencing or microarray, with genes of interest further validated by qPCR. This protocol can be used to identify inherent differences in gene expression between both poorly healing and intact skin, in patients with or without diabetes, using tissue ordinarily discarded following surgery. It will yield greater understanding of the molecular mechanisms contributing to T2DM chronic wounds and lower limb loss.

This technique provides a guide to inflicting ex vivo wounds, performing laser capture microdissection and quantifying changes in gene expression related to poor wound healing processes in diabetes using clinically relevant human tissue.

The global prevalence Type 2 diabetes mellitus (T2DM) is escalating at a rapid rate. Patients with T2DM suffer from a multitude of complications and one ...

Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein

Samenvatting

Meer video's verkennen